Abstract
The MDR1 gene encodes for P-glycoprotein (P-gp), which is an efflux transporter at the cell membrane. The P-gp has wide substrate specificity for multiple medications including the lipid lowering drug, atorvastatin. In this study, we investigated the possible association between three common MDR1 gene polymorphisms (G2677T, C3435T, and C1236T), and the lipid lowering effect of atorvastatin among Jordanians. Lipid and lipoproteins were measured in blood samples collected from patients (n = 201) at baseline and during atorvastatin treatment. MDR1 polymorphisms were genotyped using polymerase chain reaction–restriction fragment length polymorphism. Both the TT genotype of G2677T and the TT genotype of the C3435T polymorphisms were associated with lower levels of low-density lipoproteins after atorvastatin treatment. However, the effects of atorvastatin on the levels of total cholesterol, triglycerides, and high-density lipoprotein, were not correlated with any of the genotypes in both polymorphisms. Finally, the C1236T polymorphism was not associated with the lipid lowering effect of atorvastatin. In conclusion, the MDR1 gene polymorphisms G2677T, and C3435T, but not C1236T were associated with the lipid lowering effect of atorvastatin among Jordanians.
Keywords: Atorvastatin, MDR1, SNP, Drug response, Jordan
Introduction
Genetics account for significant percentage of variations in drug disposition and metabolizing enzymes that play major determinants of drug level and distribution in the body (Goldstein 2005). The Multi-Drug Resistance (MDR1) gene encodes for P-glycoprotein (P-gp) or MDR1 protein, which functions as ATP-dependent efflux pump (Rosenberg et al. 1997). The MDR1, which spans 28 exons and maps to chromosome 7 (Bodor et al. 2005), is also highly expressed in brain, liver, kidney, lymphocytes, placenta, and gut (Woodahl and Ho 2004). P-gp plays an important role in regulating absorption, distribution, and elimination of drugs. P-gp has been found to mediate the energy dependent efflux of xenobiotics in epithelial tissues of the human body including the intestinal mucosa, liver, testicular membrane, and kidney proximal tubules, as well as blood-tissue-barriers such as the brain and placenta (Cigana et al. 2007; Haslam et al. 2008). P-gp, therefore, could decrease intestinal absorption, increase biliary excretion or renal tubular secretion, and impair drug distribution to the brain for several drugs (DeGorter et al. 2012 for review).
Among the substrates of P-gp is atorvastatin, which belongs to the drug family of statins and is used for treatment of hyperlipidemia (Foger 2011). Atorvastatin mediates its effect via inhibiting 3-hydroxy-3-methyl-glutaryl-CoA (HMG-CoA) reductase enzyme. The drug reduces levels of total cholesterol, low-density lipoprotein (LDL)-cholesterol, and triglyceride, and increases high-density lipoprotein (HDL)-cholesterol in patients with a wide variety of dyslipidemia (Lennernas 2003). Previous studies have reported changes in atorvastatin treatment outcomes in association with MDR-1 polymorphisms (Kajinami et al. 2004; Munshi 2012). For example, in a study from USA, common variants of MDR1 gene such as the C3435T, were associated with a smaller reduction in LDL and with a larger increase in HDL levels, relative to variant allele carriers (Kajinami et al. 2004). However, other studies among Brazilian of European descents and USA populations, found no significant relation between atorvastatin response and MDR1 C3435T polymorphism (Mega et al. 2009; Rodrigues et al. 2005). In the current study, we examined the influence of three common MDR1 gene variants on lipid response to atorvastatin treatment among Jordanians. These variants include: the G to T/A transition (G2677T/A: rs2032582) at codon 893 (A893S/T) in exon 21, the C to T transition (C3435T: rs1045642) at codon 1145 (I1145I) in exon 26, and the C to T transition (C1236T: rs1128503) at codon 412 (G412G) in exon 12.
Materials and Methods
This is a prospective cohort study that was conducted at King Abdullah University Hospital (KAUH) in the period between November 2010 and October 2011. Institutional Review Board approval was obtained from KAUH and Jordan University of Science and Technology (JUST). Patients (age ≥ 18) who attended the cardiology or endocrine clinics of KAUH were included in the study. Subjects were patients who were diagnosed with hypercholesterolemia at their clinic visit, and started atorvastatin treatment (10 mg/day) under physician care. Exclusion criteria were: presence of liver disease, elevation of transaminase or creatine kinase levels >1.5 times the upper normal limit at baseline, presence of atrioventricular block and/or sinus bradycardia, presence of acute or chronic renal failure, evidence of electrolyte disturbances, cases of acute cerebrovascular disease or myocardial infarction within the preceding 3 months, evidence of alcohol abuse, patients with hypothyroidism, evidence of myopathy, pregnancy, and patients who had any medication changes during the 2 months prior to study participation.
The study procedure and goals were explained to patients both verbally and through consent form. Patients, who agreed to participate, were interviewed by a trained researcher using a structured questionnaire that was designed to obtain patients’ demographic data. Other related data regarding patient’s baseline and clinical characteristics were obtained from the medical files. These characteristics included height, weight, smoking status, presence of other diseases, and use of medications.
