Abstract
Enterohemorrhagic Escherichia coli (EHEC) of the O157:H7 serotype is a worldwide zoonotic pathogen responsible for the majority of severe cases of human EHEC disease. The aim of the present study was to investigate the prevalence of E. coli O157: H7/NM in raw meat samples from two provinces of Iran. During a period from March 2010 to March 2011. Two hundred and ninety five raw meat samples were collected from beef (n= 85), camel, (n= 50), sheep (n= 62), goat (n= 60), and water buffalo (n=38). Fourteen (4.7%) of the 295 samples were positive for E. coli O157. The highest prevalence of E. coli O157 was found in beef samples (8.2%), followed by water buffalo (5.3%), sheep (4.8%), camel (2.0%), and goat (1.7%). Of fourteen E. coli O157 isolates, only one was determined to be serotype O157: H7 while 13 were determined as serotype O157: NM. Of the 14 E. coli O157:H7/NM isolates, one, four, two, and one strains were positive for stx1, stx2, eaeA and ehlyA genes, respectively. The prevalence of this organism varied between seasons with the highest prevalence of E. coli O157 occurring in summer (9.3%). The results of this study showed that beef and water buffalo meat are a significant source for human EHEC E. coli O157:H7/NM infection in Iran. The data reported in this study provides some useful baseline in formation for future research such as molecular or epidemiologic works.
Key Words: Escherichia coli O157:H7/NM, Raw meat, Enterohemorrhagic Escherichia coli, Iran
Introduction
Enterohemorrhagic Escherichia coli (EHEC) causes hemorrhagic colitis which is often associated with devastating or life-threatening systemic manifestations. The most severe sequel, the hemolytic uremic syndrome (HUS), results from shiga toxins (Stxs) produced by the bacteria in the intestine that act systemically on sensitive cells in the kidneys, brain, and other organs.1 Although most EHEC strains produce Stxs, those produced by EHEC O157:H7 are particularly virulent and are responsible for the majority of HUS cases of bacterial etiology worldwide.1, 2 In addition to shiga toxins, the eaeA gene that encodes for intimin and the hly gene that encodes for hemolysin are other main virulence factors.3,4
Domestic and wild animals are sources of EHEC O157:H7,5,6 but the major animal carriers are healthy domesticated ruminants, primarily cattle1 and, to a lesser extent, sheep, and possibly goats.7 Contamination of meat with fecal material in the slaughtering process is the main transmission route of E. coli O157:H7.8 Human infections caused by E. coli O157:H7 have been reported in more than 30 countries. Cattle appear to be the chief source of infection; with many outbreaks of the disease being linked to the consumption of beef.4 Many studies report that the prevalence rates of E. coli O157 or E. coli O157:H7 in ground beef and meat from other ruminants range from 0.1 to > 50%. In addition, virulence genes have also been reported to be present in these isolates.9-11
There is limited information regarding the prevalence of E. coli O157:H7 in ruminant meat in Iran. This study was conducted to determine the prevalence of E. coli O157:H7/NM contamination in retail raw beef, and meat from camel, sheep, goat, and water buffalo in Fars and Khuzestan provinces, Iran.
Materials and Methods
Sample collection. From March 2010 to March 2011, 295 raw non pre-packed meat samples from beef (n = 85), camel (n = 50), sheep (n = 62), goat (n = 60), and water buffalo meat (n= 38) were purchased randomly from selected butcheries in Fars and Khuzestan provinces, Iran. Sections of meat (10cm × 10cm × 3cm) from neck of each carcasses was aseptically removed and placed in separate sterile plastic bags to prevent spilling and cross contamination and were immediately transported to the laboratory in a cooler with ice packs.
