Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Jan 31.
Published in final edited form as: J Orthop Res. 2014 Oct 27;33(2):199–207. doi: 10.1002/jor.22745

Targeting CDK11 in osteosarcoma cells using the CRISPR-Cas9 system

Yong Feng 1,2, Slim Sassi 3, Jacson K Shen 1, Xiaoqian Yang 1, Yan Gao 1, Eiji Osaka 1, Jianming Zhang 4, Shuhua Yang 2, Cao Yang 2, Henry J Mankin 1, Francis J Hornicek 1, Zhenfeng Duan 1
PMCID: PMC4304907  NIHMSID: NIHMS626583  PMID: 25348612

Abstract

Osteosarcoma is the most common type primary malignant tumor of bone. Patients with regional osteosarcoma are routinely treated with surgery and chemotherapy. In addition, many patients with metastatic or recurrent osteosarcoma show poor prognosis with current chemotherapy agents. Therefore, it is important to improve the general condition and the overall survival rate of patients with osteosarcoma by identifying novel therapeutic strategies. Recent studies have revealed that CDK11 is essential in osteosarcoma cell growth and survival by inhibiting CDK11 mRNA expression with RNAi. Here, we apply the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 system, a robust and highly efficient novel genome editing tool, to determine the effect of targeting endogenous CDK11 gene at the DNA level in osteosarcoma cell lines. We show that CDK11 can be efficiently silenced by CRISPR-Cas9. Inhibition of CDK11 is associated with decreased cell proliferation and viability, and induces cell death in osteosarcoma cell lines KHOS and U-2OS. Furthermore, the migration and invasion activities are also markedly reduced by CDK11 knockout. These results demonstrate that CRISPR-Cas9 system is a useful tool for the modification of endogenous CDK11 gene expression, and CRISPR-Cas9 targeted CDK11 knockout may be a promising therapeutic regimen for the treatment of osteosarcoma.

Keywords: Osteosarcoma, CRISPR-Cas9, CDK11

Introduction

Osteosarcoma is the most common type of primary malignant bone tumor. Traditional treatments of osteosarcoma involve surgery with adjuvant systemic chemotherapy with several chemotherapeutic agents, such as doxorubicin, cisplatin, ifosfamide, and methotrexate. 1; 2 However, if these agents fail to show favorable tumor response, further chemotherapeutic options are very limited. In addition, despite aggressive chemotherapy, many patients with metastatic or recurrent osteosarcoma show poor prognosis and poor response to current chemotherapy agents. Most of these relapsed patients will eventually develop multidrug resistance in the late stages of osteosarcoma; the average survival period after metastases is less than one year. Therefore, to improve the survival rate of osteosarcoma patients and their overall well-being, novel therapeutic strategies are urgently needed.

The discovery of oncogenic kinases and target-specific small-molecule inhibitors has revolutionized the treatment of a select group of cancers, including chronic myeloid leukemia (CML) with BCR-ABL, gastrointestinal stromal tumors (GIST) with c-KIT, and non-small cell lung cancer with EGFR. However, the therapeutic value of targeting kinases in osteosarcoma is still unknown. Protein kinases play important roles in regulating cellular functions and are critical for tumorigenesis, proliferation/survival, cell metabolism, apoptosis, DNA damage repair, cell motility, and drug resistance. In an effort to identify new therapeutic targets in osteosarcoma, we found that knockdown of CDK11 (cyclin-dependent kinase 11, also known as CDC2L for cell division cycle 2-like or PITSLRE) by short hairpin RNA (shRNA) or short interfering RNA (siRNA) inhibited tumor cell growth and induced apoptosis.3 Importantly, nuclear CDK11 expression levels correlated with clinical prognosis in osteosarcoma patients. Systemic in vivo administration of in vivo ready CDK11 siRNA reduced tumor growth in an osteosarcoma xenograft model. These observations demonstrate that CDK11signaling is essential in osteosarcoma cell growth and survival, and that CDK11 may be a promising therapeutic target in the management of osteosarcoma.

Thus far, siRNA and shRNA have been used to target CDK11 at the post-transcriptional mRNA level. Despite their high transfection efficiency, siRNA and viral based shRNA approaches face serious challenges. Naked siRNA is unstable in circulation due to serum RNase A-type nucleases and rapid renal clearance, resulting in degradation and a short half-life4. High costs for producing large amounts of synthetic siRNA stocks for clinical use and limited quantities of nucleic acids that can be packaged for shRNA therapy also limit the applications of viral delivery systems5. In addition, several gene therapy trials based on viral delivery systems have produced adverse effects, bringing their safety into question6; 7. It is, therefore, important to develop safe and effective CDK11 targeting systems.

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Cas9 protein is a genome editing tool, which allows for specific genome disruption and replacement in a flexible and simple system.8; 9 The system uses a nuclease, Cas9, that complexes with single guide RNA (sgRNA) to cleave DNA and generate double-strand breaks in a sequence-specific manner upstream of the protospacer-adjacent-motif (PAM - the sequence NGG) in any genomic locus.10–16 Subsequent cellular DNA repair processes lead to desired insertions, deletions, or substitutions at target sites through homologous recombination (HR) or non-homologous end joining (NHEJ). Compared with RNAi technology, CRISPR possesses a number of advantages.12; 15; 16 First, CRISPR is an exogenous system that does not compete with endogenous processes, such as microRNA expression or function. Furthermore, CRISPR functions at the DNA level targeting transcripts, such as noncoding RNAs, microRNAs, antisense transcripts, nuclear-localized RNAs, and polymerase III transcripts, which results in knockout or complete elimination of gene function. Finally, CRISPR provides a much larger targetable sequence space, including promoters and, in theory, exons may also be targeted.