Blood sampling and handling
Overnight-fasting blood samples were withdrawn from eligible participants by a specialized laboratory technician. Samples were collected in evacuated EDTA tubes (5 mL) and anticoagulant-free plain tubes (10 mL). Serum was prepared by centrifuging blood at 4,000×g for 4 min in plain tubes. All serum samples were stored at −80 °C until analysis of biochemical parameters.
Biochemical assays
The levels of total cholesterol (Tchol), low-density-lipoprotein cholesterol (LDL), high-density-lipoprotein cholesterol (HDL) and triglycerides (TG) were measured in serum at the laboratories of King Abdullah University Hospital using Roche automated clinical analyzer system and reagents (Roche Diagnostics, Mannheim, Germany). The assays sensitivity ranges were 0.08–20.7 mmol/L for Tchol and HDL, and 0.05–11.3 mmol/L for TG. For all assays, the precision was more than 98 %, and the predictive value for all assays was 98 % (Gelskey et al. 1994). Measurements were carried out at baseline before starting treatment and after 24 weeks of atorvastatin treatment (Munshi 2012).
Molecular analysis
DNA was extracted from all samples using genomic DNA purification kit from whole blood (Promega, Madison, WI, USA), according to the manufacturer instructions. After measurement of DNA concentrations, samples were stored at −20 °C until analysis. The polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP) assay was used to genotype C1236T, G2677T/A and C3435T MDR1 single nucleotide polymorphisms (SNPs). For each SNP: 20 μL PCR reaction mixture containing 5 ng of template DNA, 1 μM of each forward and reverse primers and ready to use commercially available master mix (Promega, USA) were used. PCR restrictions conditions and sizes of the restricted fragments for all SNPs are shown in Table 1 (slightly modified from Kato et al. 2008). PCR and restricted fragments were visualized using 3 % agarose gel for C1236T and C3435T SNPs, and 8 % polyacrylamide gel for G2677T/A SNP, and ethidium bromide under UV light. All gels were scanned and documented using gel documentation system. Negative controls were included in each PCR run.
Table 1.
Primers and conditions used for genotyping analysis of MDR1 polymorphisms (slightly modified from Kato et al. 2008)
| SNP ID | Variant | Primer sequence (5′–3′) | PCR annealing temperature (°C) | Restriction enzyme, incubation conditions | Fragment length (bp) |
|---|---|---|---|---|---|
| rs1128503 | C1236T | F:TCTTTGTCACTTTA TCCAGC R:TCTCACCATCCCCTCTGT |
61 | Hae III, 37 °C, 4 h | C allele: 381, 86, 35 T allele: 416, 86 |
| rs2032582 | G2677A | F:TGCAGGCTATAGGTTCCAGG R:GTTTGACTCACCTTCCCAG |
59 | Bsr I, 65 °C, 4 h | G allele: 220 A allele: 206, 14 |
| G2677T | F:TGCAGGCTATAGGTTCCAGG R:TTTAGTTTGACTCACCTTCCCG |
59 | Ban I, 37 °C, 4 h | T allele: 224 G allele: 198, 26 |
|
| rs1045642 | C3435T | F:TGATGGCAAAGAAATAAAGCGA R:TGACTCGATGAAGGCATGTATG |
56 | Mbo I, 37 °C, 4 h | T allele: 193 C allele: 144, 49 |
Statistical analysis
Data were analyzed using SPSS package version 17 (SPSS Inc, Chicago, IL, USA) for windows. Data were expressed in various tables; continuous variables are expressed as mean ± standard deviation. Discrete variables were expressed as counts and frequencies, and were compared using Chi square test. A Normality test was used to check data distribution. Normally distributed variables were analyzed using one-way ANOVA followed by Tukey’s post-test for pair wise comparisons of genotypes. Three-locus haplotype frequencies were calculated using the SHEsis program (Shi and He 2005). Power analysis was carried out using G. Power version 3.0.10 (Franz Faul, Universität Kiel, Kiel, Germany). Sample size analysis was performed at 80 % power and 5 % alpha level of significance. Genotype distributions were analyzed for Hardy–Weinberg equilibrium, and a P value <0.05 was considered significant.
Results
In the studied samples (n = 201), the average age was 58.0 ± 8.5 years, and 57.7 % of subjects were males. The average BMI was 29.9 ± 5.0, and 23.1 % were smokers. In addition to hypercholesterolemia, 38 % of the patients were diabetic and 64 % were diagnosed with hypertension. There were no patients with other major cardiac or metabolic diseases. About 33.4 % of the patients used insulin and/or oral hypoglycemic agents, whereas 58.2 % used antihypertensive medications. Table 2 shows the lipid, and lipoprotein lowering effect of atorvastatin in patients. Twenty four weeks of treatment with atorvastatin was associated with more patients having Tchol, TG, LDL, and HDL values within normal range (P < 0.05). Lipid levels in patients were classified into normal or abnormal according to these cut-off values; 6.2 mmol/L for Tchol, 1.7 mmol/L for TG, 1 mmol/L for HDL, and 4.1 mmol/L for LDL.
Table 2.
