Abstract
Background:
Helicobacter pylori is known to be a causative agent of chronic active gastritis, peptic ulcer and gastric cancer in human. Diverse genotypes of H. pylori strains have different virulence potency and geographic distribution.
Objectives:
The purpose of this study was to investigate the association between the cytotoxin-associated gene (cagA), and the various vacuolating cytotoxin (vacA) genotypes of H. pylori strains and clinical outcomes in patients referred to Shahid-Beheshti Hospital in Hamadan, Iran.
Patients and Methods:
In this cross-sectional study, biopsy samples were collected consecutively from 153 patients with gastric cancer (GC), peptic ulcer dyspepsia (PUD) and non-ulcer dyspepsia (NUD) in the gastroenterology department of Shahid-Beheshti Hospital in Hamadan province, the west of Iran. H. pylori infection was confirmed in 83 patients (3 with GC, 27 with PUD, and 53 with NUD) by histology, rapid urease test (RUT) and culture. Genomic DNA was extracted from the bacterial isolate and was further confirmed with 16S rRNA gene sequencing as H. pylori, and characterized based on cagA and vacA genotyping using the polymerase chain reaction (PCR) method.
Results:
In this study, vacA genotypes s1/m2, s1/m1, s2/m2 and s2/m1 were determined in 43.4%, 19.3%, 13.2% and 6% of the isolated H. pylori, respectively. The vacAs1 genotype was detected in 52 (62.6%) isolates, of which the vacAs1a genotype was detected in 45.2, 40.7, and 66.6% of the isolates from patients with NUD, PUD, and GC, respectively. The cagA-positive genotype was determined in 73 (87.9%) isolates and 10 (12.1%) were negative. The frequency rates of cagA gene were 84.9, 92.6 and 100% in isolates of patients with NUD, PUD, and GC, respectively. The cagA-positive genotype is strongly associated with s1a/m2 and s1a/m1 vacA genotypes.
Conclusions:
The most predominant VacA genotypes in our areas were s1/m2 and s1/m1, which regard as the genotypes with more virulence intensity. The H. pylori vacAs1a, cagA genotypes have a significant relationship with the presence of PUD and GC in Iranian patients with dyspepsia.
Keywords: Helicobacter Pylori, VacA, cagA, Genotyping
1. Background
Helicobacter pylori can colonize the stomach of about fifty percent of the world's population. The bacteria are primarily observed on the mucosa of the gastric antrum (1). Colonization with H. pylori itself is not a disease, but H. pylori is an etiologic agent of the acute or chronic gastritis, and a predisposing condition to the peptic ulcer disease, gastric carcinoma, and B-cell mucosa associated lymphoid tissue (MALT) lymphoma (2-4). The clinical outcome of H. pylori infection depends on a diversity of factors, which are related to the host (e.g. blood group antigens and polymorphisms in interleukin 1 gene cluster), the bacterium (e.g. strain-specific genes, differential gene expression, phase variation and allelic variation), and the environment (e.g. age and smoking) (5). The genes of H. pylori (e.g. CagA and VacA) have been identified as being virulence-associated. These virulence and pathogenicity factors are well-implicated in studies for their role in the progress of diseases leading to gastric ulcer and gastric cancer (6-8). The vacuolating cytotoxin (vacA) gene is present in virtually all H. pylori strains and contains at least two variable regions, the signal (s) region, which encodes the signal peptide, and the middle (m) region. There are two major s-region types, s1 and s2, and three known s1-region subtypes (s1a, s1b, s1c). The m region has been divided into two allelic type, m1 and m2. Among type m1 strains, subtypes m1a and m1b have been identified (9). Although all strains of H. pylori contain the vacA gene, they vary in terms of their ability to produce cytotoxin. The amount of cytotoxin produced is highest with the s1/m1 allele, followed by the s1/m2 allele, while no cytotoxin activity is found when s2/m2 is present. Specific vacA genotypes are associated with the level of toxin production and clinical diseases like PUD and GCin different parts of the world (10-12). The cytotoxin-associated gene (cagA) is a marker of 40 kb genomic pathogenicity island. A significant association between the presence of ulcers or gastric carcinoma and vacA type s1 and cagA genes has been reported (13). H. pylori eradication leads to the healing of gastritis and peptic ulcer disease, and probably also has a beneficial effect on regression of atrophic gastritis and prevention of distal gastric cancer (14, 15).