CRISPR-Cas9 provides a robust and highly efficient novel genome editing tool, which enables precise manipulation of specific genomic loci, and facilitates elucidation of target gene functions or diseases. This tool has previously been applied to induce manipulation of pluripotent stem (iPS) cells, genome editing, and gene therapy studies.17–20 CRISPR-Cas9 mediated gene knockout has also been utilized in human glioblastoma cell lines.21 A genome-scale CRISPR-Cas9 knockout library has been generated to identify genes essential for cell viability in cancer cells.22 CRISPR-Cas9 has demonstrated that it is feasible for gene disruption and powerful in in situ genetic screens in the chemoresistant lymphomas model.23 In addition, dimeric RNA-guided CRISPR-Cas9 can recognize extended sequences and edit endogenous genes with high efficiency in human cancer cells.24

CRISPR-Cas9 is an easy and reliable genome editing tool that can rapidly extend to a wide array of biological systems and diseases. In this study, we apply a CRISPR-Cas9 system specifically inhibiting CDK11 at the DNA level in osteosarcoma cells, and further determine the effects of CDK11 knockout on osteosarcoma cell growth, proliferation, migration, and invasion.

Materials and Methods

Cell Lines and Cell Culture

The human osteosarcoma cell line KHOS was kindly provided by Dr. Efstathios Gonos (Institute of Biological Research & Biotechnology, Athens, Greece). The human osteosarcoma cell line U-2OS was obtained from the American Type Culture Collection (Rockville, Maryland, USA). Both cell lines were cultured in RPMI 1640 from Invitrogen (Carlsbad, CA) supplemented with 10% FBS, 100-U/ml penicillin, and 100 mg/ml streptomycin (Invitrogen, NY). Cells were incubated in a humidified atmosphere containing 5% CO2 and 95% air at 37°C.

CRISPR-Cas9 Plasmid Design and Purification

The CRISPR-Cas9 and green fluorescent protein (GFP) fusion protein expression vector U6gRNA-Cas9-2A-GFP guide by CDK11 sgRNA (abbreviated as CDK11-Cas9-GFP) was purchased from Sigma-Aldrich (St. Louis, MO) (Fig. 1A). GFP is co-expressed from the same mRNA as the Cas9 protein via a 2A peptide linkage, which enables tracking of transfection efficiency. The exon of CDK11 selected for guide RNA design is located at the fourth coding exon (Fig. 1B); CDK11 guide RNA sequence is as follow: TCCGAGACATTTGCTGGGGTGG (Fig. 1C). The pEGFP-N3 plasmid was purchased from Clontech (Mountain View, CA). Plasmids were purified using QIAGEN Plasmid Mega Kits (Hilden, Germany). Plasmid purification protocols were followed according to the plasmid purification QIAGEN Plasmid Purification Handbook. To determine the yield of plasmid, DNA concentrations were determined by both UV spectrophotometry at 260 nm and quantitative analysis on an agarose gel.

Figure 1.

Figure 1

Open in a new tab

(A) Schematic of U6 gRNA-CMV Cas9-GFP expression cassette in the single-plasmid system. GFP is co-expressed from the same mRNA as the Cas9 protein via a 2A peptide linkage, which enable tracking of transfection efficiency. Guide RNA sequence is: TCCGAGACATTT GCTGGGGTGG. Exon of CDK11 selected for guide RNA design is located on the fourth coding exon. The human U6 promoter is used to drive gRNA expression, while CMV promoter drives expression of Cas9 and GFP proteins. (B) Position of the frameshift that CRISPR-Cas9 knockout is located at exon 4 within the CDK11B gene (NM_033486.1-CDK11B). (C) Schematic structure of CRISPR-Cas9 system functions on targeting CDK11 gene. CRISPR-Cas9 system utilizes a fusion between a crRNA and part of the tracrRNA sequence. This single single-guide RNA (sgRNA) complexes with Cas9 to mediate cleavage of target DNA sites that are complementary to the 5′- 19 nt of the gRNA and that lie next to a Protospacer Adjacent Motif (PAM) sequence. Target sequence (including PAM) is: TCCGAGACATTTGCTGGGG TGG. Complementary sequence is: CCACCCCAGCAAATGTCTCGGA.

Optimization Electroporation Transfection

Transfections were performed with Neon™ Transfection System (Grand Island, NY) following the manufacturer’s instructions and Optimization Protocol. In brief, osteosarcoma cells were cultured to 80–90% confluence, then harvested and washed in phosphate buffered saline (PBS) without Ca2+ and Mg2+. 24-well plates were prepared by filling the wells with the 0.5 mL of culture medium containing serum and supplements without antibiotics and pre-incubated at 37°C in a humidified 5% CO2 incubator. Cell pellets were resuspended in the appropriate resuspension buffer (included with Neon™ Kits) at a final density of 5.0 × 106 cells/ml. Each electroporation sample used the 10 μL Neon™ Tip in 24-well format. One Neon™ Tube was set up with 4 mL electrolytic buffer into the Neon™ Pipette Station containing the cell-DNA (0.5 μg DNA/well) mixture. The optimization protocols were loaded to begin electroporation using the 24 diverse parameters with different pulse voltage, pulse width, and pulse number. After electroporation, cells were seeded into the prepared plates.