The lipid lowering response for atorvastatin in the whole studied samples
| Variable | Numbers at baseline n (%) | Numbers after treatment n (%) | P value |
|---|---|---|---|
| TChol (mmol/L) | <0.005 | ||
| <5.2 | 105 (52.2) | 147 (73.1) | |
| 5.2–6.2 | 53 (26.4) | 37 (18.4) | |
| >6.2 | 43 (21.4) | 17 (8.5) | |
| TG (mmol/L) | 0.07 | ||
| ≤1.7 | 63 (31.3) | 78 (38.8) | |
| >1.7 | 138 (68.7) | 123 (61.2) | |
| HDL (mmol/L) | 0.03 | ||
| >1 | 83 (41.5) | 103 (51.2) | |
| ≤1 | 117 (58.5) | 98 (48.8) | |
| LDL (mmol/L) | 0.005 | ||
| <3.4 | 136 (58.0) | 165 (82.1) | |
| 3.4–4.1 | 34 (17.0) | 18 (9.0) | |
| >4.1 | 30 (15.0) | 18 (9.0) |
Tchol total cholesterol, TG triglycerides, HDL high-density lipoprotein, LDL low-density lipoprotein
Table 3 shows the G2677T/A SNP in MDR1 gene and its association with lipid and lipoprotein levels at baseline and after atorvastatin treatment. Strong association was found between G2677T SNP and the level of LDL after atorvastatin treatment (P < 0.01). Patients with the TT genotype had higher levels of LDL after atorvastatin treatment than those with GG genotypes. However, no significant association was found between G2677T/A SNP and levels of Tchol, TG, and HDL (P > 0.05, Table 3).
Table 3.
The effect of MDR1 G2677T/A polymorphism on lipid lowering response for atorvastatin
| Variables | Numbers at baseline for each genotype | Numbers after treatment for each genotype | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| GG n (%) | GT n (%) | TT n (%) | GA n (%) | P value | GG n (%) | GT n (%) | TT n (%) | GA n (%) | P value | |
| TChol (mmol/L) | 0.70 | 0.74 | ||||||||
| <5.2 | 47 (56.6) | 37 (45.7) | 14 (56.0) | 5 (55.6) | 60 (72.3) | 60 (74.1) | 17 (68.0) | 8 (88.9) | ||
| 5.2–6.2 | 18 (21.7) | 24 (29.6) | 8 (32.0) | 2 (22.2) | 17 (20.5) | 14 (17.4) | 4 (16.0) | 1 (11.1) | ||
| >6.2 | 18 (21.7) | 20 (24.7) | 3 (12.0) | 2 (22.2) | 6 (7.2) | 7 (8.6) | 4 (16.0) | 0 (0) | ||
| TG (mmol/L) | 0.42 | 0.48 | ||||||||
| ≤1.7 | 29 (34.9) | 21 (25.9) | 10 (40.0) | 2 (22.2) | 30 (36.18) | 36 (44.4) | 9 (36.0) | 2 (22.2) | ||
| >1.7 | 54 (65.1) | 60 (74.1) | 15 (60.0) | 7 (77.9) | 53 (63.9) | 45 (55.6) | 16 (64.0) | 7 (77.8) | ||
| HDL (mmol/L) | 0.69 | 0.62 | ||||||||
| >1 | 38 (45.8) | 32 (39.5) | 8 (32.0) | 4 (44.4) | 39 (47.0) | 44 (54.3) | 13 (52.0) | 6 (66.7) | ||
| ≤1 | 45 (54.2) | 49 (60.5) | 17 (68.0) | 5 (55.6) | 44 (53.0) | 37 (45.7) | 12 (48.0) | 3 (33.3) | ||
| LDL (mmol/L) | 0.67 | 0.01 | ||||||||
| <3.4 | 55 (66.3) | 52 (64.2) | 20 (80.0) | 7 (77.8) | 69 (83.1) | 72 (88.9) | 15 (60.0) | 7 (77.8) | ||
| 3.4–4.1 | 15 (18.1) | 16 (19.8) | 3 (12.0) | 0 (0) | 10 (12.0) | 2 (2.5) | 5 (20.0) | 1 (11.1) | ||
| >4.1 | 13 (15.7) | 13 (16.0) | 2 (8.0) | 2 (22.2) | 4 (4.8) | 7 (8.6) | 5 (20.0) | 1 (11.1) | ||
Numbers of subjects in the different genotypes are: GG = 83, GT = 81, TT = 25, and GA = 9. Degrees of freedom are 6 for TChol and LDL analysis, and 3 for TG and HDL analysis
For the MDR1 C3435T SNP, the TT genotype was significantly associated with lower levels of LDL after atorvastatin treatment relative to the CT and the CC genotypes (Table 4, P < 0.05). Other lipid and lipoprotein parameters such as Tchol, TG, and HDL were not associated with this SNP (P > 0.05, Table 4). No significant association was found between this MDR1 C1236T SNP and lipid or lipoproteins levels measured at baseline or after atorvastatin treatment (Table 5, P > 0.05).
Table 4.