2. Objectives
There are no data regarding the prevalence and molecular characteristics of H. pylori in patients with gastrointestinal discomfort in Hamadan province. This study aimed to evaluate the H. pylori vacA, cagA genotypes and their correlation with clinical outcomes in patients with dyspepsia in Hamadan, the west of Iran.
3. Materials and Methods
3.1. Clinical Specimen
The study population consisted of 153 adult patients (89 men and 64 women) aged 16-88 (mean age, 53) years. This descriptive cross- sectional study was performed on 153 adult patients [4 gastric cancer (GC), 42 peptic ulcer dyspepsia (PUD) and 107 non-ulcer dyspepsia (NUD)] underwent an upper gastroduodenal endoscopy for the diagnosis and treatment purposes in the gastroenterology department of Shahid-Beheshti Hospital (it’s a governmental and referral hospital) in Hamadan province from May 2010 to February 2011. The diagnosis of gastroduodenal diseases was based on the clinical, endoscopic and histopathological examinations. The clinical variables were extracted from medical records of the patients by a specialist physician. The ethics committee of the Hamadan University of Medical Sciences approved the study protocol with the number 546788 and the written consent was obtained from all the patients. Subjects who had received anti-microbial therapy, H2 receptor blockers, and proton pump inhibitors in the preceding 20 days prior to endoscopy or anti-H. Pylori treatments in the past were excluded from the study. Biopsy specimens of antrum from each patient were collected for the rapid urease test, culture, histopathology and PCR.
3.2. Bacterial Isolation and Culture
During each endoscopy, three antral biopsies were obtained and subjected to the following tests: The first biopsy for rapid urease test (RUT), the second for culture, and the last for histopathology following the standard protocol as described earlier (16). The biopsy specimens for culture were taken into screw capped bottle containing Thioglycolate broth (Merck, Germany) with 0.5% agar and 3% yeast extract and immediately transported to the microbiology lab at Faculty of Medicine, Hamadan University of Medical Sciences. Since H. pylori is a fastidious organism, the culture of H. pylori has done with some modifications as follows: gastric biopsy specimens were ground with tissue homogenizer and then inoculated onto Brucella Agar (Merck, Germany) media with 10% sheep blood and 10% fetal bovine serum (GIPCO), and Campylobacter Selective Supplement (Merck, Germany), and incubated under microaerophilic (5% O2, 10% CO2, and 85% N2) conditions at 37°C for 3 to 5 days. Organisms were identified as H. pylori on the basis of morphology on Gram stain observation and by oxidase, catalase, urease tests and 16s rRNA PCR (Table 1). All the isolated H. pylori strains were kept frozen at -70°C in the tryptone soya broth medium containing 15% (vol/vol) glycerol until genotyping was performed.
Table 1. Oligonucleotide Primers Used for cagA and vacA Typing.