Fluorescence Microscope

To observe the viability of CRISPR in osteosarcoma, KHOS and U-2OS cells were transfected with CDK11-Cas9-GFP or pEGFP-N3. Then, 5 × 104 cells per well were plated in 24-well plates, and incubated for 96 h. Detection was performed under fluorescence. Osteosarcoma cells were then visualized on a Nikon Eclipse Ti-U fluorescence microscope (Nikon Instruments, Inc., NY) equipped with a SPOTRT digital camera from Diagnostic Instruments, Inc. (Sterling Heights, MI).

MTT Assay

Briefly, after electroporation with CDK11-Cas9-GFP or pEGFP-N3, KHOS and U-2OS cells were seeded in 96-well plates with 2 × 103 cells per well for MTT assay. Each 96-well plate received complete growth medium without antibiotics per well in a volume of 100 μL in triplicate. Cell growth and proliferation was determined using the MTT assay. After incubation, 20 μL of MTT (5mg/mL, Sigma, MO) was added, followed by incubation for another 4 h at 37°C. The MTT formazan products were dissolved in acid-isopropanol. The absorbance was measured at a wavelength of 490 nm on a SPECTRAmax Microplate Spectrophotometer from Molecular Devices (Sunnyvale, CA). All procedures were repeated for five consecutive days. Experiments were performed in triplicate. All data were analyzed using GraphPad Prism 5 software from GraphPad Software, Inc. (San Diego, CA).

Western Blotting

Expression of CDK11 protein was evaluated by Western Blot. Protein lysates from osteosarcoma cells were extracted using 1× Cell Lysis Buffer (Cell Signaling Technology, MA). The protein concentrations were determined by Protein Assay Reagents (Bio-Rad, CA) and a SPECTRAmax Microplate Spectrophotometer from Molecular Devices (Sunnyvale). The primary antibodies for CDK11 (1:1000 dilution), Integrin β 3 (1:1000 dilution), MT1-MMP (1:1000 dilution), VEGF (1:1000 dilution) and actin (1:2000 dilution) were purchased from Cell Signaling Technology, Abcam, and Sigma-Aldrich, respectively. Secondary antibodies IRDye® 800CW or IRDye® 680LT were purchased from LI-COR (Biosciences, NE). Western blot analyses were carried out as previously described.25 Membrane signals were scanned using the Odyssey infrared imaging system and analyzed using Odyssey 3.0 software (LI-COR Biosciences). Relative expression values were normalized assigning the value of the cells in control groups to 1.0.

Wound Healing Assay

Cell migration activity was detection by wound healing assay. In brief, after transfection with CDK11-Cas9-GFP or pEFGP-N2, 2 × 105 cells were seeded onto 12-well plates. On the second day after cells reached 80–90% confluence, the cells were scraped in three parallel lines with a 200 μL tip, then washed three times with serum-free medium and incubated in regular medium. The wounds were observed at 0, 8, and 24 h after wounding, and photographed via microscope (Nikon Instruments, Inc.). Three images were taken per well at each time point using a 10 × objective, and the distance between the two edges of the scratch (wound width) was measured at 10 sites in each image. The cell migration distance was determined by measuring the wound width at each time point from the wound width at the 0 h time point and then dividing by two.

Matrigel Invasion Assay

Cell invasion activity was evaluated by Matrigel invasion assay with a BD BioCoat™ Matrigel™ Invasion Chamber (Becton-Dickinson, MA) according to the manufacturer’s instructions. In brief, 24 hours after transfection with CDK11-Cas9-GFP or pEFGP-N2, 5 × 104 cells were seeded into the upper chamber of each well in serum-free medium, and the bottom chambers were filled with medium containing 10% FBS without antibiotics. After a 22 h incubation period, the non-invading cells were removed by scrubbing from the upper surface of the membrane with two cotton swabs. After washing the cells with medium, regular medium with 1 μg/mL Hoechst 33342 (Invitrogen) was used to stain nuclei of the invading cells for 5 minutes. Images were acquired by Nikon Eclipse Ti-U fluorescence microscope and phase contrast microscope equipped with a SPOT RT digital camera. The number of invading cells was counted in three images per membrane by microscopy using a 20 × objective.

Statistical Analysis

GraphPad PRISM 5 software (GraphPad Software, Inc) was used to statistically analyze the data. The differences between groups were also evaluated using the two-sided Student’s t-test. Errors were SD of averaged results and p values < 0.05 were considered statistically significant between means, p values < 0.01 were accepted as a significant difference between means.

Results

CRISPR-Cas9 Decreases Cell Viability and Induces Cell Death

Previous studies have shown that transfection of CDK11 siRNA into osteosarcoma cell lines induces apoptosis.3 In this study, the optimization electroporation parameter applied was: pulse voltage, 1230; pulse width, 10; pulse number, 4, which achieved 70–80% transfection (data not showed). KHOS and U-2OS cells were successfully transfected with CDK11-Cas9-GFP or pEGFP-N3. The green fluorescence KHOS cells were significantly decreased in cells with CDK11-Cas9-GFP transfection during the observation period (Fig. 2A). CDK11 knockout by CRISPR-Cas9 dramatically decreased cell survival of KHOS at 48 h and almost extinguished the KHOS cells at 96 h, whereas pEGFP-N3 had no effects on cell growth of KHOS cells. Likewise, the growth of U-2OS cells transfected with CDK11-Cas9-GFP was significantly inhibited in a time dependent manner, while pEGFP-N3 had no effect on cell survival of U-2OS either (Fig. 2B). More importantly, KHOS or U-2OS cells that failed to transfect with CDK11-Cas9-GFP showed no effect on cell viability. These results showed that CDK11 knockout by CRISPR-Cas9 markedly decreased cell viability and induced cell death in osteosarcoma cell lines.