The effect of MDR1 C3435T polymorphism on lipid lowering response for atorvastatin
| Variables | Numbers at baseline for each genotype | Numbers after treatment for each genotype | ||||||
|---|---|---|---|---|---|---|---|---|
| TT n (%) | CT n (%) | CC n (%) | P value | TT n (%) | CT n (%) | CC n (%) | P value | |
| TChol (mmol/L) | 0.35 | 0.32 | ||||||
| <5.2 | 34 (58.6) | 49 (46.7) | 20 (62.5) | 47 (81.0) | 76 (72.4) | 21 (65.6) | ||
| 5.2–6.2 | 15 (25.9) | 29 (27.6) | 7 (21.9) | 8 (13.8) | 18 (17.1) | 9 (28.1) | ||
| >6.2 | 9 (15.5) | 27 (25.7) | 5 (15.6) | 3 (5.2) | 11 (10.5) | 2 (6.3) | ||
| TG (mmol/L) | 0.86 | 0.72 | ||||||
| ≤1.7 | 20 (34.5) | 32 (30.5) | 10 (31.3) | 23 (39.7) | 38 (36.2) | 14 (43.8) | ||
| >1.7 | 38 (65.5) | 73 (69.5) | 22 (68.8) | 35 (60.3) | 67 (63.8) | 18 (56.3) | ||
| HDL (mmol/L) | 0.26 | 0.29 | ||||||
| >1 | 26 (44.8) | 47 (44.8) | 9 (28.1) | 33 (56.9) | 49 (46.7) | 19 (59.4) | ||
| ≤1 | 32 (55.2) | 58 (55.2) | 23 (71.9) | 25 (43.1) | 56 (53.3) | 13 (40.6) | ||
| LDL (mmol/L) | 0.47 | 0.045 | ||||||
| <3.4 | 42 (72.4) | 69 (65.7) | 22 (68.8) | 54 (93.1) | 86 (81.9) | 22 (68.8) | ||
| 3.4–4.1 | 11 (19.0) | 16 (15.2) | 6 (18.8) | 3 (5.2) | 8 (7.6) | 5 (15.6) | ||
| >4.1 | 5 (8.6) | 20 (19.0) | 4 (12.5) | 1 (1.7) | 11 (10.5) | 5 (15.6) | ||
Numbers of subjects in the different genotypes are: TT = 58, CT = 105, and CC = 32. Degrees of freedom are 4 for TChol and LDL analysis, and 2 for TG and HDL analysis
Table 5.
The effect of MDR1 C1236T polymorphism on lipid lowering response for atorvastatin
| Variables | Numbers at baseline for each genotype | Numbers after treatment for each genotype | ||||||
|---|---|---|---|---|---|---|---|---|
| TT n (%) | CT n (%) | CC n (%) | P value | TT n (%) | CT n (%) | CC n (%) | P value | |
| Tchol (mmol/L) | 0.75 | 0.76 | ||||||
| <5.2 | 34 (48.6) | 44 (53.0) | 22 (57.9) | 54 (77.1) | 61 (73.5) | 27 (71.1) | ||
| 5.2–6.2 | 20 (28.6) | 21 (25.3) | 11 (28.9) | 12 (17.1) | 15 (18.1) | 6 (15.8) | ||
| >6.2 | 16 (22.9) | 18 (21.7) | 5 (13.2) | 4 (5.7) | 7 (8.4) | 5 (13.2) | ||
| TG (mmol/L) | 0.89 | 0.42 | ||||||
| ≤1.7 | 21 (30.0) | 27 (32.5) | 13 (34.2) | 28 (40.0) | 29 (34.9) | 18 (47.4) | ||
| >1.7 | 49 (70.0) | 56 (67.5) | 25 (65.8) | 42 (60.0) | 54 (65.1) | 20 (52.6) | ||
| HDL (mmol/L) | 0.74 | 0.67 | ||||||
| >1 | 28 (40.0) | 32 (38.6) | 18 (47.4) | 33 (47.1) | 45 (54.2) | 20 (52.6) | ||
| ≤1 | 42 (60.0) | 51 (61.4) | 20 (52.6) | 37 (52.9) | 38 (45.8) | 18 (47.4) | ||
| LDL (mmol/L) | 0.75 | 0.35 | ||||||
| <3.4 | 46 (65.7) | 55 (66.3) | 29 (76.3) | 61 (87.1) | 68 (81.9) | 28 (73.7) | ||
| 3.4–4.1 | 13 (18.6) | 14 (16.9) | 6 (15.7) | 6 (8.6) | 7 (8.4) | 4 (10.5) | ||
| >4.1 | 11 (15.7) | 14 (16.9) | 3 (7.9) | 3 (4.3) | 8 (9.6) | 6 (15.8) | ||
Numbers of subjects in the different genotypes are: TT = 70, CT = 83, and CC = 38. Degrees of freedom are 4 for Tchol and LDL analysis, and 2 for TG and HDL analysis
When average values of each of Tchol, TG, HDL and LDL were calculated at baseline, after treatment, and percentage change was derived, only the MDR1 C3435T SNP showed a significant effect. Levels of LDL after treatment were significantly lower, whereas the percentage of reduction in LDL was significantly more in the TT compared to the CC genotype (After treatment the LDL values were: TT = 2.09 ± 0.78 mmol/L, CT = 2.81 ± 0.96 mmol/L, and CC = 2.49 ± 0.62 mmol/L, P = 0.006; percentage of LDL reduction: TT = 25.82 ± 3.7 %, CT = 24.38 ± 2.7 %, and CC = 10.05 ± 4.9 %, P = 0.03). Finally, all genotypes of the examined SNPs were in Hardy–Weinberg equilibrium.