Bacteriological examination. The microbiological examination commenced within 12 h of sample collection. For each meat sample, 25 g was homogenized with 1 g of the homogenate being added to 5 mL of buffered peptone water (BPW- HiMedia Laboratories, Mumbai, India) and incubated. Cultures were streaked onto MacConkey sorbitol agar (HiMedia Laboratories, Mumbai, India) and the plates incubated overnight at 37 °C. From each plate (one plate for each meat sample), 5 to 10 suspected E. coli colonies (sorbitol negative and positive) were selected and sub-cultured onto presumptive diagnostic medium and incubated overnight at 37 °C. All sorbitol negative colonies were tested for the O157 antigen by latex agglutination (Oxoid)12 and up to five agglutination positive colonies were taken for PCR analysis.
DNA extraction. Purification of DNA was achieved using a genomic DNA purification kit (Fermentas, GmbH, Germany) according to the manufacturer’s instruction and the total DNA was measured at 260 nm optical density according to the method described by Sambrook and Russell.13
Detection of fliCh7 gene by PCR analysis. All oligonucleotide primers were obtained from a commercial source (Cinna Gen, Iran). In order to determine the H7 (fliCh7) gene of E. coli O157:H7 strains, PCR analysis was used.14 The PCR was performed with primers as described previously15 (Table 1) in a final volume of 50 μL containing 1× Reaction Buffer (Fermentas, GmbH, Germany), MgCl2 (Fermentas, GmbH, Germany), each of the four deoxynucleoside triphosphates (dNTPs) (Fermentas, GmbH, Germany), Taq DNA polymerase (Fermentas, GmbH, Germany), 0.50 μM of primers and 10 μL DNA. DNA amplification reactions were carried out using a DNA thermal cycler (Master Cycler Gradiant, Eppendrof, Germany) with the following program: one cycle of 2 min at 94 °C, 35 cycles of denaturation at 94 °C for 20 s, annealing at 54 °C for 1 min, and extension at 72 °C for 1 min, with a final extension at 72 °C for 10 min. The PCR products were stained with 1% solution of ethidium bromide and visualized under UV light after gel electrophoresis on 1.5% agarose.
Table 1.
Primer sequences and predicted lengths of PCR amplification products.15
| Gene | Primer |
Oligonucleotide
sequence (5-3) |
Fragment
size (pb) |
|---|---|---|---|
| stx1 | SLT1-F | TGTAACTGGAAAGGTGGAGTATACA | 210 |
| SLT1-R | GCTATTCTGAGTCAACGAAAAATAAC | ||
| stx2 | SLTII-F | GTTTTTCTTCGGTATCCTATTCC | 484 |
| SLTII-R | GATGCATCTCTGGTCATTGTATTAC | ||
| ehlyA | AE22 | ATTACCATCCACACAGACGGT | 397 |
| AE20-2 | ACAGCGTGGTTGGATCAACCT | ||
| eaeA | MFS1-F | ACGATGTGGTTTATTCTGGA | 166 |
| MFS1-R | CTTCACGTCACCATACATAT | ||
| fli | FLICH7-F | GCGCTGTCGAGTTCTATCGAGC | 625 |
| FLICH7-R | CAACGGTGACTTTATCGCCATTCC |
Detection of virulence factors by multiplex PCR analysis. The E. coli O157:H7/NM isolates were screened for the presence of stx1 (encoding for Shiga toxin 1), stx2 (encoding for Shiga toxin 2), eaeA (encoding for intimin),and ehlyA (encoding for enterohemolysin) genes using PCR method.14,15 The list of primers and the sizes of the expected PCR products are given in Table 1. According to Fratamico et al., multiplex PCR protocol was used to prepare the master mix with a total concentration of 50 μL containing incomplete 1× Reaction Buffer [160 mM (NH4)2SO4, 670 mM Tris-HCl (pH 8.8); 0.1% Tween-20] (Fermentas, GmbH, Germany), 3.0 mM MgCl2 (Fermentas, GmbH, Germany), 400 μM each of the four deoxynucleoside triphosphates (dNTPs) (Fermentas, GmbH, Germany), 2.5 U Taq DNA polymerase (Fermentas, GmbH, Germany), 0.50 μM of all primers that were used. Then, 10 μL of DNA was added to reaction mixture. Thermal cycling and gel documentation was carried out as mentioned above.