| Primer Sequence Annealing Size of Designation (5′ to 3′) 0C Product (bp) |
|---|
| cagA ACCCCTAGTCGGTAATGGG 49 508 |
| GCTTTAGCTTCTGAYACYGC |
| vacA s1 ATGGAAATACAACAAACACAC 48 259 |
| CTGCTTGAATGCGCCAAAC |
| vacA s1a GTCAGCATCACACCGCAAC 54 190 |
| CTGCTTGAATGCGCCAAAC |
| vacA s1b AGCGCCATACCGCAAGAG 55 187 |
| CTGCTTGAATGCGCCAAAC |
| vacA s1c CTCTCGCTTTAGTGGGGYT 52 213 |
| CTGCTTGAATGCGCCAAAC |
| vacA s2 CCTAACACGCCAAATGATCC 54 199 |
| CTGCTTGAATGCGCCAAAC |
| vacA m1a GGTCAAAATGCGGTCATGG 48 290 |
| CCATTGGTACCTGTAGAAAC |
| vacA m1b GGCCCCAATGCAGTCATGGAT 56 291 |
| CTGTTAGTGCCTAAAGAAGCAT |
| vacA m2 GGAGCCCCAGGAAACATTG 50 352 |
| CATAACTAGCGCCTTGCAC |
| 16s rRNA CTGGAGAGACTAAGCCCTCC 49 446 |
| AGGATCAAGGTTTAAGGATT |
3.3. PCR of H. Pylori Genes
DNA was extracted from the bacterial growth by boiling in 200 μL of sterile double distilled water for 10 min and cooling it on ice for 5 min. It was then centrifuged at 12000 rpm for 10 min. Fifty Mm NaOH as 1/5 was added to the supernatant and centrifuged at 12000 rpm for 5 min. The supernatant containing DNA was used for PCR. The genus-specific PCR involving 16S rRNA gene (17) and genotyping of cagA and vacA genes were performed using specific primers (9) (Table 1). PCR was performed in a 25 μL reaction volume containing 5µL of genomic DNA, 1X PCR buffer, 1.5 mM MgCl2, 0.2 mM of each deoxynucleotide (Fermentase, Co), 0.5 μM of each specific primer and 1U of Taq DNA polymerase (Fermentase, Co). All the PCR reactions were performed using thermocycler (Eppendorf 5323, Germany). The amplified product was electrophoresed in 1.5% agarose containing 0.5 μg/mL ethidium bromide and examined under a transilluminator .
3.4. Statistical Analysis
Descriptive statistics, the Chi-square and Fisher's exact tests were used to analyze the data. P Value of < 0.05 was considered statistically significant.
4. Results
Patients consisted of 64 females and 89 males (mean age 53 years, range 16-88 years) (Table 2). From 153 biopsy samples, 137 (89.5%) samples were positive for H. pylori using the histology, 76 (49.7%) by the rapid urease test, 83 (54.2%) by culture [3 gastric cancer (GC), 27 peptic ulcer dyspepsia (PUD) and 53 non- ulcer dyspepsia (NUD)] and confirmed by 16s rRNA gene PCR. PCR amplification of H. pylori 16s rRNA gene gave band size of 446 bp.
Table 2. Distribution Between vacA Subtypes, Cag A and Clinical Outcomes a,b,c.
| Genotypes | PUD (n = 27) | NUD (n = 53) | Cancer (n = 3) | Total (n = 83) | X2 | P Value |
|---|---|---|---|---|---|---|
| vacA s1 | 16 (59.3) | 33 (62.3) | 3 (100) | 52 (62.7) | 1.925 | 0.382 |
| vacA s2 | 5 (18.5) | 11 (20.8) | 0 | 16 (19.3) | 0.801 | 0.670 |
| vacA m1 | 8 (29.6) | 12 (22.6) | 1 (33.3) | 21 (25.3) | 0.568 | 0.853 |
| vacA m2 | 13 (48.1) | 32 (60.4) | 2 (66.7) | 47 (56.6) | 1.217 | 0.544 |
| vacA s1/m1 | 6 (22.2) | 9 (17) | 1 (33.3) | 16 (19.3) | 0.711 | 0.701 |
| vacA s1/m2 | 10 (37) | 24 (45.3) | 2 (66.7) | 36 (43.4) | 1.183 | 0.554 |
| vacA s2/m1 | 2 (7.4) | 3 (5.7) | 0 | 5 (6.0) | 0.296 | 0.862 |
| vacA s2/m2 | 3 (11.1) | 8 (15.1) | 0 | 11 (13.3) | 0.722 | 0.697 |
| CagA | 25 (92.6) | 45 (84.9) | 3 (100) | 73 (88) | 1.424 | 0.491 |
a Patients distribution consisted of 153 adult patients (89 men and 64 women) aged 16-88 years (mean age, 53).
b Data are presented as No.(%).
c Abbreviations: PUD; peptic ulcer dyspepsia, NUD; non-ulcer dyspepsia.