Figure 2.

Figure 2

Open in a new tab

Fluorescence analysis shows that transfection with CDK11-Cas9-GFP plasmid decreases CDK11-expressed cells in KHOS and U-2OS cell lines. (A and B) KHOS and U-2OS were transfected with CDK11-Cas9-GFP or pEGFP-N3 plasmids. Cells were visualized from 24 h - 96 h on a Nikon Eclipse Ti-U fluorescence microscope equipped with a SPOT RT digital camera. The expression levels of CDK11-expressed cells were significantly decreased in cells transfected with CDK11-Cas9-GFP.

CRISPR-Cas9 Significantly Inhibits CDK11 Expression

CRISPR-Cas9 mediated gene knockout was established in tumor cells. CRISPR-Cas9 precisely enables specific genomic locus manipulating by providing sgRNA. To evaluate whether CRISPR-Cas9 complexed with CDK11 sgRNA could inhibit CDK11 expression, western blotting was performed. The assay demonstrated that CDK11 protein expression was markedly inhibited in KHOS cells transfected with CRISPR-Cas9 (Fig. 3A). CDK11 expression of KHOS was repressed 8–12 fold at 48 h (p<0.01) and repressed 6–12 fold at 72 h (p < 0.01) (Fig. 3C). In the U-2OS cell line transfected with CRISPR-Cas9, CDK11 protein expression was significantly suppressed in a time-dependent manner (Fig. 3B). CDK11 expression in U-2OS was repressed 3–5 fold at 48 h (p < 0.01) and repressed 7–15 fold at 72 h (p < 0.01) (Fig. 3D). Furthermore, integrin β3, VEGF, and MT1-MMP protein expressions were also significantly decreased in both osteosarcoma cell lines (Fig. 3A and B). These data revealed that CDK11 expression was efficiently repressed in osteosarcoma cell lines transfected with CRISPR-Cas9.

Figure 3.

Figure 3

Open in a new tab

Expression of CDK11 protein was significantly decreased in CRISPR-Cas9 mediated CDK11 knockdown cells. (A and B) Western blotting analysis confirmed that knockdown of CDK11 by CDK11-Cas9-GFP significantly decreased the CDK11 protein in KHOS and U-2OS. Furthermore, integrin β3, VEGF and MT1-MMP protein expression were also significantly decreased. (C and D) CDK11 protein after transfection with CDK11-Cas9-GFP of KHOS and U-2OS were quantitatively evaluated at 24–72 h. Relative expression values were normalized assigning the value of the cells in control groups to 1.0. * p < 0.05, ** p < 0.01. (comparison transfected cells with control cells using Student’s t-test).

Knockout of CDK11 by CRISPR-Cas9 Inhibits Cell Viability

Previous studies have shown that transfection of CDK11 shRNA or siRNA into osteosarcoma cell lines inhibits cell growth in a dose-dependent manner. In this study, KHOS and U-2OS cells were transfected with CDK11-Cas9-GFP or pEGFP-N3 plasmid. The MTT assay demonstrated that KHOS cells transfected with CDK11-Cas9-GFP significantly inhibited cell growth after 96h (p < 0.01), while cells transfected with pEGFP-N3 revealed no inhibition of growth compared with control groups (Fig. 4A). U-2OS cells transfected with CDK11-Cas9-GFP showed that cell growth was notably suppressed after 72 h, and proliferation was completely arrested during the observation period (Fig. 4B). These results confirm that CDK11 is critical for osteosarcoma cell growth. Moreover, CRISPR-Cas9 mediated CDK11 knockout induced growth arrest in a time-dependent manner in both osteosarcoma cell lines KHOS and U-2OS.

Figure 4.

Figure 4

Open in a new tab

CDK11-Cas9-GFP inhibits cell proliferation in KHOS and U-2OS cells. (A and B) KHOS and U-2OS were transfected with CDK11-Cas9-GFP or pEGFP-N3 plasmids and incubated 24–96 h. Cell proliferation after transfection was determined by SPECTRAmax Microplate Spectrophotometer. * p < 0.05, ** p < 0.01.

CDK11 Knockout Suppressed the Migratory Activity of Osteosarcoma Cells

Recent studies have shown that CDKs and their cyclin family are important for cell migration in several types of tumors.26–29 However, direct evidence demonstrating the relationship between expression of CDK11 and migration and invasion of cancer cells is lacking. We assessed whether knockout of CDK11 by CRISPR-Cas9 transfection could affect the migratory activity of osteosarcoma cells using a wound healing assay. Because the wound was covered in control cells after 48 h, we observed the wound distance after 0, 8, and 24 h (Fig. 5A and C). During the 24 h incubation, the U-2OS and KHOS cells transfected with CDK11-Cas9-GFP migrated only 64.50 and 73.00mm, respectively. On the other hand, U-2OS and KHOS cells transfected with pEFGP-N3 migrated 150.70 and 138.75 mm, respectively, from the scratch defect (Fig. 5B and D). These data demonstrated that osteosarcoma cell migratory activities were significantly suppressed in CDK11-Cas9-GFP transfected cells as compared with pEFGP-N2 transfected and control cells.