Statistical analysis. Data were transferred to a Microsoft Excel spreadsheet (Microsoft Corp., Redmond, WA, USA). Using SPSS 16.0 statistical software (SPSS Inc., Chicago, IL, USA), a Pearson chi-square test and Fisher's exact two-tailed test analyses were performed and differences were considered significant at P < 0.05.
Results
Table 2 shows the prevalence of E. coli O157 and E. coli O157:H7 isolated from beef, camel, sheep, goat and water buffalo meat in Fars and Khuzestan provinces, Iran. Fourteen (4.7%) of 295 samples were positive for E. coli O157. The highest prevalence of E. coli O157 was found in beef meat samples (8.2%), followed by water buffalo (5.3%), sheep (4.8%), camel (2.0%), and goat (1.7%). There were not significant differences (P > 0.05) in the level of contamination with E. coli O157 between beef, camel, sheep, goat, and water buffalo meat samples. No significant differences in the prevalence rates were observed between meat samples isolated in Fars or Khuzestan (P > 0.05). Out of 14 E. coli O157 isolates, only one was serotype O157: H7 and 13 were serotype O157:NM.
Table 2.
Prevalence of Escherichia coli O157:H7/NM isolated from raw beef, camel, sheep, goat, and water buffalo meat in Iran
| Samples |
No. of
examined samples |
No. of
positive samples (%) |
Virulence genes
|
|||
|---|---|---|---|---|---|---|
| Stx 1 | Stx 2 | eaeA | ehlyA | |||
| Beef | 85 | 7 (8.2) * | 1 | 2 | 1 | 1 |
| Camel | 50 | 1 (2.0) | 0 | 0 | 0 | 0 |
| Sheep | 62 | 3 (4.8) | 0 | 1 | 0 | 0 |
| Goat | 60 | 1 (1.7) | 0 | 0 | 0 | 0 |
| Buffalo | 38 | 2 (5.3) | 0 | 1 | 1 | 0 |
| Total | 295 | 14 (4.7) | 1 | 4 | 2 | 1 |
Out of 7 E. coli O157 isolates, 1 was serotype O157: H7
Out of 14 E. coli 157:H7/NM isolates, one, four, two, and one strains were positive for stx1, stx2, eaeA, and ehlyA genes, respectively (Table 2).
Table 3 shows the seasonal prevalence of E. coli O157 in raw beef, camel, sheep, goat, and water buffalo meat samples in Fars and Khuzestan provinces, Iran. The highest prevalence of E. coli O157 occurred in summer (9.3%) followed by fall (6.6%). The prevalence rates of E. coli O157 in spring and winter were 1.4%.
Table 3.
Seasonal prevalence of Escherichia coli O157:H7/NM in raw meat of beef, camel, sheep, goat, and water buffalo in Iran.
| Season |
Meat samples
*
|
Total | ||||
|---|---|---|---|---|---|---|
| Beef | Camel | Sheep | Goat | Water buffalo | ||
| Summer | 3/22 (13.6) | 0/13 (0.0) | 2/15 (13.3) | 1/15 (6.7) | 1/10 (10.0) | 7/75 (9.3) |
| Fall | 3/23 (13.0) | 1/11 (9.1) | 1/17 (5.7) | 0/15 (0.0) | 0/10 (0.0) | 5/76 (6.6) |
| Winter | 0/20 (0.0) | 0/13 (0.0) | 0/15 (0.0) | 0/15 (0.0) | 1/10 (10.0) | 1/73 (1.4) |
| Spring | 1/20 (5.0) | 0/13 (0.0) | 0/15 (0.0) | 0/15 (0.0) | 0/10 (0.0) | 1/71 (1.4) |
Results expressed as the number of Escherichia coli O157:H7/NM -positive samples / number of samples analyzed (%).