4.1. PCR of cagA and vacA Genes
Out of 83 culture positive samples, 73 (87.9%) samples yielded the 508bp product representing cagA positive, in which 25 (92.6%) isolates found in 27 patients with PUD, 3 (100%) isolates in 3 patients with GC, and 45 (84.9 %) isolates in 53 patients with NUD. Sixty-eight (81.9 %) isolates of H. pylori were found to be vacA-positive using the specific primers for s1 52 (62.7 %) and s2 16 (19.3 %) genes (Table 2). Thirty-seven (44.6%) of 83 strains yielded the 190 bp product representing vacA signal sequence genotype s1a, 2 (2.4%) yielded the 187 bp product representing genotype s1b and 13 (15.7%) yielded the 213bp product representing genotype s1c. Sixteen (19.3%) yielded the 199 bp product representing genotype s2. Fourteen (16.9%) isolates were classified as type m1a and 7 (8.4%) were classified as type m1b. Forty-seven (56.6%) isolates were classified as type m2 (Table 2). The relationship between the particular vacA genotypes and the occurrence of different gastrointestinal diseases was also determined (Table 2). Combinations of vacA homologue containing signal sequence and middle region (s1a/m1, s1a/m2, s1b/m1, s1b/m2, s1c/m1, s1c/m2, s2/m1 and s2/m2) were estimated. The s1a/m1 and s1a/m2 combinations were found in 10 (12%) and 27 (32.5%) patients, respectively. The combination of s1b/m1 was found in 2 (2.4%) patient and s1b/m2 in 2 (2.4%) isolates. The s1c/m1 and s1c/m2 were found in 6 (7.2%) patients. The s2m2 combination was identified in 11 (13.3%) and s2m1 in 5 (6 %) out of 83 patients (Table 3). Distribution of the combination of vacA homologue containing signal sequence and middle region with the occurrence of different gastrointestinal diseases was also determined (Table 3). S1/m2 (36 patients) was the predominant combination found in 10 (37%) out of 27 patients with PUD, 24 (45.3%) out of 53 patients with NUD, 2 (66.6%) with GC, respectively. All 27 (100%) s1a/m2 and 10 (100%) s1a/m1 vacA genotypes were associated with the cagA-positive genotype.
Table 3. Distribution Between Allelic Variants of vacA and Clinical Outcomes a,b.
| Allelic variants of vacA | PUD (n = 27) | NUD (n = 53) | Cancer (n = 3) | Total (n = 83) | X2 | P Value |
|---|---|---|---|---|---|---|
| s1 | ||||||
| s1a | 11 (40.7) | 24 (45.3) | 2 (66.1) | 37 (44.6) | 0.764 | 0.682 |
| s1b | 0 | 2 (3.8) | 0 | 2 (2.4) | 1.16 | 0.560 |
| s1c | 5 (18.5) | 7 (13.2) | 1 (33.3) | 13 (15.7) | 1.118 | 0.572 |
| s2 | 5 (18.5) | 11 (20.8) | 0 | 16 (19.3) | 0.801 | 0.610 |
| m1 | ||||||
| m1a | 6 (22.2) | 7 (13.2) | 1 (33.3) | 14 (16.9) | 1.638 | 0.441 |
| m1b | 2 (7.4) | 5 (9.4) | 0 | 7 (8.4) | 0.382 | 0.826 |
| m2 | ||||||
| - | 13 (48.1) | 32 (60.4) | 2 (66.7) | 47 (56.6) | 1.217 | 0.544 |
| s1a/m1a | 3 (11.1) | 4 (7.5) | 1 (33.3) | 8 (9.6) | 2.267 | 0.322 |
| s1a/m1b | 1 (3.7) | 1 (1.9) | 0 | 2 (2.4) | 0.328 | 0.849 |
| s1b/m1a | 0 | 0 | 0 | 0 | - | - |
| s1b/m1b | 0 | 0 | 0 | 0 | - | - |
| s1c/m1a | 1 (3.7) | 2 (3.8) | 0 | 3 (3.6) | 0.117 | 0.943 |
| s1c/m1b | 1 (3.7) | 2 (3.8) | 0 | 3 (3.6) | 0.117 | 0.943 |
| s1a/m2 | 7 (25.9) | 18 (34) | 2 (66.7) | 27 (32.5) | 2.179 | 0.336 |
| s1b/m2 | 0 | 2 (3.8) | 0 | 2 (2.4) | 1.160 | 0.560 |
| s1c/m2 | 4 (14.8) | 3 (5.7) | 0 | 7 (8.4) | 2.228 | 0.328 |
| s2/m1a | 2 (7.4) | 1 (1.9) | 0 | 3 (3.6) | 1.682 | 0.431 |
| s2/m1b | 0 | 2 (3.8) | 0 | 2 (2.4) | 1.160 | 0.560 |
| s2/m2 | 3 (11.1) | 8 (15.1) | 0 | 11 (13.3) | 0.722 | 0.697 |
a Data are presented as No.(%).
