Abstract
The aim of the study was to investigate whether Kv7 channels and their ancillary β-subunits, KCNE, are functionally expressed in the human urinary bladder. Kv7 channels were examined at the molecular level and by functional studies using RT-qPCR and myography, respectively. We found mRNA expression of KCNQ1, KCNQ3-KCNQ5 and KCNE1-5 in the human urinary bladder from patients with normal bladder function (n = 7) and in patients with bladder outflow obstruction (n = 3). Interestingly, a 3.4-fold up-regulation of KCNQ1 was observed in the latter. The Kv7 channel subtype selective modulators, ML277 (activator of Kv7.1 channels, 10 μM) and ML213 (activator of Kv7.2, Kv7.4, Kv7.4/7.5 and Kv7.5 channels, 10 μM), reduced the tone of 1 μM carbachol pre-constricted bladder strips. XE991 (blocker of Kv7.1–7.5 channels, 10 μM) had opposing effects as it increased contractions achieved with 20 mM KPSS. Furthermore, we investigated if there is interplay between Kv7 channels and β-adrenoceptors. Using cumulative additions of isoprenaline (β-adrenoceptor agonist) and forskolin (adenylyl cyclase activator) in combination with the Kv7 channel activator and blocker, retigabine and XE991, we did not find interplay between Kv7 channels and β-adrenoceptors in the human urinary bladder. The performed gene expression analysis combined with the organ bath studies imply that compounds that activate Kv7 channels could be useful for treatment of overactive bladder syndrome.
Introduction
The physiological roles of the urinary bladder are storage of urine and micturition. These processes are controlled both locally, by receptors in smooth muscle cells, urothelium and nerves, and centrally by higher brain levels [1]. Due to the complexity of the regulation of the detrusor, a number of diseases are linked to the lower urinary tract system. One of these diseases is overactive bladder (OAB) syndrome. It is a symptom complex that is defined by urgency, with or without urinary incontinence, nocturia and daytime urinary frequency, all symptoms that are related to the storage of urine [2]. Not only does OAB have a huge impact on the life-quality of the patients, but it also has a high prevalence, as many as 11.8% of the adult population suffers from OAB [3]. There are several causes of OAB, but in men, OAB is often associated with bladder outflow obstruction (BOO) due to benign prostatic hyperplasia [4]. For many years the first-in-line treatment for OAB has been muscarinic receptor antagonists. However, side effects, mainly dry mouth, leads to poor compliance and therefore there has been a search for novel targets. A recent approval of the β3-adrenoceptor agonist mirabegron by the FDA has improved the prospects for OAB patients [5].
During recent years, evidence have arisen, from studies on rat [6], guinea pig [7], pig [8] and from clinical trials with retigabine [9], that Kv7 channels are key regulators of urinary bladder contractility. More specifically, it has been shown that retigabine increases micturition volume in rats [6], reduces tone and contractility of rat and pig detrusor strips [10], and enhances Kv7 potassium currents in isolated detrusor smooth muscle cells [11] and interstitial cells [7]. There are five different subtypes of the Kv7 channels, Kv7.1–7.5 [12] and the protein is encoded by the KCNQ gene. The potassium channels are formed as either homo- or hetero-tetrameric combinations of Kv7.2/7.3, Kv7.3/Kv7.5 or Kv7.4/Kv7.5 alpha subunits. Kv7 channels are voltage-gated potassium channels, but they can be positively modulated by pharmacological compounds. The channels can associate with ancillary β subunits, encoded by KCNE1–5 genes. KCNE proteins are accessory subunits to multimeric ion channels and thus important regulators of both the resting membrane potential and cellular excitability [13].
According to numerous studies, Kv7 channels are distributed throughout the body, both in the cardiovascular system and in non-vascular smooth muscle cells [14]. Though the transcription of Kv7.2 and Kv7.3 channel has been described in both sympathetic [15,16], sensory [17–19] and hippocampal neurons [20], and Kv7.4 and Kv7.5 in the vasculature [21,22]; only a few studies have confirmed these findings in human tissues. More specifically, Kv7 channels have only been studied in detail in human myometrium [23], mesenteric arteries and arteries from visceral adipose tissue [24] and airway smooth muscle [25]. For this reason, to increase the knowledge of Kv7 channel modulation for the treatment of human diseases, there is a need for studies on human tissue. More specifically, there is a need to know which subtypes of Kv7 channels that are expressed and functional in the human urinary bladder. This information, along with our knowledge from other organs, will assist us to predict side effects of Kv7 channel modulators.
In the present study, we focused on Kv7 channels in human bladder biopsies as these, to our knowledge, has not been studied elsewhere. We analysed the molecular expression of KCNQ and KCNE in the urinary bladder and compared these to the corresponding levels in BOO patients as patients with BOO are more prone to develop OAB compared to patients without BOO. The molecular studies were accompanied by pharmacological studies using the activators retigabine (Kv7.2–7.5, D23129, N-(2-amino-4–(4-flurobenzylamino)-phenyl) carbamic acid ethyl ester), ML213 (Kv7.2, Kv7.4, Kv7.4/7.5 and Kv7.5, N-Mesitylbicyclo[2.2.1]heptane-2-carboxamide) [26,27], and the more recently developed compound ML277 (Kv7.1, (R)-N-(4-(4-methoxyphenyl)thiazol-2-yl)-1-tosylpiperidine-2-carboxamide) [28]. To inhibit Kv7 channels, we have used the pan-selective compound XE991 (Kv7.1–7.5, 10,10-bis(4-pyridinyl-methyl)-9(10H)-anthracenone). The functional studies were performed on bladder strips either pre-constricted with muscarinic receptor agonist carbachol or depolarised with the buffer solution containing 20 mM or 40 mM K+ to elucidate the efficacy of Kv7 channel modulation of isolated detrusor smooth muscle strips was affected by varying the extracellular K+ concentration thus confirming K+-channel selectivity. The β3-adrenoceptors have been shown to couple to different potassium channels in various tissues [29], and it has been published, that reduced Kv7.4 channel function leads to impairment of β-adrenoceptor mediated relaxation in α1-adrenoceptor pre-constricted renal arteries in rats [22]. Kv7.1 channels have been shown to have an A-kinase anchoring protein (AKAP) binding site to which protein kinase A can be recruited and mediate phosphorylation of the channel [30,31]. Furthermore, phosphorylation of Kv7.1, Kv7.2/Kv7.3 and Kv7.4 channels by protein kinase A has been shown to significantly alter the currents of the channels [32–34]. Therefore, to fully understand the β-adrenoceptor mediated relaxations in different tissues, more studies on the mechanism of action are needed [35]. To further increase our understanding of the mechanism of β-adrenoceptor mediated relaxation, we tested if β-receptor and Kv7 channel mediated relaxation were two independent mechanisms or if they were interrelated [22].
Materials and Methods
Ethics
Patients were recruited from the department of Urology at Herlev, Naestved and Skejby Hospitals and the experiments were performed at the Smooth Muscle Research Center, Copenhagen University Hospital at Koege. The study has been approved by the Copenhagen County Ethics Committee (SJ-219).
Detrusor tissue was obtained, with informed written consent, from patients with normal bladder function undergoing cystoscopy (7 patients; mean age 63; range 45–73 years, International Prostate Symptom Scores (I-PSS): 2.3 ± 0.7, for RT-qPCR analysis) or cystectomy (15 patients; mean age 68; range 56–76 years, I-PSS data for 6 out of 15 patients: 8.8 ± 1.9, no preoperative symptoms of overactive bladder, for myography). Detrusor specimens were obtained during surgery with special care taken to remove the samples from a non-tumour infiltrating area. Detrusor specimens from BOO patients were obtained from those undergoing transurethral resection of the prostate due to benign prostatic hyperplasia (3 patients, mean age of 66 years, range 62–75 years, I-PSS 22.3 ± 4.1, for RT-qPCR analysis). All BOO patients were urodynamically characterised.