Three-locus haplotype (C1236T, G2677T, and C3435T) analysis showed that frequencies of CTT and TGC haplotypes were significantly associated with high level of HDL at baseline and after treatment (P < 0.01). In addition, the CTT and CGT haplotypes were associated with higher levels of TG at baseline (P < 0.01). Furthermore, CTC haplotype was associated with high LDL after treatment (P < 0.05). None of the remaining haplotypes were significantly associated with any of the examined lipid parameters before or after treatment (P > 0.05).
Discussion
In this study, we found that the lipid lowering effect of atorvastatin is modulated by MDR1 G2677T and C3435T SNPs. The TT genotype at G2677T/A and C3435T SNPs were associated with lower LDL levels after treatment.
The MDR1 gene expression is highly variable between subjects of the same or different races, and many variants have been identified in this gene (Hattori et al. 2007; Allabi et al. 2005; Wang and Sadee 2006; Hoffmeyer et al. 2000). Among Caucasians, those with the TT genotype at the C3435T polymorphism in exon 26 show more than two-fold lower duodenal P-gp protein expression levels compared to the CC ones. Since concentrations of P-gp determine the extent of drug absorption, significant impact of this SNP on bioavailability of drugs is well documented (Maeda and Sugiyama 2008; Kuypers et al. 2008; Zhou et al. 2008; Hoffmeyer et al. 2000). The CC genotype of C3435T is more common in West Africans, African Americans, Japanese and Chinese than in White Americans (Zhang et al. 2008; Komoto et al. 2006). Accordingly, the clinical use of drugs that are P-gp substrates in African populations may be modified (Chelule et al. 2003; Lewis et al. 2007; Schaeffeler et al. 2001). The distribution of G2677T/A and C1236T SNPs also shows variation among populations with high frequency of the mutant alleles among Africans and Asians (Cascorbi 2011; Gaikovitch et al. 2003; Milojkovic et al. 2011). We have recently reported that the MDR1 variants distribution among Jordanians is similar to that of Caucasians (Khabour et al. 2012).
Variable results have been reported on the contribution of the MDR1 G2677T and C3435T in the lipid lowering effect of atorvastatin. Kajinami et al. 2004 reported a positive contribution for the TT genotype of the C3435T, but not the G2677T/A polymorphism, to the lipid lowering effect of atorvastatin among females from the USA (Kajinami et al. 2004). In a sample of Brazilians of European descent (Munshi 2012), and a sample from USA (Mega et al. 2009), no such associations were detected for these polymorphisms. In this study, The TT genotype of the C3435T, and TT genotype at MDR1 G2677T polymorphism were associated with lower levels of LDL after atorvastatin treatment among Jordanians, similar to results of Kajinami et al. (2004). The variation in SNPs effect on response to atrovastatin is possibly due to different genetic backgrounds. It can also be affected at least in part by various durations, dosing levels of atorvastatin, or variation in patients’ characteristics among the studied samples. The findings of the present study highlight the importance of these variants in Jordanians and provide additional evidence for the clinical significance of C3435T SNP in mediating response to P-gp substrates drugs.
To further understand the effects of these SNPs, a haplotype analysis was performed. We found that the CTT and TGC haplotypes (C1236T, G2677T, and C3435T) were significantly associated with high level of HDL at baseline and after treatment. The CTT and CGT haplotypes were associated with higher levels of TG at baseline and CTC haplotype was associated with high LDL after treatment with atorvastatin. Thus the rare haplotypes may affect lipid profile at the basal level. Alternatively, the observed haplotype associations may result from false positives in our study reflecting statistic power. Therefore, more studies are required to confirm the findings of the haplotype associations.
Previous studies have shown that the C1236T polymorphism affects disease progression (Bellusci et al. 2010) and blood levels of a number of drugs other than statin (Goreva et al. 2004; Anglicheau et al. 2004; Kim et al. 2001). Yet, others found that this polymorphism was not correlated with risk and clinical prognosis of other diseases such as chronic lymphocytic leukemia among Chinese population (Dong et al. 2011). Results of the current study showed no association between this polymorphism and the levels of lipids and lipoproteins during treatment with atorvastatin. Thus, this variant might not be related to statin effect in the Jordanian population.
