Characterization of a Novel Metallo-β-Lactamase Variant, GIM-2, from a Clinical Isolate of Enterobacter cloacae in Germany

LETTER

The metallo-β-lactamase (MBL) GIM-1, first identified in Pseudomonas aeruginosa isolates in Germany in 2002 (1), has since been described sporadically and never outside Germany in Pseudomonas spp. (2, 3), Acinetobacter pittii (4), and a range of Enterobacteriaceae (3, 5, 6). No genetic variations of bla_GIM-1 have been reported (7).

The Enterobacter cloacae isolate described here was first identified in June 2014 from the rectal screening of a 49-year-old male patient from Saudi Arabia previously hospitalized in Germany and in Saudi Arabia.

Results of phenotypic detection of a carbapenemase using a combined disk test (10 μg meropenem with and without 930 μg EDTA [8]) and a modified Hodge test (9) were both positive. The MICs of the following relevant antibiotics were determined by Etest (bioMérieux): piperacillin (>256 mg/liter), piperacillin-tazobactam (>256 mg/liter), ceftazidime (>256 mg/liter), cefepime (>12 mg/liter), imipenem (1 mg/liter), meropenem (4 mg/liter), aztreonam (>256 mg/liter), gentamicin (4 mg/liter), amikacin (2 mg/liter), ciprofloxacin (0.5 mg/liter), and colistin (0.5 mg/liter).

Multiplex PCRs were performed for the following β-lactamase genes: bla_IMP-1, bla_VIM-1-type, bla_VIM-2-type, bla_GIM-1, and bla_NDM-1 (3); bla_KPC and bla_OXA-48 (10); bla_CTX-M groups 1, 2, 9, and 8/25 (11); and bla_TEM and bla_SHV (12). PCR detected bla_GIM-1 and bla_CTX-M group 9 genes. Sequencing of the bla_GIM gene (GIM-F-flanking, 5′-TCCAGAACCTTGACCGAACG-3′, and GIM-R-flanking, 5′-GCCACTCATAGAGCATCGCA-3′) revealed a new variant of the metallo-β-lactamase bla_GIM-1 gene (given the name bla_GIM-2) with one nucleotide substitution, A290G, causing an amino acid substitution of glutamic acid to glycine at position 97. The sequenced class 1 integron, In1101, is identical in the order of the gene cassettes to integrons previously described in bla_GIM-1-positive E. cloacae (3, 5). The genes were located downstream of the attI1 recombination site in the following order: bla_GIM-2 and aminoglycoside acetyltransferase gene aacA4 in one common (fused) gene cassette, aminoglycoside acetyltransferase gene aadA1, and β-lactam resistance gene bla_OXA-2.

Genetic localization of the bla_GIM-2-containing integron was determined by S1-nuclease digestion and in-gel hybridization with a ³²P-labeled bla_GIM probe as previously described (13). As a template, the amplicon of primers (5′ to 3′) 5.1.R2 (CCAAGCAGCAAGCGCGTTAC) and GIMR (ACTCATGACTCCTCACGAGG) (1), which bind to bla_GIM-2, was used. No bla_GIM-2-containing plasmid was detected, and hybridization of the probe occurred only on chromosomal DNA. Conjugation experiments were carried out using the bla_GIM-2 strain and sodium azide-resistant Escherichia coli J53 on sheep blood agar at a recipient/donor ratio of 1:10. The selective media contained 4 mg/liter ceftazidime and 100 mg/liter sodium azide. The bla_GIM-2 gene was nonconjugative.

Genotyping was carried out together with bla_GIM-1-positive E. cloacae isolates previously described (3) using three methods: pulsed-field gel electrophoresis (PFGE) (XbaI, in accordance with the Tenover criteria [14]), repetitive sequence-based PCR (rep-PCR) (DiversiLab) (with a similarity cutoff of 95%), and multilocus sequence typing (MLST) (15). The bla_GIM-2-positive strain, confirmed to be sequence type 108, was shown to be unrelated to the other isolates by all genotyping methods.

In conclusion, the isolation of a new GIM-type MBL in Germany highlights the ongoing spread and evolution of this local metallo-β-lactamase gene. The isolate presented here may be easily missed in routine microbiology laboratories since isolates carrying the gene can show relatively low MICs for carbapenems; however, results of phenotypic tests for carbapenemases were positive.

Nucleotide sequence accession number.

The integron whose sequence was determined in this work has been allocated GenBank accession number KM659858.