Detrusor specimens to be used for organ bath studies were kept in 4°C Tyrode’s salt solution (Sigma-Aldrich Denmark A/S, Broendby, Denmark) with 20 mM HEPES (Life Technologies Europe B.V., Naerum, Denmark), (pH at 7.4) and transported immediately to the Smooth Muscle Research Center at Koege Hospital. Biopsies for RT-qPCR analysis were kept in RNAlater (Qiagen Denmark, Copenhagen, Denmark), stored at 4°C overnight, and then frozen at -20°C until further processing.
RNA extraction, cDNA synthesis and RT-qPCR analysis
The methods have formerly been described by Rosenbaum et al. [36] with modifications. Tissue biopsies were homogenised in liquid nitrogen, and in 1 ml TriZol (Life Technologies Europe B.V., Naerum, Denmark), using a rotor-stator homogeniser. Total RNA was extracted from (50–150 mg) homogenised tissue using the Trizol method (manufacturer’s instruction), including bromochloropropane (VWR, Herlev, Denmark) for phase-separation. The quantity and quality of extracted RNA was checked by gel electrophoresis with a Bioanalyzer 2100 (Agilent Technologies, Hoersholm, Denmark). Samples had a RIN value of 5.6–8.9 which ensured a high RNA integrity. RNA (2.5–10 μg) samples were purified by DNase treatment in order to remove contaminating genomic DNA. This was done using an RNase-free DNase kit according to the manufacturer’s instructions for DNA removal (50 μl reaction) (Ambion, Life Technologies Europe B.V., Naerum, Denmark). The quantity and quality of DNase treated RNA was checked by gel electrophoresis using a Bioanalyzer 2100.
RNA was reversely transcribed into complementary DNA, (cDNA) with 7.5 μl oligo(dT) primers (100 ng/μl), and reverse transcriptase (2.5 μl), in a 50 μl reaction volume from 1700 or 2000 ng DNase treated RNA. This was done using the Affinity Script qPCR cDNA synthesis kit (Stratagene, AH Diagnostics, Aarhus, Denmark) as per the manufacturer’s instructions. Cycling parameters were 5 minutes at 25°C; 15 minutes at 42°C; 5 minutes at 95°C; and 30 minutes at 25°C using a Mx3000P QPCR system (Stratagene, AH Diagnostics, Aarhus, Denmark). cDNA was stored at -20°C until further processing.
Primers for the genes of interest, KCNQ1-5 and KCNE1-5, and for the reference genes, GAPDH and ACTB, were designed using Primer3 (ncbi). Primer properties were determined by Oligo Analyzer (IDT) software (Table 1). The primers were synthesised and purified by MALDI-TOF from TAG-Copenhagen (Denmark). The primers were designed to match all known splice variants of the given gene. To ensure primer specificity a BLAST search against the NCBI database was performed, and a melting curve analysis ensured that only one product was amplified. Primers for the additional reference genes B2M, YWHAZ, SF3A1 and 18S were included in a geNorm REF gene kit (PrimerDesign Ltd, Southampton, UK), which included the qbasePLUS software license.
Table 1. RT-qPCR primer pair sequences, amplicon and standard curve data.
| Gene | Primer sequence (+) Sense, (-) antisense | Genebank Accession number | Region spanned | Amplicon bp | Efficiency (%) | R2 |
|---|---|---|---|---|---|---|
| β-actin | (+) TCCCCCAAAGTTCACAATGTGG | NM_0001101 | 1399–1496 | 98 | 92.7 | 0.996 |
| (-) GGGACTTCCTGTAACAACGCAT | ||||||
| GAPDH | (+) CAGTCAGCCGCATCTTCTTTTG | NM_002046 | 49–148 | 100 | 94.4 | 0.996 |
| (-) GCCCAATACGACCAAATCCGTT | ||||||
| KCNQ1 | (+) AGAACCAACAGCTTCGCCGAGG | NM_000218 | 1549–1684 | 136 | 81.7 | 0.986 |
| (-) TGGCCACAAAGTACTGCATGCG | ||||||
| KCNQ2 | (+) CACAGGCAGAAGCACTTTGAGA | NM_172107 | 1147–1280 | 134 | 79.3 | 0.995 |
| (-) GTGACCGTTCGCTCGTAGTAC | ||||||
| KCNQ3 | (+) TGCCGCCACCTTTTCCTTAATT | NM_004519 | 1221–1333 | 113 | 79.8 | 0.995 |
| (-) TCTCAAAGTGCTTCTGACGGTG | ||||||
| KCNQ4 | (+) ATCTCTGAGACTCAAACCCCGC | NM_004700 | 1561–1676 | 116 | 103.2 | 0.991 |
| (-) TCTTCACAGCAGGCATGATGTC | ||||||
| KCNQ5 | (+) CTTGGCTGGGAAGATTGCTTTC | NM_019842 | 1309–1440 | 132 | 86.1 | 0.987 |
| (-) TCTCAAAGTGTTTCTGGCGGTG | ||||||
| KCNE1 | (+)-GTGATCTTTGCCCCACCCGA | NM_001127670 | 2768–2870 | 103 | 84.1 | 0.985 |
| (-) TGAGACGTGGCAGGCATAGC | ||||||
| KCNE2 | (+)-GAGAACATTGGTGCGGCTGG | NM_172201 | 474–575 | 102 | 87.7 | 0.958 |
| (-)-TCGTGGCACTGGCATCTCTTC | ||||||
| KCNE3 | (+)-CAAGACACCTGGGGATTGCGT | NM_005472 | 687–841 | 135 | 93.9 | 0.976 |
| (-)-GCACAAGGCTTCGGTCTACCA | ||||||
| KCNE4 | (+)-GCTTCCCCTTTGGCCGGTTA | NM_080671 | 2023–2129 | 107 | 102.6 | 0.995 |
| (-)-TGGGTTGGTAGCTTGCCCTG | ||||||
| KCNE5 | (+)-AGTGCTCAACGGGGAGGGAA | NM_012282 | 1179–1250 | 72 | 78.5 | 0.994 |
| (-)-GGGATGAAAACTGGGGAGGCA |
RT-qPCR was performed using the Brilliant SYBR Green QPCR Master Mix and Mx3000P QPCR system (both from AH Diagnostics, Aarhus, Denmark). Reactions were carried out in 12.5 μl reaction volumes containing 20 ng of cDNA; 6.25 μl brilliant SYBR green mastermix; 0.25μl (10 pmol/μl) of each primer; and 6.25 μl RNase-free H2O. Amplification was detected using SYBR green fluorescent dye with the following amplification conditions: i) one 10 minutes pre-amplification cycle at 95°C; ii) 40 amplification cycles including 30 sec (denaturation) at 95°C; 60 sec (annealing) at 60°C; and 60 sec (extension) at 72°C; iii) 60 sec end-denaturation cycle at 95°C, followed by increasing the temperature from 55°C to 95°C with continuous reading of fluorescence data (dissociation curve).
Standard curves were performed for the stably expressed reference genes, and for the genes of interest (KCNQ1-5 and KCNE1-5), by 2-fold serial dilution of a cDNA pool of the positive controls brain and heart (Clontech, BioNordika, Herlev, Denmark) (0.625–80 ng) (for KCNQ4 and KCNE4 the concentration was 0.59–300 ng).