Discussion
Due to relative increase in the consumption of camel meat in Iran, it was decided to determine the prevalence of E. coli O157: H7 in the camel meat. The results of this study showed that only 2.0% of camel meat samples were positive for E. coli O157 and E. coli O157:H7 was not isolated from any of the camel meat samples. Similar studies in Iran detected E. coli O157 in 1.1% of 94 camel carcass samples.16 The results of these studies have shown that camel meat is not an important source for E. coli O157 infection, however, monitoring and inspection programmes remain critical for preventing outbreaks of food-borne diseases. The occurrence of E. coli O157 in camel has rarely been reported. In a study on camel fecal samples from the United Arab Emirates, E. coli O157:H7 was not identified.17 Studies in five east African countries on fecal and serum samples from 400 camels failed to detect STEC or anti-Stx antibodies.18
In the present study, 8.2% and 5.3% of retail beef and water buffalo meat samples respectively were E. coli O157-positive. According to the results 1.2% of retail beef meat samples were E. coli O157:H7-positive. Out of nine E. coli O157:H7/NM isolates from beef and water buffalo meat samples, three strains were positive for stx1, stx2, eaeA and ehlyA genes. These findings are comparable with those reported from other studies;11,19-24 however, they are lower than the prevalence rates reported from the Netherlands (10.4%),25 England (13.4%),10 USA (28.0%),26 and Nigeria (28.0%).27
In this study, three (4.8%) and one (1.7%) meat samples from sheep and goats respectively were positive for E. coli O157. A single isolate from sheep meat samples was positive for the stx2 gene. In a recent study in Shiraz (Iran), six E. coli O157:H7 isolates were recovered form 159 sheep meat samples representing a prevalence rate of 3.8%.28 A study in Egypt found the prevalence of E. coli O157 to be 2.5% and 2.0% in sheep and goat meat samples, respectively.29 The prevalence of E. coli O157:H7/NM in retail sheep and goat meat has been reported to be 0.7-7.3% in the Italy,30,31 4.0% in Egypt,32 1.5-2.2% in USA,3,10 0.5% in Australia,33 and 1.3% in Australia.34
Direct comparison of results of this study with other studies is difficult due to differences in the study methodologies, such as the type of slaughtering, improved enrichment and isolation procedures, differences in sample size, the type of sample and how and when it was collected.35 While there is some evidence that E. coli O157:H7 may be increasingly common in beef production systems the detection of higher proportions of E. coli O157:H7 in more recent studies is more probably associated with the wider use of more sensitive detection methods such as Immunomagnetic separation (IMS).10
In this study the highest prevalence of E. coli O157:H7/NM was found on meat sampled in summer and fall, which is in agreement with findings from previous studies on beef and sheep that reported peak prevalence occurs in summer and early fall.10,16,26,35 However, in the only study of non-O157 STEC performed on sheep,36 the prevalence did not follow the seasonal trend previously reported for STEC O157:H7, with the highest prevalence rates (up to 26.0%) during winter and spring. Kudva et al. hypothesized that changes in diet and/or environment influenced the seasonal variation in the prevalence of STEC O157:H7.37
Ruminants are the reservoirs of E. coli O157:H7 and meat and milk contaminated with feces are the most common sources of human infection.38 High prevalence of E. coli O157:H7/NM has been reported in fecal samples from cattle, water buffalo, goat and sheep.8,31,39,40 Therefore, the contamination source of E. coli O157:H7/NM in retail raw meat in this study is likely to be insufficient hygiene during slaughter, transportation or handling and storage in butcheries.41
This study shows the importance of beef and water buffalo meat as potential sources of human E. coli O157:H7/NM infection. As the potential of contamination with E. coli O157:H7/NM can be considerable in slaughterhouses, the maintenance of slaughter hygiene and regular microbiological monitoring of carcasses are essential tools in minimizing the risk of direct and cross-contamination. Such risks especially exist when other species with lower prevalence of contamination are slaughtered at the same slaughtering line or stored at the same premises as those with higher predisposition to contamination.