b Abbreviations: PUD; peptic ulcer dyspepsia, NUD; non-ulcer dyspepsia.
5. Discussion
H. pylori are one of the most genetically diverse bacterial species with geographic genetic variations. Studies in several countries have demonstrated different distribution of vacA alleles and the presence of cagA gene in H. pylori genotypes strains and their association with gastro duodenal diseases (18-20). In Europe and North America, the prevalence of cagA-positive H. pylori has been reported between 64% and 79% whereas in Asia (e.g. Japan, Korea, China and Turkey), the frequency of cagA-positive H. pylori strains is usually over 90% (21). Few studies have been done on cagA status in Iran. The CagA gene was present in 44% of the patients according to an investigation by Siavoshi et al. (22). This number was 87.9% in our study, which was not near to the number reported in the European and North American populations. No significant association between cagA status and diseases has been observed in Asian countries; although the majority of H. pylori strains are cagA-positive, but the previous studies from Iran reported that the cagA-positive strains were more frequent among patients with gastric cancer compared to other patients (22). The vacA genotypes show considerable geographic variations. In our study, a cagA-positive genotype was determined in 87.9% of the H. pylori samples and the vacA genotypes s1/m2, s1/m1, s2/m2 and s2/m1 were determined in 43.4%, 19.3%, 13.2% and 6%, respectively. This observation is similar to China and Turkey; but in the middle region, results are substantially different from Brazil and Portugal with m1 dominant type. Also, Aydin et al. from Turkey and the large multicenter study of van Doorn et al. reported an equal prevalence of m1 and m2 subtypes (6, 23-26). Martin et al. and Nogueira et al. have been observed that allele s1 was associated with high degrees of gastric tissue inflammation; although this correlation was in companion with cagA positivity and m1 allele, which we found no association (21, 27). However, the current study does not rule out an association between the expression of vacA or cagA protein and the virulence of H. Pylori (28-30). In a recent study by Ghotaslou et al. in 2013, 68.7% of the patients were infected with cagA-positive strains, similar to another Iranian study (31). However, this is different from studies from East to South Asian countries where more than 90% of the strains carry the cagA gene regardless of clinical outcomes. Our result is higher than the reported values from Europe and the USA where the prevalence of cagA-positive strains is between 60-70% (32). In the present study, out of 83 culture-positive samples, 73 (87.9%) samples yielded the 508 bp product representing cagA-positive, in which 25 (92.6%) isolates were found in 27 patients with PUD, 3 (100%) out of 3 patients with GC, and 45 (84.9 %) out of 53 patients with NUD. No correlation of cagA could be established with GC and PUD, although cagA had been identified as a virulence marker and associated with increased severity of disease in some geographic regions (33, 34). High prevalence of cagA (80-90%) independent of the disease status had been reported in some Indian studies. These studies indicate that cagA cannot be considered as the sole virulence marker for determination of the disease outcome at least in India as has been reported from other geographic regions (12). The present study suggests that vacAs2 region variants are not involved in gastric carcinogenesis and PUD. The s1a/m1 and s1a/m2 combinations were found in 10 (12%) and 27 (32.5%) patients, respectively. The combination of s1b/m1 was not found in any patient and s1b/m2 was found in 2 (2.4 %) isolates. The s1c/m1 was found in 6 (7.2%) and s1c/m2 in 6 (7.2%) patients. The s2m2 combination was identified in 11 (13.3%) out of 83 patients. The s2m1 combination was found in 5 (6 %) patients. We also found a large number of cagA-positive H. Pylori (87.9%) in our patient population. This is the first study in our area that reports high prevalence of cagA gene in the vacA-positive strains. These differences may be geographical and because of high frequency of cagA positive strains in our population with no significant difference between disease and control populations. Excluding the mixed infection and combining the groups, we observed that vacAs1a/m2 was frequently found in our study population, which is similar to several other findings.