Controls with no template- and no reverse transcription (RT) were performed for each sample and primer pair when appropriate to control for contamination or primer-dimers. A ΔCq > 10 between sample and the control with no RT ensured that the samples were not contaminated by any form of genomic DNA. All reactions were carried out in triplicate, in regard to both samples and standard curves. Cq values were calculated from the exponential phase of amplification when crossing threshold using MxPRO 4.1 software (AH Diagnostics, Aarhus, Denmark). Cq values were transformed into relative quantities using the gene-specific PCR amplification efficiency calculated by geNormPlus software (qbasePLUS, Biogazelle, PrimerDesign Ltd, Southampton, UK). A geometric mean of the two stable reference genes was employed as the normalisation factor of the reference genes in order to calculate the relative expression level of KCNQ1-5 and KCNE1-5 within the two patient groups. While amplicons were sequenced in order to ensure KCNQ and KCNE primer specificity (Beckman Coulter Genomics, Takeley, UK), a BLAST search against the NCBI database confirmed that only the gene of interest was amplified. All graphical presentations were prepared using GraphPad Prism 5.04 (San Diego, California, USA). Values were presented as mean (95% CI), and group differences were analysed using the Mann-Whitney test.
Organ bath studies
Retigabine and forskolin were purchased from Alamone Labs (Jerusalem, Israel) whereas XE991 was kindly provided by NeuroSearch (Ballerup, Denmark), and ML213 and ML277 were kindly provided by Vanderbilt University (Nashville, TN, USA (MLCPN probes)). Papaverine and isoprenaline were from Sigma-Aldrich (St. Louis, MO, USA) whereas carbachol and tetrodotoxin (TTX) were purchased from Tocris (VWR international, Herlev, Denmark) and Ascent Scientific (Cambridge, UK), respectively. All stock solutions (10–2 M), except for isoprenaline (dissolved in water), were prepared in 100% DMSO (Merck, VWR international, Herlev, Denmark). Further dilutions were prepared in physiological saline solution (PSS) (NaCl 118.99 mM, KCl 4.69 mM, MgSO4•7H2O 2.40 mM, KH2PO4 1.18 mM, glucose 6.06 mM, NaHCO3 25 mM, CaCl2 1.6 mM, EDTA 0.025 mM, pH 7.4) just before experiments.
Upon arrival the tissue was immediately placed in cold oxygenated PSS. The detrusor was separated from the urothelium under a stereomicroscope. The detrusor was then cut into strips, each 3 mm in length and 1 mm in width, weighing 3.16 ± 0.06 mg (n = 226) and kept on ice. The strips were then mounted in the organ bath (1 ml) of a myograph (700MO; Danish Myo Technology (DMT), Denmark), kept at 37°C and bubbled with a gas mixture of 95% oxygen and 5% carbon dioxide to a pH of 7.4 in PSS-buffer. The digital output was transformed using a powerlab (AD instruments, DMT, Aarhus, Denmark).
The strips were stretched by 2.5 mm to a total length of 4.09 ± 0.03 mm (n = 226) during 30 minutes followed by an equilibration period of 60 minutes resulting in a mean baseline tone of 6.88 ± 0.63 mN (n = 226), in this period the bath solution was changed at 15 minutes intervals.
Strips were stimulated with 20 mM KPSS, 40 mM KPSS or 1 μM carbachol producing a mean tone of 11.85 ± 1.37 mN (n = 47), 18.84 ± 1.67 mN (n = 98) and 31.68 ± 2.14 mN (n = 81), respectively. When contractions were stable, concentration-responses of the effect of retigabine (0.01–30 μM) and ML213 (0.01–30 μM) were evaluated on 1 μM carbachol pre-constricted tissue at a 10 minutes dosing-interval. Alternatively, strips pre-constricted by KPSS (20 mM or 40 mM) or carbachol (1μM) were treated with retigabine (10 μM), ML213 (10 μM), ML277 (10 μM), XE991 (10 μM) or vehicle control for 15 minutes. This allowed for the evaluation of Kv7 channel mediated effects. To study the involvement of Kv7 channels in the relaxation produced by stimulation of β-adrenoceptors and activation of adenylyl cyclase activity, the strips pre-treated with retigabine, XE991 or vehicle were treated with cumulative addition of isoprenaline (0.001–3 μM), forskolin (0.01–30 μM), or time-dependent vehicle-control at a 10 minutes dosing-interval. On tissue pre-constricted by 20 mM KPSS only a single addition of isoprenaline (0.1 μM), forskolin (1 μM) or time-dependent vehicle-control was added for 10 minutes. Maximal relaxation was induced by 100 μM papaverine whereas strips viability was assessed by stimulations of the detrusor strip with a buffer containing 125 mM K+ (KPSS). KPSS was similar to PSS except that NaCl was exchanged with KCl on an equimolar basis.
All values were normalised to the constriction achieved after the addition of the constriction agent before addition of compound. The mean tone was calculated, using LabChart Pro 7.3.7 software (AD instruments, DMT, Aarhus, Denmark), from an average of the last 2 minutes trace just before addition of the next concentration of drug. Graphic presentations were prepared using GraphPad Prism 5.04 (GraphPad Software, San Diego California, USA), Emax values were calculated as maximum obtained effects compared to time-dependent vehicle-controls. Cumulative additions of compound were analysed using two-way repeated measures ANOVA followed by Bonferroni post-hoc test. Differences in mean tone between compound and vehicle control was analysed by unpaired t-test. The number of patients is denoted by n and data are presented as mean values ± S.E.M.
Results
Molecular identification of KCNQ and KCNE subtypes
Before running the RT-qPCR analysis of KCNQ1-5 and KCNE1-5 gene transcript levels, a geNorm analysis was performed to determine which genes were most appropriate to use for normalisation. The analysis showed that, when analysing bladder samples, the most stably expressed genes were as follows: GAPDH > ACTB > TOP1 > B2M > SF3A1 > 18S. Furthermore, the analysis depicted that the inclusion of the invariant controls GAPDH and ACTB would be appropriate for normalisation purposes.
An M-value of 0.327 ± 0.11 (n = 10) was found when analysing bladder samples from the two patient groups. An M-value below 0.5 is considered to be a high reference target stability [37].
KCNQ1-5 and KCNE1-5 mRNA transcripts were evaluated in bladder tissue from patients with normal bladder function (n = 7) as well as in patients with bladder outflow obstruction due to prostatic hyperplasia (n = 3). In the present study, all KCNQ and KCNE subtypes were detected in human urinary bladder biopsies, except for KCNQ2 in which only one patient (normal group) had a level of KCNQ2 that was above the detection limit (Cq<35). KCNE4 and KCNQ4 were the most abundantly expressed genes depicted by raw Cq values. The relative quantities of mRNA transcripts of KCNQ2-5 and KCNE1-5 in bladder did not differ between the two patient groups (Figs. 1 and 2). However, the level of KCNQ1 transcript was 3.4-fold higher in patients with BOO compared to patients with normal bladder function (P = 0.017, Fig. 1A).
Fig 1. mRNA transcript levels of KCNQ in human urinary bladder.
KCNQ1-5 mRNA transcript levels were determined in bladder tissue from patients with normal bladder function (normal, n = 7) and in bladder tissue from patients with bladder outflow obstruction (BOO, n = 3). * P<0.05, compared to normal bladder tissue. Normalisations were performed by the inclusion of the invariant controls ACTB and GAPDH.
Fig 2. All known subtypes of the KCNE gene are expressed in human bladder.
KCNE1-5 mRNA transcript levels were determined in bladder tissue from patients with normal bladder function (normal, n = 7), in bladder tissue from patients with bladder outflow obstruction (BOO, n = 3). Normalisations were performed by the inclusion of the invariant controls ACTB and GAPDH.