Acknowledgements
The authors would like to thank Dr. Hassan Momtaz, and Majid Riahi for the sincere technical help.
References
- 1.Gyles CL. Shiga toxin-producing Escherichia coli: an overview. J Anim Sci. 2007;85:E45–E62. doi: 10.2527/jas.2006-508. [DOI] [PubMed] [Google Scholar]
- 2.Serna AT, Boedeker EC. Pathogenesis and treatment of Shiga toxin-producing Escherichia coli infections. Curr Opin Gastroenterol. 2008;24:38–47. doi: 10.1097/MOG.0b013e3282f2dfb8. [DOI] [PubMed] [Google Scholar]
- 3.Doyle MP, Zhao T, Meng J, et al. Escherichia coli O157:H7. In: Doyle MP, Beuchat LR, Montville TJ, editors. Food microbiology, fundamental and frontiers. Washington D.C.: ASM Press ; 1997. pp. 171–191. [Google Scholar]
- 4.Mead PS, Griffin PM. Escherichia coli O157:H7. Lancet. 1998;352:1207–1212. doi: 10.1016/S0140-6736(98)01267-7. [DOI] [PubMed] [Google Scholar]
- 5.Ferens WA, Hovde CJ. Escherichia coli O157:H7: animal reservoir and sources of human infection. Foodborne Pathogens Dis. 2011;8:465–485. doi: 10.1089/fpd.2010.0673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Tabatabai M, Mokarizade A, Foad Marashi N. Detection and molecular characterization of sorbitol negative shiga toxigenic Escherichia coli in chicken from north-west of Iran. Vet Res Forum. 2011;2:183–188. [Google Scholar]
- 7.La Ragione RM, Best A, Woodward MJ, et al. Escherichia coli O157:H7 colonization in small domestic ruminants. Microbiol Rev. 2009;33:394–410. doi: 10.1111/j.1574-6976.2008.00138.x. [DOI] [PubMed] [Google Scholar]
- 8.Islam MA, Mondol AS, de Boer E, et al. Prevalence and genetic characterization of Shiga toxin-producing Escherichia coli isolates from slaughtered animals in Bangladesh. Appl Environ Microbiol. 2008;74:5414–5421. doi: 10.1128/AEM.00854-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Abong’o BO, Momba MNB. Prevalence and characterization of Escherichia coli O157:H7 isolates from meat and meat products sold in Amathole District, Eastern Cape Province of South Africa. Int J Food Microbiol. 2009;26:173–176. doi: 10.1016/j.fm.2008.10.001. [DOI] [PubMed] [Google Scholar]
- 10.Chapman PA, Siddons CA, Cerdan-Malo AT, et al. A 1-year study of Escherichia coli O157 in cattle, sheep, pigs and poultry. Epidemiol Infect. 1997;119:245–250. doi: 10.1017/s0950268897007826. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Cadrirci O, Siriken B, Inat G, et al. The prevalence of Escherichia coli O157:H7 in ground beef and raw meatball by immunomagnetic separation and the detection of virulence genes using multiplex PCR. Meat Sci. 2010;84:553–556. doi: 10.1016/j.meatsci.2009.10.011. [DOI] [PubMed] [Google Scholar]
- 12.Dontorou C, Papadopoulou C, Filiousis G, et al. Isolation of Escherichia coli O157:H7 from foods in Greece. Int J Food Microbiol. 2003;82:273–279. doi: 10.1016/s0168-1605(02)00313-6. [DOI] [PubMed] [Google Scholar]
- 13.Sambrook J, Russell DW. Molecular cloning: a laboratory manual. 3rd ed. New York: Cold Spring Harbor Laboratory Press, Cold Spring Harbor; 2001. [Google Scholar]
- 14.Erol I G M, Ayaz ND e. Isolation and genomic characterization of Escherichia coli O157:H7 in bile of cattle. Ann Microbiol. 2010;60:293–297. [Google Scholar]