Acknowledgments
The authors are grateful to the Vice Chancellor for Research of the Hamadan University of Medical Sciences for providing the financial support for this study.
Footnotes
Financial Disclosure:The authors are grateful to Vice Chancellor for Research of the Hamadan University of Medical Sciences, for providing financial support of this study.
Funding/Support:The funding organization is for the deputy of Research of Hamadan University of Medical Sciences, but it has no role in the design and conduct of the study; collection, management, and analysis of the data; or preparation, review, and approval of the manuscript.
References
- 1.Marshall BJ, Joyce H, Anwar DI. Original isolation of Campylobacter pyloridis from human gastric mucosa. Microbios let. 1984;25(1):83–8. [Google Scholar]
- 2.Blaser MJ. Helicobacter pylori: microbiology of a 'slow' bacterial infection. Trends Microbiol. 1993;1(7):255–60. doi: 10.1016/0966-842x(93)90047-u. [DOI] [PubMed] [Google Scholar]
- 3.Parsonnet J, Friedman GD, Vandersteen DP, Chang Y, Vogelman JH, Orentreich N, et al. Helicobacter pylori infection and the risk of gastric carcinoma. N Engl J Med. 1991;325(16):1127–31. doi: 10.1056/NEJM199110173251603. [DOI] [PubMed] [Google Scholar]
- 4.Parsonnet J, Hansen S, Rodriguez L, Gelb AB, Warnke RA, Jellum E, et al. Helicobacter pylori infection and gastric lymphoma. N Engl J Med. 1994;330(18):1267–71. doi: 10.1056/NEJM199405053301803. [DOI] [PubMed] [Google Scholar]
- 5.Hocker M, Hohenberger P. Helicobacter pylori virulence factors--one part of a big picture. Lancet. 2003;362(9391):1231–3. doi: 10.1016/S0140-6736(03)14547-3. [DOI] [PubMed] [Google Scholar]
- 6.van Doorn LJ, Figueiredo C, Sanna R, Plaisier A, Schneeberger P, de Boer W, et al. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology. 1998;115(1):58–66. doi: 10.1016/s0016-5085(98)70365-8. [DOI] [PubMed] [Google Scholar]
- 7.Peek RM, Jr., Thompson SA, Donahue JP, Tham KT, Atherton JC, Blaser MJ, et al. Adherence to gastric epithelial cells induces expression of a Helicobacter pylori gene, iceA, that is associated with clinical outcome. Proc Assoc Am Physicians. 1998;110(6):531–44. [PubMed] [Google Scholar]
- 8.Ito Y, Azuma T, Ito S, Suto H, Miyaji H, Yamazaki Y, et al. Sequence analysis and clinical significance of the iceA gene from Helicobacter pylori strains in Japan. J Clin Microbiol. 2000;38(2):483–8. doi: 10.1128/jcm.38.2.483-488.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Yamazaki S, Yamakawa A, Okuda T, Ohtani M, Suto H, Ito Y, et al. Distinct diversity of vacA, cagA, and cagE genes of Helicobacter pylori associated with peptic ulcer in Japan. J Clin Microbiol. 2005;43(8):3906–16. doi: 10.1128/JCM.43.8.3906-3916.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Atherton JC, Cao P, Peek RM, Jr., Tummuru MK, Blaser MJ, Cover TL. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J Biol Chem. 1995;270(30):17771–7. doi: 10.1074/jbc.270.30.17771. [DOI] [PubMed] [Google Scholar]
- 11.Atherton JC, Peek RM, Jr., Tham KT, Cover TL, Blaser MJ. Clinical and pathological importance of heterogeneity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori. Gastroenterology. 1997;112(1):92–9. doi: 10.1016/s0016-5085(97)70223-3. [DOI] [PubMed] [Google Scholar]