Functional effect of Kv7 channel modulators on human detrusor strips
To study the importance of Kv7 channels on urinary bladder contractility several Kv7 channel modulators were tested using different pre-constricting agents. The positive modulator retigabine (Kv7.2–7.5) decreased the constriction achieved by 20 mM KPSS (P = 0.030), 40 mM KPSS (P = 0.014) and 1 μM carbachol (P = 0.001), compared to vehicle control (Table 2). The concentration-response of retigabine was analysed at the tone induced with 1 μM carbachol, the effect of retigabine differed significantly (P<0.001) from that of vehicle control above 3 μM, and retigabine reduced mean tone to 50.67 ± 8.27% of the initial tone with carbachol (Fig. 3). The vehicle responses declined gradually over time being significantly reduced at and above a concentration of 0.01% DMSO (P<0.05). To elaborate on the effects of retigabine, the more selective compounds ML277 and ML213 were tested under the same experimental conditions. ML277, which activates Kv7.1 channels, reduced tone induced by the pre-constrictor agents 1 μM carbachol and 40 mM KPSS, whereas ML213, which is known to activate both Kv7.2 and Kv7.4 channels, but also Kv7.4/7.5 and Kv7.5 channels, only affected tone induced by 1 μM carbachol (Table 2). ML213 concentration-dependently reduced the carbachol evoked response to 41.41 ± 5.71% of the initial pre-constriction tone achieved by carbachol, thereby being more efficacious than retigabine (P<0.05) (Fig. 3).
Table 2. Reduction in mean tone by Kv7 channel modulators (10 μM) in human DSM isolated strips.
| Stimuli | Modulator | Target | Mean tone(%) | P |
|---|---|---|---|---|
| 1μM carbachol | Retigabine | Pos. Kv7.2–7.5 | 20.76 ± 4.97 | ** (6) |
| ML213 | Pos. Kv7.2/7.4 | 32.93 ± 6.63 | *** (6) | |
| ML277 | Pos. Kv7.1 | 13.11 ± 3.95 | * (4) | |
| XE991 | Neg. Kv7.1–7.5 | - 4.23 ± 3.46 | (7) | |
| 40mM KPSS | Retigabine | Pos. Kv7.2–7.5 | 8.08 ± 2.90 | * (7) |
| ML213 | Pos. Kv7.2/7.4 | 1.45 ± 7.67 | (7) | |
| ML277 | Pos. Kv7.1 | 19.81 ± 4.13 | ** (4) | |
| XE991 | Neg. Kv7.1–7.5 | 2.18 ± 2.51 | (10) | |
| 20mM KPSS | Retigabine | Pos. Kv7.2–7.5 | 19.34 ± 7.34 | * (4) |
| ML213 | Pos. Kv7.2/7.4 | 13.81 ± 12.64 | (4) | |
| ML277 | Pos. Kv7.1 | 6.34 ± 6.10 | (4) | |
| XE991 | Neg. Kv7.1–7.5 | -43.89 ± 19.01 | * (5) |
Mean tone is reported in comparison to time-matched vehicle control (mean difference ± SEM%). Positive and negative modulators are denoted by Pos. and Neg., respectively. Each data point is n = 4–10 patients which is presented in parenthesis,
*P<0.05,
**P<0.01,
***P<0.001 vs. vehicle control and is tested by t-test.
Fig 3. Retigabine and ML213 decrease the constriction tone of human detrusor strips.
(A) The original DSM tension recordings illustrate the relaxatory effect of retigabine and ML213, which are Kv7.2–7.5 and Kv7.2/7.4/7.5 channel activators, respectively. (B) Cumulative concentration-responses for retigabine, ML213 and time-matched vehicle responses (< 0.1% DMSO). Initial tone was achieved by pre-constriction with 1 μM carbachol. Retigabine decreased mean tone with a lower efficacy compared to ML213. *P<0.05, ***P<0.001, significantly different from vehicle control.
To investigate whether Kv7 channels are important regulators of urinary bladder quiescence, the pan-selective Kv7 channel blocker XE991 was applied to the muscle strips. XE991 increased the pre-constriction tone achieved with 20 mM KPSS by 43.89 ± 19.01% compared to control (P = 0.043) whereas XE991 had no effect on the pre-constriction tone achieved by 40 mM KPSS (P = 0.397) or 1 μM carbachol (P = 0.243) (Table 2).
Effect of isoprenaline and forskolin on detrusor contractility
Pre-constriction of urinary bladder strips with 1 μM carbachol was followed by cumulative additions of isoprenaline (Fig. 4A and Table 3). Forskolin also relaxed carbachol-contracted strips, with maximal efficacy equivalent to isoprenaline (P = 0.25) (Fig. 4B and Table 3). When evaluating the effects of isoprenaline and forskolin on 40 mM KPSS-depolarised strips, both isoprenaline (Fig. 4C) and forskolin (Fig. 4D) concentration-dependently reduced the mean tone of detrusor strips compared to the time-dependent vehicle-control, however; forskolin being the most efficacious compound (P<0.01). The maximum reduction in the mean tone by both isoprenaline and forskolin compared to vehicle effect was at least twice as large in 40 mM KPSS compared to 1 μM carbachol pre-constricted strips, though the difference was not statistically significant (P = 0.46 and P = 0.07, respectively). The time-matched vehicle controls declined gradually over time in 1 μM carbachol pre-constricted tissues, but not when the tissues were pre-constricted with 40 mM KPSS (Fig. 4).
Fig 4. Effect of isoprenaline and forskolin in human DSM at 1 μM carbachol- and 40 mM KPSS-induced contractions.
Cumulative concentration-responses were induced with isoprenaline and forskolin. Initial tone was achieved by pre-constriction with 1 μM carbachol (A and B) and 40 mM KPSS (C and D) bladder strips. *P<0.05, **P<0.01, ***P<0.001, significantly different from vehicle control. The vehicles corresponded to water (< 0.2%)(A and C) and DMSO (< 0.3%)(B and D) diluted in PSS.
Table 3. Reduction in mean tone by isoprenaline and forskolin with or without pre-incubation with Kv7 channel modulators (10μM) in human DSM isolated strips.
| Stimuli | Modulator | Target | Mean tone(%) | P |
|---|---|---|---|---|
| 1μM carbachol | Isoprenaline | Beta-AR agonist | 12.21 ± 8.34 | 0.19 |
| + retigabine | Pos. Kv7.2–7.5 | 17.97 ± 5.79 | 0.47 § | |
| + XE991 | Neg. Kv7.1–7.5 | 6.91 ± 7.32 | 0.74 § | |
| Forskolin | AC activator | 13.97 ± 9.26 | 0.16 | |
| + XE991 | Neg. Kv7.1–7.5 | 8.36 ± 6.00 | 0.67 # | |
| 40mM KPSS | Isoprenaline | Beta-AR agonist | 26.45 ± 10.47 | * |
| + retigabine | Pos. Kv7.2–7.5 | 26.30 ± 4.28 | 0.97 § | |
| + XE991 | Neg. Kv7.1–7.5 | 28.61 ± 7.89 | 0.80 § | |
| Forskolin | AC activator | 38.03 ± 8.10 | *** | |
| + XE991 | Neg. Kv7.1–7.5 | 34.08 ± 11.35 | 0.72 # |
Mean tone is reported as mean difference ± SEM% in comparison to time-matched vehicle-control at 30 μM forskolin or 3 μM isoprenaline. Positive and negative modulators are denoted by Pos. and Neg., respectively, and AC stands for adenylyl cyclase. Each datapoint is n = 4–9 patients. Statistically significant differences were evaluated by t-test,
*P<0.05,
***P<0.001 compared to vehicle control,
§ compared to isoprenaline or
# compared to forskolin.
Mechanism of β-adrenoceptor-mediated relaxation
In order to study whether the Gs pathway was coupled to Kv7 channels, we analysed the effect of activating and blocking the Kv7 channels by retigabine (Fig. 5B) and XE991 (Fig. 5A and C), respectively, before cumulative additions with isoprenaline (Fig. 5A-B) and forskolin (Fig. 5C). This was tested in strips pre-constricted with 1 μM carbachol. The addition of XE991 (10 μM) had no effect on the efficacy of isoprenaline or forskolin (Table 3). At 1 nM of isoprenaline, retigabine (10 μM) reduced tone by 23.69% as compared to the effect of isoprenaline alone (P<0.01). This is equivalent to the effect of retigabine (10 μM) on 1 μM carbachol pre-constricted detrusor strips described in Table 2.