- 15.Fratamico PM, Bagi LK, Pepe T. A multiplex polymerase chain reaction assay for rapid detection and identification of Escherichia coli O157:H7 in foods and bovine feces. J Food Prot. 2000;63:1032–1037. doi: 10.4315/0362-028x-63.8.1032. [DOI] [PubMed] [Google Scholar]
- 16.Rahimi E, Momtaz H, Nozarpour N. Prevalence of Listeria spp., Campylobacter spp., and Escherichia coli O157:H7 isolated from camel carcasses during processing. Bulg J Vet Med. 2010;13:179–185. [Google Scholar]
- 17.Moore JE, McCalmont M, Xu JR, et al. Prevalence of fecal pathogens in calves of racing camels (Camelus dromedarius) in the United Arab Emirates. Trop Anim Health Prod. 2002;4:283–287. doi: 10.1023/a:1015626601014. [DOI] [PubMed] [Google Scholar]
- 18.El-Sayed A, Ahmed S, Awad W. Do camels (Camelus dromedarius) play an epidemiological role in the spread of Shiga toxin producing Escherichia coli (STEC) infection? Trop Anim Health Prod. 2008;40:469–473. doi: 10.1007/s11250-007-9122-1. [DOI] [PubMed] [Google Scholar]
- 19.Rahimi E, Momtaz H, Hemmatzadeh F. The prevalence of Escherichia coli O157:H7, Listeria monocytogens and Campylobacter spp. on bovine carcasses in Isfahan, Iran. Iranian J Vet Res. 2008;9:365–370. [Google Scholar]
- 20.Jamshidi A, Bassami MR, Rasooli M. Isolation of Escherichia coli O157:H7 from ground beef samples collected from beef markets, using conventional culture and polymerase chain reaction in Mashhad, northeastern Iran. Iranian J Vet Res. 2008;9:72–76. [Google Scholar]
- 21.Walsh L, Dooge D, Hill C. Screening for Escherichia coli O157:H7 in Irish ground beef using two commercial detection systems. Irish Vet J. 1997;50:111–115. [Google Scholar]
- 22.Duffy EA, Belk KE, Sofos JN, et al. Microbial contamination occurring on lamb carcasses processed in the United States. J Food Prot. 2001;64:503–508. doi: 10.4315/0362-028x-64.4.503. [DOI] [PubMed] [Google Scholar]
- 23.Jo MY, Kim JH, Lim JH, et al. Prevalence and character in Korea. Int J Food Microbiol. 2004;95:41–49. doi: 10.1016/j.ijfoodmicro.2004.01.016. [DOI] [PubMed] [Google Scholar]
- 24.Badri S, Filliol I, Carle I, et al. Prevalence of virulence genes in Escherichia coli isolated from food. Food Control. 2009;20:560–564. [Google Scholar]
- 25.Heuvelink AE, Zwartkruis-Nahuis JT, Beumer RR, et al. Occurrence and survival of verocytotoxin-producing Escherichia coli O157 in meats obtained from retail outlets in The Netherlands. J Food Prot. 1999;62:1115–1122. doi: 10.4315/0362-028x-62.10.1115. [DOI] [PubMed] [Google Scholar]
- 26.Elder RO, Keen JE, Siragusa GR, et al. Correlation of enterohemorrhagic Escherichia coli O157 prevalence in feces, hides, and carcasses of beef cattle during processing. Proceedings of the National Academy of Science. 2000;97:2999–3003. doi: 10.1073/pnas.060024897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Olatoye IO. The incidence and antibiotics susceptibility of Escherichia coli O157:H7 from beef in Ibadan Municipal, Nigeria. Afr J Biotech. 2010;9:1196–1199. [Google Scholar]
- 28.Shekarfroush S, Tahamtan Y, Pourbakhsh A. Detection and frequency of Stx2 gene in Escherichia coli O157 and O157:H7 strains isolated from sheep carcasses in Shiraz-Iran. Pak J Bioch Sci. 2008;11:1085–1092. doi: 10.3923/pjbs.2008.1085.1092. [DOI] [PubMed] [Google Scholar]