This study has some limitations. At one end, a limited number of patients on atorvastatin was followed up for 3 months. Although this period seems enough, longer duration of follow-up might be warranted. Moreover, carrying out a large randomized clinical study is needed to optimally define the effect of the studied polymorphisms on antihyperlipidemic response of atorvastatin. In this study, the effect of the three common MDR1 polymorphisms on atorvastatin treatment response was studied. Previous studies have shown that the response to atorvastatin is affected by other genes. A genome-wide association study shows associations of LDL-c response to atorvastatin with polymorphisms in LPA and APOE genes (Deshmukh et al. 2012). The CYP7A1 and CYP3A4 gene polymorphisms in Chinese Hans and Chileans (Rosales et al. 2012; Jiang et al. 2012), and the CYP3AP1*3 allele in Chinese women (Li et al. 2011) were also correlated to response to atorvastatin. Thus, other loci could relate to the effects seen in this study. Further studies are recommended to evaluate the effect of other potential polymorphisms in several genes.
In conclusion, this study showed an association between the lipid lowering effect of atorvastatin and the MDR1 gene G2677T/A, and C3435T, but not C1236T polymorphisms.
Acknowledgments
This work was supported by a grant to KA from the Scientific Research funds, Amman, Jordan.
References
- Allabi AC, Gala JL, Horsmans Y. CYP2C9, CYP2C19, ABCB1 (MDR1) genetic polymorphisms and phenytoin metabolism in a Black Beninese population. Pharmacogenet Genomics. 2005;15:779–786. doi: 10.1097/01.fpc.0000174787.92861.91. [DOI] [PubMed] [Google Scholar]
- Anglicheau D, Thervet E, Etienne I, Hurault De Ligny B, Le Meur Y, Touchard G, Buchler M, Laurent-Puig P, Tregouet D, Beaune P, Daly A, Legendre C, Marquet P. CYP3A5 and MDR1 genetic polymorphisms and cyclosporine pharmacokinetics after renal transplantation. Clin Pharmacol Ther. 2004;75:422–433. doi: 10.1016/j.clpt.2004.01.009. [DOI] [PubMed] [Google Scholar]
- Bellusci CP, Rocco CA, Aulicino PC, Mecikovsky D, Bologna R, Sen L, Mangano A. MDR1 3435T and 1236T alleles delay disease progression to pediatric AIDS but have no effect on HIV-1 vertical transmission. AIDS. 2010;24:833–840. doi: 10.1097/QAD.0b013e328336abfc. [DOI] [PubMed] [Google Scholar]
- Bodor M, Kelly EJ, Ho RJ. Characterization of the human MDR1 gene. Aaps J. 2005;7:E1–E5. doi: 10.1208/aapsj070101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cascorbi I. P-glycoprotein: tissue distribution, substrates, and functional consequences of genetic variations. Handb Exp Pharmacol. 2011;201:261–283. doi: 10.1007/978-3-642-14541-4_6. [DOI] [PubMed] [Google Scholar]
- Chelule PK, Gordon M, Palanee T, Page T, Mosam A, Coovadia HM, Cassol S. MDR1 and CYP3A4 polymorphisms among African, Indian, and white populations in KwaZulu-Natal, South Africa. Clin Pharmacol Ther. 2003;74:195–196. doi: 10.1016/S0009-9236(03)00151-6. [DOI] [PubMed] [Google Scholar]
- Cigana C, Nicolis E, Pasetto M, Assael BM, Melotti P. Effects of azithromycin on the expression of ATP binding cassette transporters in epithelial cells from the airways of cystic fibrosis patients. J Chemother. 2007;19:643–649. doi: 10.1179/joc.2007.19.6.643. [DOI] [PubMed] [Google Scholar]
- DeGorter MK, Xia CQ, Yang JJ, Kim RB. Drug transporters in drug efficacy and toxicity. Annu Rev Pharmacol Toxicol. 2012;52:249–273. doi: 10.1146/annurev-pharmtox-010611-134529. [DOI] [PubMed] [Google Scholar]
- Deshmukh HA, Colhoun HM, Johnson T, McKeigue PM, Betteridge DJ, Durrington PN, Fuller JH, Livingstone S, Charlton-Menys V, Neil A, Poulter N, Sever P, Shields DC, Stanton AV, Chatterjee A, Hyde C, Calle RA, Demicco DA, Trompet S, Postmus I, Ford I, Jukema JW, Caulfield M, Hitman GA. Genome-wide association study of genetic determinants of LDL-c response to atorvastatin therapy: importance of Lp(a) J Lipid Res. 2012;53:1000–1011. doi: 10.1194/jlr.P021113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dong HJ, Miao KR, Qiao C, Zhuang Y, Shen WY, Hong M, Fan L, Liu P, Xu W, Li JY. Polymorphisms and haplotypes in multidrug resistance 1 gene are not associated with chronic lymphocytic leukemia susceptibility and prognostic parameters of chronic lymphocytic leukemia in Chinese population. Leuk Lymphoma. 2011;52:1003–1009. doi: 10.3109/10428194.2011.557454. [DOI] [PubMed] [Google Scholar]