Figure 5.

Figure 5

Open in a new tab

Transfection of CDK11-Cas9-GFP suppressed the migratory activities of osteosarcoma cells. KHOS and U-2OS cells were transfected with either CDK11-Cas9-GFP or pEFGP. (A) Micrographs of osteosarcoma U-2OS cells at 0, 8, and 24 h after wounding. (B) Migration distance of U-2OS for each time point and condition. (C) Micrographs of osteosarcoma KHOS cells at 0, 8, and 24 h after wounding. (D) Migration distance of KHOS for each time point and condition. * p < 0.05, ** p < 0.01. (comparison transfected cells with control cells using Student’s t-test).

CDK11 Knockout Repressed the Invasive Activity of Osteosarcoma Cells

We next assessed whether CDK11-Cas9-GFP transfection of osteosarcoma cells affected their invasive activities using a matrigel invasion assay. Hoechst 33342 was used to stain the nuclei of living invasive cells. After electroporation transfection, the matrigel invasion assay revealed significant inhibition of the invasive activities of CDK11-Cas9-GFP transfected U-2OS cells (Fig. 6A). The average number of invasive osteosarcoma cells transfected with CDK11-Cas9-GFP was 23.5. In contrast, the average number of invasive osteosarcoma cells transfected with pEFGP-N3 and control cells were 118.7 and 131.0, respectively (Fig. 6B). These results showed that osteosarcoma cell invasion activities were significantly repressed in CDK11-Cas9-GFP transfected cells.

Figure 6.

Figure 6

Open in a new tab

Transfection of CDK11-Cas9-GFP suppressed the invasive activities of osteosarcoma cells. U-2OS cells were transfected with either CDK11-Cas9-GFP or pEFGP. (A) Micrographs and fluorescence microscopy of osteosarcoma U-2OS cells transfected with CDK11-Cas9-GFP; Hoechst 33342 was used to stained cell nuclei. (B) The average numbers of invasive osteosarcoma cells among those transfected with CDK11-Cas9-GFP or p-EFGP. * p < 0.05, ** p < 0.01. (comparison transfected cells with control cells using Student’s t-test).

Discussion

This study applies the CRISPR-Cas9 system, Cas9 in complex with sgRNA, to cleave CDK11. CRISPR-Cas9 functions at the DNA level and can target genes at any locus including promoters.7,10,11 The position of the CDK11 sgRNA target is located on exon 4 of the CDK11B gene (Fig. 1B); this CRISPR-Cas9 mediates cleavage of targets on DNA sites that are complementary to the 5′- 19 nt of the sgRNA that lie next to a PAM sequence (Fig. 1C). It has been demonstrated that the CRISPR-Cas9 system directly blocks transcription initiation and elongation.15 The non-template DNA strand shares the same sequence as the transcribed mRNA and only sgRNAs that bind to the non-template DNA strand exhibit silencing.15 Another group has shown that CRISPR-Cas9 can also efficiently repress transcription.12 Furthermore, endogenous gene activation was achieved when sgRNA targeted genes were introduced into cells.10 Therefore, CRISPR- Cas9 provides a novel tool for switching gene expression at the DNA level.

CRISPR-Cas9 system guided gene targeting is highly specific. Our study shows that CRISPR-Cas9 guided by CDK11 sgRNA markedly decreased cell viability and induced cell death in osteosarcoma cell lines, whereas pEGFP-N3 had no effect on KHOS or U-2OS cell lines. It has been demonstrated that the mRFP transcript transfected with CRISPR system is the sole gene that exhibited a decrease in abundance, which was examined by whole-transcriptome sequencing (RNA-seq).15 Another RNA-seq showed GFP to be the only gene product that was significantly suppressed by the GFP-targeting sgRNA.12 Using microarray experiments to compare genome-wide gene expression profiles also revealed that the CRISPR-Cas9 system is highly specific.10 These studies imply that CDK11 sgRNA-guided CRISPR-Cas9 can specifically knockout CDK11.

Robust gene knockdown has been observed in both reporter and endogenous genes by CRISPR-Cas9 system.12 Consistent with this, CRISPR-Cas9 with CDK11 sgRNA significantly silences CDK11 protein expression. There are several factors that affect repression efficiency. Firstly, transfection efficiency may slightly eliminate gene expression. Common lentiviral constructs are used to express both Cas9 and sgRNAs, which reveals 5- to 15-fold repression of both reporter and endogenous genes.12 The results are consistent with our findings that CDK11 expression is repressed 8- to 12-fold. This is comparable to the efficiency of existing gene knockdown techniques, such as RNAi and TALE proteins. Secondly, the location of the sgRNA target sequence along the gene is important for efficiency. It was shown that sgRNAs were designed to cover the full length of the coding regions for both mRFP and sfGFP.15 In all of these cases, repression was inversely correlated with the target distance from the transcription start site. The same results were shown in another group; the most efficient gene activation was achieved by clusters of 3–4 sgRNAs binding to the proximal promoters.11 The CDK11 sgRNA in this study binds at the fourth exon of the CDK11B gene, which may also affect silencing efficiency of CRISPR-Cas9.