Fig 5. Modulation of Kv7 channels does not affect Gs mediated relaxation at 1 μM carbachol-induced contractility.
Cumulative concentrations-responses for isoprenaline (A and B) and forskolin (C) were produced with pre-incubation of 10 μM XE991 (A and C), 10 μM retigabine (B) or vehicle control (0.1% DMSO). Initial tone was achieved by pre-constriction with 1 μM carbachol. *P<0.05, **P<0.01, significantly different from isoprenaline. When pre-constricting the detrusor strips by 40 mM KPSS neither of the treatments with Kv7 channel modulators (retigabine and XE991) changed the response to isoprenaline or forskolin at any concentration tested (Fig. 6).
Fig 6. Modulation of Kv7 channels does not affect Gs mediated relaxation at 40 mM KPSS-induced contractility.
Cumulative concentrations-responses for isoprenaline (A and B) and forskolin (C) were produced with pre-incubation of 10 μM XE991 (A and C), 10 μM retigabine (B) or vehicle control (0.1% DMSO). Initial tone was achieved by pre-constriction with 40 mM KPSS. Neither of the Kv7 channel modulators affected the response to isoprenaline or forskolin.
To further investigate the role of the beta-adrenergic pathway, we added either retigabine (10 μM) or XE991 (10 μM), on the top of 20 mM KPSS pre-constricted strips before addition of isoprenaline (0.1 μM) (Fig. 7A and B) or forskolin (1 μM) (Fig. 7C). Isoprenaline reduced the mean tone by 20.60 ± 16.01% compared to vehicle control responses though not significantly (P = 0.24) (Fig. 7A). In contrast, forskolin (1 μM) reduced mean tone by 48.62 ± 11.52% compared to vehicle control (P = 0.006) (Fig. 7B). The pre-addition of retigabine did not affect the response to isoprenaline. In contrast, XE991 attenuated the reduction of mean tone induced by isoprenaline and forskolin by 30.17 ± 18.07% (P = 0.13) and 26.24 ± 11.62% (P = 0.06), respectively, though not statistically significantly.
Fig 7. At low depolarisation Kv7 channel inhibition reduces the response to forskolin.
Strips pre-constricted with 20 mM KPSS were treated with either 0.1 μM isoprenaline (A) or 1 μM forskolin (B). Pre-treatment with Kv7 channel modulators revealed a reduction in response to isoprenaline and forskolin when blocking Kv7 channels by XE991 (10 μM) whereas retigabine (10μM) did not affect the response to isoprenaline. Pre-treatment with vehicle control (0.1% DMSO). **P<0.01, significantly different from vehicle control.
Discussion
The present study has provided evidence that Kv7 channels are functionally expressed in the human detrusor. RT-qPCR showed that all five subtypes of the KCNQ and KCNE genes, except for KCNQ2, were expressed in human bladder tissue. Functional studies confirmed the presence of functional Kv7 channels in human detrusor. Furthermore, we observed a 3.4-fold up-regulation of KCNQ1 in patients with bladder outflow obstruction compared to in patients with normal bladder function.
Effect of Kv7 channel modulators
Using the Kv7.2–7.5 channel activator retigabine and the Kv7 channel blocker XE991 we observed a potent effect of modulating Kv7 channels in the human urinary bladder. Not only are Kv7 channels functionally present in the human urinary bladder, they are also active at low level of depolarisation since XE991 augmented the pre-constriction tone achieved with 20 mM KPSS, but had no effect on the pre-constriction tone achieved with 40 mM KPSS- or 1 μM carbachol. This was also observed in pig detrusor [8] and could be due to phosphatidylinositol 4,5-biphosphate depletion as this has been shown to inactivate Kv7 channels [38]. Mani et al. (2013) have shown that retigabine blocks L-type calcium channels and thus this could account for some of the effect mediated by retigabine, namely the fact that only retigabine, and not ML213, could decrease the contractility achieved with 20 mM KPSS [39]. However, in the paper by Rode et al. (2010) we tested the effect of retigabine on 5, 10 and 60 mM KPSS pre-constricted rat bladder tissue [10]. We found that retigabine concentration-dependently decreased the mean tone and twitch amplitude with a decrease in potency at increasing concentrations of K+. The effect was attenuated by the pre-incubation with XE991 (10 μM) and thus supports that the effect of retigabine in the present study is mediated by potassium channels. In guinea pig bladder, the application of meclofenamic acid has confirmed the presence of Kv7.2 and/or Kv7.3 channels [33] however functionality of Kv7.3 channels remains to be studied in human urinary bladder.
In the present study on human urinary bladder, we show that KCNQ1 is expressed and that the Kv7.1 channel activator ML277 reduces tone in detrusor strips, however not at low concentrations of KPSS. In guinea pig bladder, Kv7.1 channels could also be pharmacologically modulated by the blocker chromanol 293B [40] and activator L-364373 [11], though this was tested on spontaneous contracting bladder strips and thus did not completely correlate with our findings at near resting membrane potentials. Furthermore, using single cell electrophysiological recordings on freshly isolated guinea pig detrusor smooth muscle, functional Kv7.1 channels (chromanol 293B) were observed by Anderson et al. in 2013 [40]. In contrast, we have formerly shown that chromanol 293B [8] and ML277 (S1 Fig.) had no effect on pig bladder and thus a complete overlap between human and pig bladder in terms of Kv7 channel functionality is not evident.
Using myography, we showed that ML213 (positive Kv7.2, Kv7.4, Kv7.4/7.5 and Kv7.5 channel modulator) reduced mean tone of human tissue which correlated with our previous findings in pig urinary bladder [8]. We cannot with certainty claim that the effect is mediated via Kv7.4 channels though this would be the most obvious as Kv7.4 channels, at least on mRNA level, are more prevalent than the other Kv7 channel subtypes. However, as protein levels of the channels have not been determined we do not know whether hetero- or homomeric Kv7.4/Kv7.5 channels exist in the urinary bladder. Though the functionality of Kv7.4 or Kv7.5 channels have not been studied in guinea pig bladder, Afeli et al. (2013) and Anderson et al. (2013) have performed immunohistochemical staining of Kv7 channels [11]. Interestingly, while Afeli et al. (2013) claimed that Kv7.4 channel protein could not be detected. Anderson et al. found protein of all Kv7 channel subtypes in guinea pig bladder; which might be explained by different experimental settings.