- 29.Hiko A, Asrat D, Zewde G. Occurrence of Escherichia coli O157:H7 in retail raw meat products in Ethiopia. J Infect Dev Ctries. 2008;2: 389–393. doi: 10.3855/jidc.203. [DOI] [PubMed] [Google Scholar]
- 30.Battisti A, Lovari S, Franco A, et al. Prevalence of Escherichia coli O157 in lambs at slaughter in Rome, central Italy. Epidemiol Infect. 2006;134:415–419. doi: 10.1017/S0950268805005236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Franco A, Lovari S, Cordaro G, et al. Prevalence and concentration of verotoxigenic Escherichia coli O157:H7 in adult sheep at slaughter from Italy. Zoonoses Public Health. 2009;56:215–220. doi: 10.1111/j.1863-2378.2008.01188.x. [DOI] [PubMed] [Google Scholar]
- 32.Abdul-Raouf UM, Ammar MS, Beuchat LR. Isolation of Escherichia coli O157:H7 from some Egyptian foods. Int J Food Microbiol. 1996;29:423–426. doi: 10.1016/0168-1605(95)00076-3. [DOI] [PubMed] [Google Scholar]
- 33.Phillips D, Jordan D, Morris S, et al. Microbiological quality of Australian sheep meat in 2004. Meat Sci. 2006;74:261–266. doi: 10.1016/j.meatsci.2006.03.017. [DOI] [PubMed] [Google Scholar]
- 34.Duffy LL, Small A, Fegan N. Concentration and prevalence of Escherichia coli O157 and Salmonella serotypes in sheep during slaughter at two Australian abattoirs. Aust Vet J. 2010;88:399–404. doi: 10.1111/j.1751-0813.2010.00623.x. [DOI] [PubMed] [Google Scholar]
- 35.Bryane CM, Erol I, Call JE, et al. Characterization of E. coli O157:H7 from downer and healthy dairy cattle in the upper Midwest region of the United States. Appl Environ Microbiol. 2003;69:4683–4688. doi: 10.1128/AEM.69.8.4683-4688.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Hussein HS, Thran BH, Glimp HA. Verotoxin-producing Escherichia coli in sheep grazing an irrigated pasture or arid rangeland forages. Exp Biol Med. 2003;228:358–364. doi: 10.1177/153537020322800405. [DOI] [PubMed] [Google Scholar]
- 37.Kudva IT, Hatfield PG, Hovde CJ. Characterization of Escherichia coli O157:H7 and other Shiga toxin- producing E. coli serotypes isolated from sheep. J Clin Microbiol. 1997;35:892–899. doi: 10.1128/jcm.35.4.892-899.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Armstrong , GL , Hollingsworth J, Morris JG. Emerging foodborne pathogens: E. coli O157:H7 as a model of entry of a new pathogen into the food supply of the developed world. Epidemiol Rev. 1996;18:29–51. doi: 10.1093/oxfordjournals.epirev.a017914. [DOI] [PubMed] [Google Scholar]
- 39.Sanchez S, Martinez R, Garcia A, et al. Variation in the prevalence of non-O157 Shiga toxin-producing Escherichia coli in four sheep flocks during a 12-month longitudinal study. Small Rumin Res. 2010;93:144–148. [Google Scholar]
- 40.Vu-Khac H, Cornick NA. Prevalence and genetic profiles of Shiga toxin-producing Escherichia coli strains isolated from buffaloes, cattle, and goats in central Vietnam. Vet Microbiol. 2008;126:356–363. doi: 10.1016/j.vetmic.2007.07.023. [DOI] [PubMed] [Google Scholar]
- 41.Rahimi E, Ameri M, Kazemeini HR. Prevalence and antimicrobial resistance of Campylobacter species isolated from raw camel, beef, lamb and goat meat in Iran. Foodborne Pathog Dis. 2010;7:443–447. doi: 10.1089/fpd.2009.0421. [DOI] [PubMed] [Google Scholar]