- 12.Saxena A, Shukla S, Prasad KN, Ghoshal UC. Virulence attributes of Helicobacter pylori isolates & their association with gastroduodenal disease. Indian J Med Res. 2011;133:514–20. [PMC free article] [PubMed] [Google Scholar]
- 13.Asrat D, Nilsson I, Mengistu Y, Kassa E, Ashenafi S, Ayenew K, et al. Prevalence of Helicobacter pylori vacA and cagA genotypes in Ethiopian dyspeptic patients. J Clin Microbiol. 2004;42(6):2682–4. doi: 10.1128/JCM.42.6.2682-2684.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Bayerdorffer E, Neubauer A, Rudolph B, Thiede C, Lehn N, Eidt S, et al. Regression of primary gastric lymphoma of mucosa-associated lymphoid tissue type after cure of Helicobacter pylori infection. MALT Lymphoma Study Group. Lancet. 1995;345(8965):1591–4. doi: 10.1016/s0140-6736(95)90113-2. [DOI] [PubMed] [Google Scholar]
- 15.Sugiyama T, Sakaki N, Kozawa H, Sato R, Fujioka T, Satoh K, et al. Sensitivity of biopsy site in evaluating regression of gastric atrophy after Helicobacter pylori eradication treatment. Aliment Pharmacol Ther. 2002;16(Suppl 2):187–90. doi: 10.1046/j.1365-2036.16.s2.17.x. [DOI] [PubMed] [Google Scholar]
- 16.Singh M, Prasad KN, Yachha SK, Krishnani N. Genotypes of Helicobacter pylori in children with upper abdominal pain. J Gastroenterol Hepatol. 2003;18(9):1018–23. doi: 10.1046/j.1440-1746.2003.03119.x. [DOI] [PubMed] [Google Scholar]
- 17.Lu JJ, Perng CL, Shyu RY, Chen CH, Lou Q, Chong SK, et al. Comparison of five PCR methods for detection of Helicobacter pylori DNA in gastric tissues. J Clin Microbiol. 1999;37(3):772–4. doi: 10.1128/jcm.37.3.772-774.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Molaei M, Foroughi F, Mashayekhi R, Haghazali M, Zojaji H, Jafari F, et al. CagA status and VacA subtypes of Helicobacter pylori in relation to histopathologic findings in Iranian population. Indian J Pathol Microbiol. 2010;53(1):24–7. doi: 10.4103/0377-4929.59178. [DOI] [PubMed] [Google Scholar]
- 19.Krashias G, Bashiardes S, Potamitou A, Potamitis GS, Christodoulou C. Prevalence of Helicobacter pylori cagA and vacA genes in Cypriot patients. J Infect Dev Ctries. 2013;7(9):642–50. doi: 10.3855/jidc.2923. [DOI] [PubMed] [Google Scholar]
- 20.Lopes AI, Palha A, Monteiro L, Olcastro M, Pelerito A, Fernandes A. Helicobacter pylori genotypes in children from a population at high gastric cancer risk: no association with gastroduodenal histopathology. Am J Gastroenterol. 2006;101(9):2113–22. doi: 10.1111/j.1572-0241.2006.00732.x. [DOI] [PubMed] [Google Scholar]
- 21.Martin AC, Penn CWH. Molecular and medical microbiology. San Diego: Academic Press; 2002. [Google Scholar]
- 22.Siavoshi F, Malekzadeh R, Daneshmand M, Ashktorab H. Helicobacter pylori endemic and gastric disease. Dig Dis Sci. 2005;50(11):2075–80. doi: 10.1007/s10620-005-3010-1. [DOI] [PubMed] [Google Scholar]
- 23.Chen XJ, Yan J, Shen YF. Dominant cagA/vacA genotypes and coinfection frequency of H. pylori in peptic ulcer or chronic gastritis patients in Zhejiang Province and correlations among different genotypes, coinfection and severity of the diseases. Chin Med J (Engl). 2005;118(6):460–7. [PubMed] [Google Scholar]