Our study shows that CDK11 knockout by CRISPR-Cas9 extensively inhibited cell proliferation and induced cell death, in both osteosarcoma cell lines KHOS and U-2OS, which implies that CDK11 plays an important role in osteosarcoma cell proliferation and growth. CDK11 knockout mice cannot survive past the blastocyst stage of embryonic development30. The CDK11 null cells exhibit proliferative defects, mitotic arrest, and apoptosis30. These are consistent with previous studies that expression of CDK11is essential for cell growth and survival in osteosarcoma cells and liposarcoma cells.3; 31 Many studies have revealed that CDK11p58 and CDK11p46, as well as CDK11p110 are involved in apoptotic signaling or cell cycle arrest3; 30–33. Another potential mechanism of CDK11 knockout that induced cell growth inhibition in osteosarcoma cells may relate to the critical role that CDK11 plays in the regulation of cellular RNA transcription and processing. CDK11 interacts with the general pre-mRNA splicing factors RNPS1 and 9G8, RNA polymerase II (RNAP II), Cyclin-L, casein kinase 2 (CK2), and checkpoint kinase 2 (CHK2), which effect on certain proteins required for cell cycle progression and apoptosis34–36. CDK11 is also a modulator of autophagy in human cells37.

In this study, we also demonstrate that knockout of CDK11 inhibits cell migratory and invasive activities in osteosarcoma cells. There are several potential molecular alterations associated with cell migration and invasion. Degradation of the Extracellular Matrix (ECM), facilitated by the action of Matrix Metallo Proteinases (MMPs), is a prerequisite of tumor invasion and metastasis in a variety of human cancers, including osteosarcoma.38–40 The Wnt/β-catenin pathway and its antagonists are involved in osteosarcoma progression, including invasion and metastasis.41–44 Recent studies in osteosarcoma have uncovered novel targets for anti-metastatic strategies. CD99 expression increases MMP9 activity and stimulates the migration and metastasis of osteosarcoma; moreover, CD99 suppresses osteosarcoma cell migration through inhibition of ROCK2 activity.45–47 Consistent with previous studies, several invasion-associated cellular factors, such as integrin β 3, MT1-MMPs, and VEGF were also knocked down by CDK11-cas9-GFP in osteosarcoma cell lines (Figure 3A and B). Osteosarcoma migratory and invasive abilities are essential for the initial metastatic or recurrent process. Since pulmonary metastasis is the major cause of death in osteosarcoma, inhibiting migratory and invasive abilities would presumably decrease local recurrence or metastasis, thereby improving survival. Taken together, CDK11 is vital in osteosarcoma cell migration and invasion, and may be a potential target for improving the overall survival of osteosarcoma patients.

Conclusion

This study confirms that CDK11 is essential for osteosarcoma cell growth and survival, and that CDK11 is crucial for osteosarcoma cell migration and invasion. Furthermore, this is the first application of CRISPR-Cas9 targeting the CDK11 gene in osteosarcoma. Progress in the development of Cas9-based strategies over the past two years has been notable, but many interesting questions and applications remain to be addressed and explored.48; 49 Taken together, the CRISPR-Cas9 system holds great promise as a general genetic programming platform that is suitable for a variety of biomedical research and clinical applications, including genome-scale functional profiling, cell reprogramming, and gene therapy. With the simplicity and flexibility of CRISPR-Cas9, this strategy opens the door for elucidating gene function in osteosarcoma and correcting gene defects in musculoskeletal diseases.

Acknowledgments

This work was supported, in part, by the Gattegno and Wechsler funds, the Kenneth Stanton Fund. Dr. Duan is supported, in part, through a grant from Sarcoma Foundation of America (SFA), a grant from National Cancer Institute (NCI)/National Institutes of Health (NIH), UO1, CA 151452-01, a pilot grant from Sarcoma SPORE/NIH, and a grant from an Academic Enrichment Fund of MGH Orthopaedics. Dr. Feng is supported by the National Natural Science Foundation of China (NSFC), 81101375.

Footnotes

Conflict of Interest statement:

No potential conflicts of interest were disclosed authors.