- Foger B. Lipid lowering therapy in type 2 diabetes. Wien Med Wochenschr. 2011;161:289–296. doi: 10.1007/s10354-011-0908-4. [DOI] [PubMed] [Google Scholar]
- Gaikovitch EA, Cascorbi I, Mrozikiewicz PM, Brockmoller J, Frotschl R, Kopke K, Gerloff T, Chernov JN, Roots I. Polymorphisms of drug-metabolizing enzymes CYP2C9, CYP2C19, CYP2D6, CYP1A1, NAT2 and of P-glycoprotein in a Russian population. Eur J Clin Pharmacol. 2003;59:303–312. doi: 10.1007/s00228-003-0606-2. [DOI] [PubMed] [Google Scholar]
- Gelskey DE, Young TK, MacDonald SM. Screening with total cholesterol: determining sensitivity and specificity of the National Cholesterol Education Program’s guidelines from a population survey. J Clin Epidemiol. 1994;47:547–553. doi: 10.1016/0895-4356(94)90301-8. [DOI] [PubMed] [Google Scholar]
- Goldstein DB. The genetics of human drug response. Philos Trans R Soc Lond B Biol Sci. 2005;360:1571–1572. doi: 10.1098/rstb.2005.1686. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Goreva OB, Grishanova AY, Domnikova NP, Mukhin OV, Lyakhovich VV. MDR1 Gene C1236T and C6 + 139T polymorphisms in the Russian population: associations with predisposition to lymphoproliferative diseases and drug resistance. Bull Exp Biol Med. 2004;138:404–406. doi: 10.1007/s10517-004-0024-1. [DOI] [PubMed] [Google Scholar]
- Haslam IS, Jones K, Coleman T, Simmons NL. Induction of P-glycoprotein expression and function in human intestinal epithelial cells (T84) Biochem Pharmacol. 2008;76:850–861. doi: 10.1016/j.bcp.2008.07.020. [DOI] [PubMed] [Google Scholar]
- Hattori H, Suminoe A, Wada M, Koga Y, Kohno K, Okamura J, Hara T, Matsuzaki A. Regulatory polymorphisms of multidrug resistance 1 (MDR1) gene are associated with the development of childhood acute lymphoblastic leukemia. Leuk Res. 2007;31:1633–1640. doi: 10.1016/j.leukres.2007.04.009. [DOI] [PubMed] [Google Scholar]
- Hoffmeyer S, Burk O, von Richter O, Arnold HP, Brockmoller J, Johne A, Cascorbi I, Gerloff T, Roots I, Eichelbaum M, Brinkmann U. Functional polymorphisms of the human multidrug-resistance gene: multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc Natl Acad Sci USA. 2000;97:3473–3478. doi: 10.1073/pnas.97.7.3473. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jiang XY, Zhang Q, Chen P, Li SY, Zhang NN, Chen XD, Wang GC, Wang HB, Zhuang MQ, Lu M (2012) CYP7A1 polymorphism influences the LDL cholesterol-lowering response to atorvastatin. J Clin Pharm Ther 37:719–723 [DOI] [PubMed]
- Kajinami K, Brousseau ME, Ordovas JM, Schaefer EJ. Polymorphisms in the multidrug resistance-1 (MDR1) gene influence the response to atorvastatin treatment in a gender-specific manner. Am J Cardiol. 2004;93:1046–1050. doi: 10.1016/j.amjcard.2004.01.014. [DOI] [PubMed] [Google Scholar]
- Kato M, Fukuda T, Serretti A, Wakeno M, Okugawa G, Ikenaga Y, Hosoi Y, Takekita Y, Mandelli L, Azuma J, Kinoshita T. ABCB1 (MDR1) gene polymorphisms are associated with the clinical response to paroxetine in patients with major depressive disorder. Prog Neuropsychopharmacol Biol Psychiatry. 2008;32:398–404. doi: 10.1016/j.pnpbp.2007.09.003. [DOI] [PubMed] [Google Scholar]
- Khabour OF, Alzoubi KH, Al-azzam SI, Mhaidat NM (2012) Identification and distribution of MDR1 single nucleotide polymorphisms in Jordanian population: detection of a novel variant. Gen Mol Res 12:801–808 [DOI] [PubMed]
- Kim RB, Leake BF, Choo EF, Dresser GK, Kubba SV, Schwarz UI, Taylor A, Xie HG, McKinsey J, Zhou S, Lan LB, Schuetz JD, Schuetz EG, Wilkinson GR. Identification of functionally variant MDR1 alleles among European Americans and African Americans. Clin Pharmacol Ther. 2001;70:189–199. doi: 10.1067/mcp.2001.117412. [DOI] [PubMed] [Google Scholar]
- Komoto C, Nakamura T, Sakaeda T, Kroetz DL, Yamada T, Omatsu H, Koyama T, Okamura N, Miki I, Tamura T, Aoyama N, Kasuga M, Okumura K. MDR1 haplotype frequencies in Japanese and Caucasian, and in Japanese patients with colorectal cancer and esophageal cancer. Drug Metab Pharmacokinet. 2006;21:126–132. doi: 10.2133/dmpk.21.126. [DOI] [PubMed] [Google Scholar]