- 24.Erzin Y, Koksal V, Altun S, Dobrucali A, Aslan M, Erdamar S, et al. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA, babA2 genotypes and correlation with clinical outcome in Turkish patients with dyspepsia. Helicobacter. 2006;11(6):574–80. doi: 10.1111/j.1523-5378.2006.00461.x. [DOI] [PubMed] [Google Scholar]
- 25.Martins LC, Corvelo TC, Demachki S, Araujo MT, Assumpcao MB, Vilar SC, et al. Clinical and pathological importance of vacA allele heterogeneity and cagA status in peptic ulcer disease in patients from North Brazil. Mem Inst Oswaldo Cruz. 2005;100(8):875–81. doi: 10.1590/s0074-02762005000800009. [DOI] [PubMed] [Google Scholar]
- 26.Aydin F, Kaklikkaya N, Ozgur O, Cubukcu K, Kilic AO, Tosun I, et al. Distribution of vacA alleles and cagA status of Helicobacter pylori in peptic ulcer disease and non-ulcer dyspepsia. Clin Microbiol Infect. 2004;10(12):1102–4. doi: 10.1111/j.1469-0691.2004.00989.x. [DOI] [PubMed] [Google Scholar]
- 27.Nogueira C, Figueiredo C, Carneiro F, Gomes AT, Barreira R, Figueira P, et al. Helicobacter pylori genotypes may determine gastric histopathology. Am J Pathol. 2001;158(2):647–54. doi: 10.1016/s0002-9440(10)64006-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Sicinschi LA, Correa P, Bravo LE, Peek RM, Jr., Wilson KT, Loh JT, et al. Non-invasive genotyping of Helicobacter pylori cagA, vacA, and hopQ from asymptomatic children. Helicobacter. 2012;17(2):96–106. doi: 10.1111/j.1523-5378.2011.00919.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Bravo LE, van Doom LJ, Realpe JL, Correa P. Virulence-associated genotypes of Helicobacter pylori: do they explain the African enigma? Am J Gastroenterol. 2002;97(11):2839–42. doi: 10.1111/j.1572-0241.2002.07031.x. [DOI] [PubMed] [Google Scholar]
- 30.Gonzalez-Valencia G, Atherton JC, Munoz O, Dehesa M, la Garza AM, Torres J. Helicobacter pylori vacA and cagA genotypes in Mexican adults and children. J Infect Dis. 2000;182(5):1450–4. doi: 10.1086/315864. [DOI] [PubMed] [Google Scholar]
- 31.Ghotaslou R, Milani M, Akhi MT, Nahaei MR, Hasani A, Hejazi MS, et al. Diversity of Helicobacter Pylori cagA and vacA Genes and Its Relationship with Clinical Outcomes in Azerbaijan, Iran. Adv Pharm Bull. 2013;3(1):57–62. doi: 10.5681/apb.2013.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Jafarzadeh A, Rezayati MT, Nemati M. Specific serum immunoglobulin G to H pylori and CagA in healthy children and adults (south-east of Iran). World J Gastroenterol. 2007;13(22):3117–21. doi: 10.3748/wjg.v13.i22.3117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Bindayna KM, Al Baker WA, Botta GA. Detection of Helicobacter pylori cagA gene in gastric biopsies, clinical isolates and faeces. Indian J Med Microbiol. 2006;24(3):195–200. [PubMed] [Google Scholar]
- 34.Tanuma M, Rimbara E, Noguchi N, Boonyaritichaikij S, Kuwabara K, Fukunaga Y, et al. Analysis of clarithromycin resistance and CagA status in Helicobacter pylori by use of feces from children in Thailand. J Clin Microbiol. 2009;47(12):4144–5. doi: 10.1128/JCM.00786-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