References

  • 1.Geller DS, Gorlick R. Osteosarcoma: a review of diagnosis, management, and treatment strategies. Clinical advances in hematology & oncology : H&O. 2010;8:705–718. [PubMed] [Google Scholar]
  • 2.Luetke A, Meyers PA, Lewis I, et al. Osteosarcoma treatment - Where do we stand? A state of the art review. Cancer treatment reviews. 2014;40:523–532. doi: 10.1016/j.ctrv.2013.11.006. [DOI] [PubMed] [Google Scholar]
  • 3.Duan Z, Zhang J, Choy E, et al. Systematic kinome shRNA screening identifies CDK11 (PITSLRE) kinase expression is critical for osteosarcoma cell growth and proliferation. Clinical cancer research : an official journal of the American Association for Cancer Research. 2012;18:4580–4588. doi: 10.1158/1078-0432.CCR-12-1157. [DOI] [PubMed] [Google Scholar]
  • 4.Bumcrot D, Manoharan M, Koteliansky V, et al. RNAi therapeutics: a potential new class of pharmaceutical drugs. Nature chemical biology. 2006;2:711–719. doi: 10.1038/nchembio839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Pecot CV, Calin GA, Coleman RL, et al. RNA interference in the clinic: challenges and future directions. Nat Rev Cancer. 2011;11:59–67. doi: 10.1038/nrc2966. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Somia N, Verma IM. Gene therapy: trials and tribulations. Nature reviews Genetics. 2000;1:91–99. doi: 10.1038/35038533. [DOI] [PubMed] [Google Scholar]
  • 7.Huang PI, Lo WL, Cherng JY, et al. Non-viral delivery of RNA interference targeting cancer cells in cancer gene therapy. Current gene therapy. 2012;12:275–284. doi: 10.2174/156652312802083576. [DOI] [PubMed] [Google Scholar]
  • 8.Bhaya D, Davison M, Barrangou R. CRISPR-Cas systems in bacteria and archaea: versatile small RNAs for adaptive defense and regulation. Annual review of genetics. 2011;45:273–297. doi: 10.1146/annurev-genet-110410-132430. [DOI] [PubMed] [Google Scholar]
  • 9.Wiedenheft B, Sternberg SH, Doudna JA. RNA-guided genetic silencing systems in bacteria and archaea. Nature. 2012;482:331–338. doi: 10.1038/nature10886. [DOI] [PubMed] [Google Scholar]
  • 10.Cheng AW, Wang H, Yang H, et al. Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell research. 2013;23:1163–1171. doi: 10.1038/cr.2013.122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Cong L, Ran FA, Cox D, et al. Multiplex genome engineering using CRISPR/Cas systems. Science (New York, NY) 2013;339:819–823. doi: 10.1126/science.1231143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gilbert LA, Larson MH, Morsut L, et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell. 2013;154:442–451. doi: 10.1016/j.cell.2013.06.044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Hsu PD, Scott DA, Weinstein JA, et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nature biotechnology. 2013;31:827–832. doi: 10.1038/nbt.2647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Mali P, Yang L, Esvelt KM, et al. RNA-guided human genome engineering via Cas9. Science (New York, NY) 2013;339:823–826. doi: 10.1126/science.1232033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Qi LS, Larson MH, Gilbert LA, et al. Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell. 2013;152:1173–1183. doi: 10.1016/j.cell.2013.02.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Wang H, Yang H, Shivalila CS, et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell. 2013;153:910–918. doi: 10.1016/j.cell.2013.04.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Horii T, Tamura D, Morita S, et al. Generation of an ICF syndrome model by efficient genome editing of human induced pluripotent stem cells using the CRISPR system. International journal of molecular sciences. 2013;14:19774–19781. doi: 10.3390/ijms141019774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ding Q, Regan SN, Xia Y, et al. Enhanced efficiency of human pluripotent stem cell genome editing through replacing TALENs with CRISPRs. Cell stem cell. 2013;12:393–394. doi: 10.1016/j.stem.2013.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Miao J, Guo D, Zhang J, et al. Targeted mutagenesis in rice using CRISPR-Cas system. Cell research. 2013;23:1233–1236. doi: 10.1038/cr.2013.123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ebina H, Misawa N, Kanemura Y, et al. Harnessing the CRISPR/Cas9 system to disrupt latent HIV-1 provirus. Scientific reports. 2013;3:2510. doi: 10.1038/srep02510. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kranz D, Boutros M. A synthetic lethal screen identifies FAT1 as an antagonist of caspase-8 in extrinsic apoptosis. The EMBO journal. 2014;33:181–197. doi: 10.1002/embj.201385686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Shalem O, Sanjana NE, Hartenian E, et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science (New York, NY) 2014;343:84–87. doi: 10.1126/science.1247005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Malina A, Mills JR, Cencic R, et al. Repurposing CRISPR/Cas9 for in situ functional assays. Genes & development. 2013;27:2602–2614. doi: 10.1101/gad.227132.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Tsai SQ, Wyvekens N, Khayter C, et al. Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nature biotechnology. 2014 doi: 10.1038/nbt.2908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Osaka E, Yang X, Shen JK, et al. MicroRNA-1 (miR-1) inhibits chordoma cell migration and invasion by targeting slug. Journal of orthopaedic research : official publication of the Orthopaedic Research Society. 2014 doi: 10.1002/jor.22632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Zhong Z, Yeow WS, Zou C, et al. Cyclin D1/cyclin-dependent kinase 4 interacts with filamin A and affects the migration and invasion potential of breast cancer cells. Cancer research. 2010;70:2105–2114. doi: 10.1158/0008-5472.CAN-08-1108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zhang X, Cao Q, Liu X, et al. Cellular and molecular evidence for malignancy-inhibitory functions of p15RS. Cell cycle (Georgetown, Tex) 2012;11:1988–1998. doi: 10.4161/cc.20400. [DOI] [PubMed] [Google Scholar]