KCNQ and KCNE subtypes
The Kv7 channels are formed by four α-subunits and modulated by two β-subunits encoded by the KCNE gene [41]. We observed that KCNQ1 was 3.4-fold up-regulated in patients with bladder outflow obstruction compared to the patients with normal bladder function but there was no significant change in the level of either of the KCNE subtypes. However, KCNE3 and KCNE1 were 1.3-fold up-regulated (P = 0.38) and 1.9-fold down-regulated (P = 0.40), respectively. With regards to the other KCNE subtypes a slight change of 5–15% was observed between normal and BOO bladder biopsies. As Kv7 channel activation leads to hyperpolarisation/repolarisation due to an outward current of K+, we expect that a higher level of Kv7 channels will decrease the membrane potential and thus render the tissue with a lower baseline tension. It has been shown in cardiomyocytes that Kv7.1-KCNE1 forms a slowly activating K+ current that is important for depolarisation. In the inner ear Kv7.1-KCNE1 channels do not inactivate and as the channels are open at membrane potentials positive to -40 mV, the channels remain open [41]. Moreover, Kv7.1 can be modulated by the ancillary KCNE3 subunit and KCNE3 has been shown to lock the open-state of the channel and render Kv7.1 channels constitutively active thereby eliminating the channels voltage-dependency [42]. Therefore, we speculate that the up-regulation of the ancillary β subunits are shifting the channel from a voltage-dependent Kv7.1-KCNE1 channel to a constitutively active Kv7.1-KCNE3 channel and that this is a compensatory mechanism to avoid detrusor overactivity due to BOO to maintain normal bladder function. Though the findings in the present study are very interesting and calls for future studies, the number of studied patients with BOO is very low, and care must be taken not to overestimate the significance of the small changes in KCNE expression.
Kv7 channels and the Gs pathway
The β3-adrenoceptor agonist mirabegron has been approved for the treatment of OAB. In the urinary bladder, β3-adrenoceptors are the most functionally important of the three characterised subtypes [43] and the mRNA level of β3-adrenoceptors have been shown to account for 97% of the total transcript level of β-adrenoceptors, both in patients with normal bladder function and in patients with BOO [44]. Studies on rat bladder has led to the hypothesis, that β3-adrenergic stimulation does not necessarily lead to cAMP production subsequent to adenylyl cyclase stimulation as Frazier et al. (2005) and Uchida et al. (2005) have shown that in strips pre-constricted by KCl, β3-adrenoceptor activation led to opening of big-conductance potassium channels (BKCa), whereas relaxation of strips with passive tone was cAMP and thereby protein kinase A-dependent [45,46].
Moreover, it has been shown in rat renal arteries that β-adrenoceptor mediated relaxation relies on Kv7.4 channel activation. Therefore, in addition to study Kv7 channel function and expression, we also aimed to look at the possible interplay between Kv7 channels and β-adrenoceptors in the human urinary bladder. More specifically we wanted to test the hypothesis that Kv7 channels are important for β-adrenoceptor mediated relaxation. Firstly, we found that both isoprenaline and forskolin concentration-dependently decreased mean tone induced by pre-constriction with 1 μM carbachol-, 40 mM and 20 mM KPSS, with a slightly higher efficacy on strips pre-constricted with KPSS. Though we observed a time-dependent decrease in vehicle response at carbachol pre-constriction, these findings support previous studies on normal human urinary bladder strips [47]. We found that forskolin concentration-dependently relaxed human urinary bladder strips independent of the pre-constriction agent used. Forskolin acts by stimulating adenylyl cyclase and thereby increasing cAMP production, and therefore we believe that the cAMP pathway is intact in normal human urinary bladder strips. The cAMP pathway has also been shown to be intact in normal and hyperreflexic human urinary bladders by Igawa et al. (2001) [48]. To elucidate if the effect of isoprenaline was cAMP dependent we employed the protein kinase A inhibitor Rp-cAMPS (cell-permeable inhibitor of cAMP-dependent kinase A) [49], on pig urinary bladder, on both 1 μM carbachol and 40 mM and 20 mM KPSS-induced pre-constriction. The compound did not decrease the relaxation induced by isoprenaline (S2 Fig.). This is equivalent to findings made by Frazier et al. (2005) in rat bladder strips, in which H7 (protein kinase A inhibitor) failed to reduce contractions induced by 50 mM KPSS [45]. Interestingly, Frazier et al. (2005) showed that H7 decreased the potency of isoprenaline at passive tension. Therefore studies on passive tension should be performed on human tissue to determine if the cAMP pathway is active under these circumstances.
To evaluate the impact of Kv7 channels on the Gs pathway, we pre-incubated the strips with retigabine or XE991 to activate and inhibit Kv7 channels, respectively. In contrast to what we expected, Kv7 channels were not affecting the isoprenaline- or forskolin-mediated relaxations at any pre-constriction agent tested. Therefore, it does not seem that β-adrenergic stimulation is via Kv7 channels in the human urinary bladder. This means that the relaxation made by isoprenaline and retigabine is mediated by two separate mechanisms and proposes the use of Kv7 channel activators as add-on therapy to β3-adrenergic agonists such as mirabegron.
Clinical implications
The present study revealed an up-regulation of KCNQ1 mRNA in patients with BOO. Furthermore, we now have pharmacological evidence that Kv7.1 channels are functional in human bladder. Though this seems compelling for the development of positive modulators for Kv7.1 channels for the treatment of urinary incontinence, it must be stated that Kv7.1 channels are important in heart tissue [50,51] and therefore the risk of side effects renders Kv7.1 channels as an improper target in the bladder. However, the urinary bladder biopsies also expressed KCNQ4 and KCNQ5 of which only KCNQ4 has been described in heart tissue [52]. Accordingly, we would expect a lower degree of side effects when modulating these channels. This is in accordance with in vivo studies on rats in which retigabine increased micturition volume and interval at a lower dose, which had no effect on blood pressure [53] and further supported by clinical studies on retigabine in which urinary retention [9] was observed but no effects on the cardiovascular system was observed [54].
Conclusions
Kv7 channels are important regulators of urinary bladder quiescence at near resting membrane potential (-60 mV). We found that Kv7.1 channels could be pharmacologically activated and that KCNQ1 was up-regulated in patients with BOO. The performed gene expression analysis combined with the organ bath studies leads us to believe that compounds that activate Kv7.4 and/or Kv7.5 channels could be useful for treatment of overactive bladder syndrome.
Supporting Information
All results are described in the results section corresponding to S1 and S2 Figs.
(DOCX)
The naming of each sheet corresponds to the relevant figure or table.
(XLSX)
ML277 (10 μM), chromanol (10 μM) or vehicle control (0.1% DMSO) was applied to strips pre-constricted by 1 μM carbachol (A), 40 mM KPSS (B) or 20 mM KPSS (C).
(TIF)
Rp-cAMPS (100 μM) or vehicle control (0.1% DMSO) was applied to strips pre-constricted by 1 μM carbachol (A), 40 mM KPSS (B) or 20 mM KPSS (C). Thereafter strips were treated with isoprenaline (0.1 μM).
(TIF)
Acknowledgments
We would like to thank the Vanderbilt Center for Accelerated Probe Development (MLCPN) for providing the compounds ML213 and ML277 and NeuroSearch for providing XE991. The doctors and nurses at the department of Urology at Herlev, Skejby and Naestved Hospital, especially Jørgen Bjerggård at Skejby Hospital. Furthermore, for the technical support by Majken M. Jansen.
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
This work was supported by Region Zealand Health Foundation, http://www.regionsjaelland.dk/Sundhed/forskning/forskningsfinansiering/Sider/oekonomi.aspx. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Andersson KE, Arner A (2004) Urinary bladder contraction and relaxation: physiology and pathophysiology. Physiol Rev 84: 935–986. [DOI] [PubMed] [Google Scholar]
- 2. Abrams P, Cardozo L, Fall M, Griffiths D, Rosier P, et al. (2003) The standardisation of terminology in lower urinary tract function: report from the standardisation sub-committee of the International Continence Society. Urology 61: 37–49. [DOI] [PubMed] [Google Scholar]
- 3. Irwin DE, Milsom I, Hunskaar S, Reilly K, Kopp Z, et al. (2006) Population-based survey of urinary incontinence, overactive bladder, and other lower urinary tract symptoms in five countries: results of the EPIC study. Eur Urol 50: 1306–1314; discussion 1314–1305. [DOI] [PubMed] [Google Scholar]
- 4. Yamaguchi O, Aikawa K, Shishido K, Nomiya M (2009) Place of overactive bladder in male lower urinary tract symptoms. World J Urol 27: 723–728. 10.1007/s00345-009-0470-5 [DOI] [PubMed] [Google Scholar]
- 5. Sacco E, Bientinesi R (2012) Mirabegron: a review of recent data and its prospects in the management of overactive bladder. Ther Adv Urol 4: 315–324. 10.1177/1756287212457114 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Streng T, Christoph T, Andersson K-E (2004) Urodynamic Effects of the K+ Channel (Kcnq) Opener Retigabine in Freely Moving, Conscious Rats. The Journal of Urology 172: 2054–2058. [DOI] [PubMed] [Google Scholar]
- 7. Anderson UA, Carson C, McCloskey KD (2009) KCNQ currents and their contribution to resting membrane potential and the excitability of interstitial cells of Cajal from the guinea pig bladder. J Urol 182: 330–336. 10.1016/j.juro.2009.02.108 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Svalø J, Bille M, Parameswaran Theepakaran N, Sheykhzade M, Nordling J, et al. (2013) Bladder contractility is modulated by Kv7 channels in pig detrusor. Eur J Pharmacol 715: 312–320. 10.1016/j.ejphar.2013.05.005 [DOI] [PubMed] [Google Scholar]
- 9. Brickel N, Gandhi P, VanLandingham K, Hammond J, DeRossett S (2012) The urinary safety profile and secondary renal effects of retigabine (ezogabine): a first-in-class antiepileptic drug that targets KCNQ (K(v)7) potassium channels. Epilepsia 53: 606–612. 10.1111/j.1528-1167.2012.03441.x [DOI] [PubMed] [Google Scholar]
- 10. Rode F, Svalø J, Sheykhzade M, Ronn LC (2010) Functional effects of the KCNQ modulators retigabine and XE991 in the rat urinary bladder. Eur J Pharmacol 638: 121–127. 10.1016/j.ejphar.2010.03.050 [DOI] [PubMed] [Google Scholar]
- 11. Afeli SA, Malysz J, Petkov GV (2013) Molecular expression and pharmacological evidence for a functional role of kv7 channel subtypes in Guinea pig urinary bladder smooth muscle. PLoS One 8: e75875 10.1371/journal.pone.0075875 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Robbins J (2001) KCNQ potassium channels: physiology, pathophysiology, and pharmacology. Pharmacol Ther 90: 1–19. [DOI] [PubMed] [Google Scholar]
- 13. McCrossan ZA, Abbott GW (2004) The MinK-related peptides. Neuropharmacology 47: 787–821. [DOI] [PubMed] [Google Scholar]
- 14. Stott JB, Jepps TA, Greenwood IA (2014) K7 potassium channels: a new therapeutic target in smooth muscle disorders. Drug Discov Today 19: 413–424. 10.1016/j.drudis.2013.12.003 [DOI] [PubMed] [Google Scholar]
- 15. Zaika O, Lara LS, Gamper N, Hilgemann DW, Jaffe DB, et al. (2006) Angiotensin II regulates neuronal excitability via phosphatidylinositol 4,5-bisphosphate-dependent modulation of Kv7 (M-type) K+ channels. J Physiol 575: 49–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Zaika O, Tolstykh GP, Jaffe DB, Shapiro MS (2007) Inositol triphosphate-mediated Ca2+ signals direct purinergic P2Y receptor regulation of neuronal ion channels. J Neurosci 27: 8914–8926. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Mucha M, Ooi L, Linley JE, Mordaka P, Dalle C, et al. (2010) Transcriptional control of KCNQ channel genes and the regulation of neuronal excitability. J Neurosci 30: 13235–13245. 10.1523/JNEUROSCI.1981-10.2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Rose K, Ooi L, Dalle C, Robertson B, Wood IC, et al. (2011) Transcriptional repression of the M channel subunit Kv7.2 in chronic nerve injury. Pain 152: 742–754. 10.1016/j.pain.2010.12.028 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. King CH, Lancaster E, Salomon D, Peles E, Scherer SS (2014) Kv7.2 regulates the function of peripheral sensory neurons. J Comp Neurol 522: 3262–3280. 10.1002/cne.23595 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Zhang J, Shapiro MS (2012) Activity-dependent transcriptional regulation of M-Type (Kv7) K(+) channels by AKAP79/150-mediated NFAT actions. Neuron 76: 1133–1146. 10.1016/j.neuron.2012.10.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Brueggemann LI, Mackie AR, Cribbs LL, Freda J, Tripathi A, et al. (2014) Differential protein kinase C-dependent modulation of Kv7.4 and Kv7.5 subunits of vascular Kv7 channels. J Biol Chem 289: 2099–2111. 10.1074/jbc.M113.527820 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Chadha PS, Zunke F, Zhu HL, Davis AJ, Jepps TA, et al. (2012) Reduced KCNQ4-encoded voltage-dependent potassium channel activity underlies impaired beta-adrenoceptor-mediated relaxation of renal arteries in hypertension. Hypertension 59: 877–884. 10.1161/HYPERTENSIONAHA.111.187427 [DOI] [PubMed] [Google Scholar]
- 23. McCallum LA, Pierce SL, England SK, Greenwood IA, Tribe RM (2011) The contribution of Kv7 channels to pregnant mouse and human myometrial contractility. J Cell Mol Med 15: 577–586. 10.1111/j.1582-4934.2010.01021.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Ng FL, Davis AJ, Jepps TA, Harhun MI, Yeung SY, et al. (2011) Expression and function of the K+ channel KCNQ genes in human arteries. Br J Pharmacol 162: 42–53. 10.1111/j.1476-5381.2010.01027.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Brueggemann LI, Kakad PP, Love RB, Solway J, Dowell ML, et al. (2012) Kv7 potassium channels in airway smooth muscle cells: signal transduction intermediates and pharmacological targets for bronchodilator therapy. Am J Physiol Lung Cell Mol Physiol 302: L120–132. 10.1152/ajplung.00194.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Yu H, Wu M, Townsend SD, Zou B, Long S, et al. (2011) Discovery, Synthesis, and Structure Activity Relationship of a Series of N-Aryl- bicyclo[2.2.1]heptane-2-carboxamides: Characterization of ML213 as a Novel KCNQ2 and KCNQ4 Potassium Channel Opener. ACS Chem Neurosci 2: 572–577. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Brueggemann LI, Haick JM, Cribbs LL, Byron KL (2014) Differential Activation of Vascular Smooth Muscle Kv7.4, Kv7.5, and Kv7.4/7.5 Channels by ML213 and ICA-069673. Mol Pharmacol. [DOI] [PMC free article] [PubMed]
- 28. Mattmann ME, Yu H, Lin Z, Xu K, Huang X, et al. (2012) Identification of (R)-N-(4-(4-methoxyphenyl)thiazol-2-yl)-1-tosylpiperidine-2-carboxamide, ML277, as a novel, potent and selective K(v)7.1 (KCNQ1) potassium channel activator. Bioorg Med Chem Lett 22: 5936–5941. 10.1016/j.bmcl.2012.07.060 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Ferro A (2006) beta-adrenoceptors and potassium channels. Naunyn Schmiedebergs Arch Pharmacol 373: 183–185. [DOI] [PubMed] [Google Scholar]
- 30. Potet F, Scott JD, Mohammad-Panah R, Escande D, Baro I (2001) AKAP proteins anchor cAMP-dependent protein kinase to KvLQT1/IsK channel complex. Am J Physiol Heart Circ Physiol 280: H2038–2045. [DOI] [PubMed] [Google Scholar]
- 31. Kurokawa J, Motoike HK, Rao J, Kass RS (2004) Regulatory actions of the A-kinase anchoring protein Yotiao on a heart potassium channel downstream of PKA phosphorylation. Proc Natl Acad Sci U S A 101: 16374–16378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Schroeder BC, Kubisch C, Stein V, Jentsch TJ (1998) Moderate loss of function of cyclic-AMP-modulated KCNQ2/KCNQ3 K+ channels causes epilepsy. Nature 396: 687–690. [DOI] [PubMed] [Google Scholar]
- 33. Marx SO, Kurokawa J, Reiken S, Motoike H, D'Armiento J, et al. (2002) Requirement of a macromolecular signaling complex for beta adrenergic receptor modulation of the KCNQ1-KCNE1 potassium channel. Science 295: 496–499. [DOI] [PubMed] [Google Scholar]
- 34. Chambard JM, Ashmore JF (2005) Regulation of the voltage-gated potassium channel KCNQ4 in the auditory pathway. Pflugers Arch 450: 34–44. [DOI] [PubMed] [Google Scholar]
- 35. Andersson KE, Martin N, Nitti V (2013) Selective beta(3)-adrenoceptor agonists for the treatment of overactive bladder. J Urol 190: 1173–1180. 10.1016/j.juro.2013.02.104 [DOI] [PubMed] [Google Scholar]
- 36. Rosenbaum ST, Svalø J, Nielsen K, Larsen T, Jorgensen JC, et al. (2012) Immunolocalization and expression of small-conductance calcium-activated potassium channels in human myometrium. J Cell Mol Med 16: 3001–3008. 10.1111/j.1582-4934.2012.01627.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Hellemans J, Mortier G, De Paepe A, Speleman F, Vandesompele J (2007) qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol 8: R19 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Linley JE, Pettinger L, Huang D, Gamper N (2012) M channel enhancers and physiological M channel block. J Physiol 590: 793–807. 10.1113/jphysiol.2011.223404 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Mani BK, O'Dowd J, Kumar L, Brueggemann LI, Ross M, et al. (2013) Vascular KCNQ (Kv7) potassium channels as common signaling intermediates and therapeutic targets in cerebral vasospasm. J Cardiovasc Pharmacol 61: 51–62. 10.1097/FJC.0b013e3182771708 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Anderson UA, Carson C, Johnston L, Joshi S, Gurney AM, et al. (2013) Functional expression of KCNQ (Kv 7) channels in guinea pig bladder smooth muscle and their contribution to spontaneous activity. Br J Pharmacol 169: 1290–1304. 10.1111/bph.12210 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Abbott GW (2014) Biology of the KCNQ1 Potassium Channel. New Journal of Science 2014: 1–26. [Google Scholar]
- 42. Schroeder BC, Waldegger S, Fehr S, Bleich M, Warth R, et al. (2000) A constitutively open potassium channel formed by KCNQ1 and KCNE3. Nature 403: 196–199. [DOI] [PubMed] [Google Scholar]
- 43. Michel MC, Vrydag W (2006) Alpha1-, alpha2- and beta-adrenoceptors in the urinary bladder, urethra and prostate. Br J Pharmacol 147 Suppl 2: S88–119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Nomiya M, Yamaguchi O (2003) A quantitative analysis of mRNA expression of alpha 1 and beta-adrenoceptor subtypes and their functional roles in human normal and obstructed bladders. J Urol 170: 649–653. [DOI] [PubMed] [Google Scholar]
- 45. Frazier EP, Mathy MJ, Peters SL, Michel MC (2005) Does cyclic AMP mediate rat urinary bladder relaxation by isoproterenol? J Pharmacol Exp Ther 313: 260–267. [DOI] [PubMed] [Google Scholar]
- 46. Uchida H, Shishido K, Nomiya M, Yamaguchi O (2005) Involvement of cyclic AMP-dependent and -independent mechanisms in the relaxation of rat detrusor muscle via beta-adrenoceptors. Eur J Pharmacol 518: 195–202. [DOI] [PubMed] [Google Scholar]
- 47. Biers SM, Reynard JM, Brading AF (2006) The effects of a new selective beta3-adrenoceptor agonist (GW427353) on spontaneous activity and detrusor relaxation in human bladder. BJU Int 98: 1310–1314. [DOI] [PubMed] [Google Scholar]
- 48. Igawa Y, Yamazaki Y, Takeda H, Kaidoh K, Akahane M, et al. (2001) Relaxant effects of isoproterenol and selective beta3-adrenoceptor agonists on normal, low compliant and hyperreflexic human bladders. J Urol 165: 240–244. [DOI] [PubMed] [Google Scholar]
- 49. Schaap P, van Ments-Cohen M, Soede RD, Brandt R, Firtel RA, et al. (1993) Cell-permeable non-hydrolyzable cAMP derivatives as tools for analysis of signaling pathways controlling gene regulation in Dictyostelium. J Biol Chem 268: 6323–6331. [PubMed] [Google Scholar]
- 50. Barhanin J, Lesage F, Guillemare E, Fink M, Lazdunski M, et al. (1996) K(V)LQT1 and lsK (minK) proteins associate to form the I(Ks) cardiac potassium current. Nature 384: 78–80. [DOI] [PubMed] [Google Scholar]
- 51. Sanguinetti MC, Curran ME, Zou A, Shen J, Spector PS, et al. (1996) Coassembly of K(V)LQT1 and minK (IsK) proteins to form cardiac I(Ks) potassium channel. Nature 384: 80–83. [DOI] [PubMed] [Google Scholar]
- 52. Joshi S, Sedivy V, Hodyc D, Herget J, Gurney AM (2009) KCNQ modulators reveal a key role for KCNQ potassium channels in regulating the tone of rat pulmonary artery smooth muscle. J Pharmacol Exp Ther 329: 368–376. 10.1124/jpet.108.147785 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Svalø J, Hansen HH, Rønn LC, Sheykhzade M, Munro G, et al. (2011) K(v) 7 Positive Modulators Reduce Detrusor Overactivity and Increase Bladder Capacity in Rats. Basic Clin Pharmacol Toxicol. [DOI] [PubMed]
- 54. French JA, Abou-Khalil BW, Leroy RF, Yacubian EM, Shin P, et al. (2011) Randomized, double-blind, placebo-controlled trial of ezogabine (retigabine) in partial epilepsy. Neurology 76: 1555–1563. 10.1212/WNL.0b013e3182194bd3 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
All results are described in the results section corresponding to S1 and S2 Figs.
(DOCX)
The naming of each sheet corresponds to the relevant figure or table.
(XLSX)
ML277 (10 μM), chromanol (10 μM) or vehicle control (0.1% DMSO) was applied to strips pre-constricted by 1 μM carbachol (A), 40 mM KPSS (B) or 20 mM KPSS (C).
(TIF)
Rp-cAMPS (100 μM) or vehicle control (0.1% DMSO) was applied to strips pre-constricted by 1 μM carbachol (A), 40 mM KPSS (B) or 20 mM KPSS (C). Thereafter strips were treated with isoprenaline (0.1 μM).
(TIF)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.