- Kuypers DR, de Jonge H, Naesens M, Vanrenterghem Y. Effects of CYP3A5 and MDR1 single nucleotide polymorphisms on drug interactions between tacrolimus and fluconazole in renal allograft recipients. Pharmacogenet Genomics. 2008;18:861–868. doi: 10.1097/FPC.0b013e328307c26e. [DOI] [PubMed] [Google Scholar]
- Lennernas H. Clinical pharmacokinetics of atorvastatin. Clin Pharmacokinet. 2003;42:1141–1160. doi: 10.2165/00003088-200342130-00005. [DOI] [PubMed] [Google Scholar]
- Lewis LD, Miller AA, Rosner GL, Dowell JE, Valdivieso M, Relling MV, Egorin MJ, Bies RR, Hollis DR, Levine EG, Otterson GA, Millard F, Ratain MJ. A comparison of the pharmacokinetics and pharmacodynamics of docetaxel between African-American and Caucasian cancer patients: CALGB 9871. Clin Cancer Res. 2007;13:3302–3311. doi: 10.1158/1078-0432.CCR-06-2345. [DOI] [PubMed] [Google Scholar]
- Li YP, Zhang LR, Jia M, Hu XJ. CYP3AP1*3 allele is associated with lipid-lowering efficacy of simvastatin and atorvastatin in Chinese women. J Clin Pharmacol. 2011;51:181–188. doi: 10.1177/0091270010370589. [DOI] [PubMed] [Google Scholar]
- Maeda K, Sugiyama Y. Impact of genetic polymorphisms of transporters on the pharmacokinetic, pharmacodynamic and toxicological properties of anionic drugs. Drug Metab Pharmacokinet. 2008;23:223–235. doi: 10.2133/dmpk.23.223. [DOI] [PubMed] [Google Scholar]
- Mega JL, Morrow DA, Brown A, Cannon CP, Sabatine MS. Identification of genetic variants associated with response to statin therapy. Arterioscler Thromb Vasc Biol. 2009;29:1310–1315. doi: 10.1161/ATVBAHA.109.188474. [DOI] [PubMed] [Google Scholar]
- Milojkovic M, Stojnev S, Jovanovic I, Ljubisavljevic S, Stefanovic V, Sunder-Plassman R. Frequency of the C1236T, G2677T/A and C3435T MDR1 gene polymorphisms in the Serbian population. Pharmacol Rep. 2011;63:808–814. doi: 10.1016/S1734-1140(11)70593-X. [DOI] [PubMed] [Google Scholar]
- Munshi A (2012) Genetic variation in MDR1, LPL and eNOS genes and the response to atorvastatin treatment in ischemic stroke. Hum Genet 131:1775–1781 [DOI] [PubMed]
- Rodrigues AC, Rebecchi IM, Bertolami MC, Faludi AA, Hirata MH, Hirata RD. High baseline serum total and LDL cholesterol levels are associated with MDR1 haplotypes in Brazilian hypercholesterolemic individuals of European descent. Braz J Med Biol Res. 2005;38:1389–1397. doi: 10.1590/S0100-879X2005000900014. [DOI] [PubMed] [Google Scholar]
- Rosales A, Alvear M, Cuevas A, Saavedra N, Zambrano T, Salazar LA. Identification of pharmacogenetic predictors of lipid-lowering response to atorvastatin in Chilean subjects with hypercholesterolemia. Clin Chim Acta. 2012;413:495–501. doi: 10.1016/j.cca.2011.11.003. [DOI] [PubMed] [Google Scholar]
- Rosenberg MF, Callaghan R, Ford RC, Higgins CF. Structure of the multidrug resistance P-glycoprotein to 2.5 nm resolution determined by electron microscopy and image analysis. J Biol Chem. 1997;272:10685–10694. doi: 10.1074/jbc.272.16.10685. [DOI] [PubMed] [Google Scholar]
- Schaeffeler E, Eichelbaum M, Brinkmann U, Penger A, Asante-Poku S, Zanger UM, Schwab M. Frequency of C3435T polymorphism of MDR1 gene in African people. Lancet. 2001;358:383–384. doi: 10.1016/S0140-6736(01)05579-9. [DOI] [PubMed] [Google Scholar]
- Wang D, Sadee W. Searching for polymorphisms that affect gene expression and mRNA processing: example ABCB1 (MDR1) Aaps J. 2006;8:E515–E520. doi: 10.1208/aapsj080361. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Woodahl EL, Ho RJ. The role of MDR1 genetic polymorphisms in interindividual variability in P-glycoprotein expression and function. Curr Drug Metab. 2004;5:11–19. doi: 10.2174/1389200043489108. [DOI] [PubMed] [Google Scholar]
- Zhang Y, Jiang XH, Hu YQ, Li ZR, Su L, Wang ZG, Ma G. MDR1 genotypes do not influence the absorption of a single oral dose of 600 mg valacyclovir in healthy Chinese Han ethnic males. Br J Clin Pharmacol. 2008;66:247–254. doi: 10.1111/j.1365-2125.2008.03189.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou SF, Di YM, Chan E, Du YM, Chow VD, Xue CC, Lai X, Wang JC, Li CG, Tian M, Duan W. Clinical pharmacogenetics and potential application in personalized medicine. Curr Drug Metab. 2008;9:738–784. doi: 10.2174/138920008786049302. [DOI] [PubMed] [Google Scholar]