  • 28.Chow SE, Wang JS, Lin MR, et al. Downregulation of p57kip(2) promotes cell invasion via LIMK/cofilin pathway in human nasopharyngeal carcinoma cells. Journal of cellular biochemistry. 2011;112:3459–3468. doi: 10.1002/jcb.23277. [DOI] [PubMed] [Google Scholar]
  • 29.Warfel NA, Dolloff NG, Dicker DT, et al. CDK1 stabilizes HIF-1alpha via direct phosphorylation of Ser668 to promote tumor growth. Cell cycle (Georgetown, Tex) 2013;12:3689–3701. doi: 10.4161/cc.26930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Li T, Inoue A, Lahti JM, et al. Failure to proliferate and mitotic arrest of CDK11(p110/p58)-null mutant mice at the blastocyst stage of embryonic cell development. Molecular and cellular biology. 2004;24:3188–3197. doi: 10.1128/MCB.24.8.3188-3197.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Jia B, Choy E, Cote G, et al. Cyclin-dependent kinase 11 (CDK11) is crucial in the growth of liposarcoma cells. Cancer letters. 2014;342:104–112. doi: 10.1016/j.canlet.2013.08.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lahti JM, Xiang J, Heath LS, et al. PITSLRE protein kinase activity is associated with apoptosis. Molecular and cellular biology. 1995;15:1–11. doi: 10.1128/mcb.15.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Mikolajczyk M, Nelson MA. Regulation of stability of cyclin-dependent kinase CDK11p110 and a caspase-processed form, CDK11p46, by Hsp90. The Biochemical journal. 2004;384:461–467. doi: 10.1042/BJ20040848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Choi HH, Choi HK, Jung SY, et al. CHK2 kinase promotes pre-mRNA splicing via phosphorylating CDK11(p110) Oncogene. 2014;33:108–115. doi: 10.1038/onc.2012.535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Drogat J, Migeot V, Mommaerts E, et al. Cdk11-cyclinL controls the assembly of the RNA polymerase II mediator complex. Cell reports. 2012;2:1068–1076. doi: 10.1016/j.celrep.2012.09.027. [DOI] [PubMed] [Google Scholar]
  • 36.Loyer P, Trembley JH, Grenet JA, et al. Characterization of cyclin L1 and L2 interactions with CDK11 and splicing factors: influence of cyclin L isoforms on splice site selection. The Journal of biological chemistry. 2008;283:7721–7732. doi: 10.1074/jbc.M708188200. [DOI] [PubMed] [Google Scholar]
  • 37.Wilkinson S, Croft DR, O’Prey J, et al. The cyclin-dependent kinase PITSLRE/CDK11 is required for successful autophagy. Autophagy. 2011;7:1295–1301. doi: 10.4161/auto.7.11.16646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Xin ZF, Kim YK, Jung ST. Risedronate inhibits human osteosarcoma cell invasion. Journal of experimental & clinical cancer research : CR. 2009;28:105. doi: 10.1186/1756-9966-28-105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Cho HJ, Lee TS, Park JB, et al. Disulfiram suppresses invasive ability of osteosarcoma cells via the inhibition of MMP-2 and MMP-9 expression. Journal of biochemistry and molecular biology. 2007;40:1069–1076. doi: 10.5483/bmbrep.2007.40.6.1069. [DOI] [PubMed] [Google Scholar]
  • 40.Cheng YY, Huang L, Lee KM, et al. Alendronate regulates cell invasion and MMP-2 secretion in human osteosarcoma cell lines. Pediatric blood & cancer. 2004;42:410–415. doi: 10.1002/pbc.20019. [DOI] [PubMed] [Google Scholar]
  • 41.Rubin EM, Guo Y, Tu K, et al. Wnt inhibitory factor 1 decreases tumorigenesis and metastasis in osteosarcoma. Molecular cancer therapeutics. 2010;9:731–741. doi: 10.1158/1535-7163.MCT-09-0147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Leow PC, Tian Q, Ong ZY, et al. Antitumor activity of natural compounds, curcumin and PKF118-310, as Wnt/beta-catenin antagonists against human osteosarcoma cells. Investigational new drugs. 2010;28:766–782. doi: 10.1007/s10637-009-9311-z. [DOI] [PubMed] [Google Scholar]
  • 43.Iwaya K, Ogawa H, Kuroda M, et al. Cytoplasmic and/or nuclear staining of beta-catenin is associated with lung metastasis. Clinical & experimental metastasis. 2003;20:525–529. doi: 10.1023/a:1025821229013. [DOI] [PubMed] [Google Scholar]
  • 44.Haydon RC, Deyrup A, Ishikawa A, et al. Cytoplasmic and/or nuclear accumulation of the beta-catenin protein is a frequent event in human osteosarcoma. International journal of cancer Journal international du cancer. 2002;102:338–342. doi: 10.1002/ijc.10719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Zucchini C, Manara MC, Pinca RS, et al. CD99 suppresses osteosarcoma cell migration through inhibition of ROCK2 activity. Oncogene. 2014;33:1912–1921. doi: 10.1038/onc.2013.152. [DOI] [PubMed] [Google Scholar]
  • 46.Manara MC, Bernard G, Lollini PL, et al. CD99 acts as an oncosuppressor in osteosarcoma. Molecular biology of the cell. 2006;17:1910–1921. doi: 10.1091/mbc.E05-10-0971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Scotlandi K, Zuntini M, Manara MC, et al. CD99 isoforms dictate opposite functions in tumour malignancy and metastases by activating or repressing c-Src kinase activity. Oncogene. 2007;26:6604–6618. doi: 10.1038/sj.onc.1210481. [DOI] [PubMed] [Google Scholar]
  • 48.Zhang F, Wen Y, Guo X. CRISPR/Cas9 for genome editing: progress, implications and challenges. Human molecular genetics. 2014 doi: 10.1093/hmg/ddu125. [DOI] [PubMed] [Google Scholar]
  • 49.Sander JD, Joung JK. CRISPR-Cas systems for editing, regulating and targeting genomes. Nature biotechnology. 2014;32:347–355. doi: 10.1038/nbt.2842. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES