Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2015 Jan 21;197(4):717–726. doi: 10.1128/JB.02365-14

One-Carbon Metabolic Pathway Rewiring in Escherichia coli Reveals an Evolutionary Advantage of 10-Formyltetrahydrofolate Synthetase (Fhs) in Survival under Hypoxia

Shivjee Sah a, Srinivas Aluri a, Kervin Rex a, Umesh Varshney a,b,✉
Editor: P de Boer
PMCID: PMC4334196  PMID: 25448816

Abstract

In cells, N10-formyltetrahydrofolate (N10-fTHF) is required for formylation of eubacterial/organellar initiator tRNA and purine nucleotide biosynthesis. Biosynthesis of N10-fTHF is catalyzed by 5,10-methylene-tetrahydrofolate dehydrogenase/cyclohydrolase (FolD) and/or 10-formyltetrahydrofolate synthetase (Fhs). All eubacteria possess FolD, but some possess both FolD and Fhs. However, the reasons for possessing Fhs in addition to FolD have remained unclear. We used Escherichia coli, which naturally lacks fhs, as our model. We show that in E. coli, the essential function of folD could be replaced by Clostridium perfringens fhs when it was provided on a medium-copy-number plasmid or integrated as a single-copy gene in the chromosome. The fhs-supported folD deletion (ΔfolD) strains grow well in a complex medium. However, these strains require purines and glycine as supplements for growth in M9 minimal medium. The in vivo levels of N10-fTHF in the ΔfolD strain (supported by plasmid-borne fhs) were limiting despite the high capacity of the available Fhs to synthesize N10-fTHF in vitro. Auxotrophy for purines could be alleviated by supplementing formate to the medium, and that for glycine was alleviated by engineering THF import into the cells. The ΔfolD strain (harboring fhs on the chromosome) showed a high NADP+-to-NADPH ratio and hypersensitivity to trimethoprim. The presence of fhs in E. coli was disadvantageous for its aerobic growth. However, under hypoxia, E. coli strains harboring fhs outcompeted those lacking it. The computational analysis revealed a predominant natural occurrence of fhs in anaerobic and facultative anaerobic bacteria.

INTRODUCTION

The pathway of one-carbon metabolism is central to the synthesis of purine nucleotides, thymidylate, glycine, and methionine (Fig. 1). The enzymes that catalyze interconversions of the pathway intermediates are highly conserved across the three domains of life (1–6). Serine hydroxymethyltransferase (GlyA) catalyzes the reversible reaction of conversion of serine and tetrahydrofolate (THF) to glycine and 5,10-methylene-tetrahydrofolate (5,10-CH2-THF) (7). FolD, a bifunctional enzyme, carries out sequential steps of reversible conversions of 5,10-CH2-THF to 5,10-methenyltetrahydrofolate (5,10-CH+-THF), followed by the conversion of the latter to N10-formyltetrahydrofolate (N10-fTHF) by its dehydrogenase and cyclohydrolase activities, respectively (8). Availability of N10-fTHF is crucial for the de novo pathway of purine nucleotide biosynthesis and formylation of the initiator tRNA (tRNAfMet) to initiate protein synthesis in eubacteria and eukaryotic organelles (9).

FIG 1.

FIG 1

Schematic of the one-carbon metabolic pathway. Reaction networks of the standard (A) and rewired (B) one-carbon metabolic pathways are shown. The standard pathway includes dihydrofolate reductase (FolA), serine hydroxymethyltransferase (GlyA), 5,10-methylenetetrahydrofolate dehydrogenase/cyclohydrolasse (FolD), 5,10-methylenetetrahydrofolate reductase (MetF), thymidylate synthase (ThyA), cobalamin-independent homocysteine transmethylase (MetE), cobalamin-dependent methionine synthase (MetH), and the glycine cleavage system (GCS). In the rewired pathway, FolD was replaced with formyl tetrahydrofolate synthetase (Fhs).

N10-fTHF can also be synthesized by formyltetrahydrofolate synthetase, Fhs (also known as formate-tetrahydrofolate ligase), by utilizing THF, formate, and ATP (Fig. 1). The dual scheme of N10-fTHF synthesis is conserved in eukaryotes and some archaea (6). Many eukaryotic organisms possess FolD with trifunctional activities of dehydrogenase-cyclohydrolase-synthetase (10, 11). Among eubacteria, all organisms possess FolD, but some possess both FolD and Fhs (12). The advantages of possessing Fhs in addition to FolD are unclear. However, in the presence of formate (such as under the anaerobic conditions of growth), predominant synthesis of N10-fTHF may occur via Fhs. N10-fTHF may then be converted to the other one-carbon metabolism intermediates (13).

Furthermore, 5,10-CH+-THF is not known to be involved in any other essential processes in the cell. Both of its known functions, i.e., as a cofactor for photolyase (an enzyme responsible for the direct repair of pyrimidine dimers in DNA) (14) and as an intermediate in the synthesis of N5-formyltetrahydrofolate (N5-fTHF), are not essential in E. coli (15, 16). This raises the question of whether Fhs could replace FolD for its essential function of N10-fTHF production in the cell.

Earlier studies have shown that in Leishmania, a protozoan where the de novo pathway of purine biosynthesis is not present (Leishmania organisms obtain purines from the growth medium), FolD could be deleted when Fhs was provided as an additional copy (17). Thus, while the intracellular availability of N10-fTHF is essential in Leishmania, this essentiality appears largely for the formylation of the initiator tRNA (tRNAfMet) for organellar protein synthesis (17). However, at least in the case of Saccharomyces cerevisiae, the requirement of tRNAfMet formylation appears nonessential (18). Thus, a long-standing question that remains unanswered is whether FolD function could be replaced with Fhs even in the organisms where Fhs is not naturally present, which (unlike Leishmania) possess de novo pathways of purine biosynthesis and where formylation of tRNAfMet is known to be essential. In this context, we observed that the majority of eubacteria that possess Fhs are either anaerobes or facultative anaerobes. Escherichia coli, a facultative anaerobe, lacks Fhs. Thus, E. coli presented us with an excellent model to investigate the physiological and functional importance of FolD and Fhs.

MATERIALS AND METHODS

Chemicals, plasmids, DNA oligomers, and E. coli strains and their growth.

(6-R,S)-THF and trimethoprim (TMP) were from Sigma-Aldrich. (6-R,S)-5,10-CH2-THF (calcium salt) and (6-R,S)-5,10-CH+-THF chloride were from Schircks Laboratories (Jona, Switzerland). Stock solutions were prepared in N2-sparged buffer, with minimal light exposure. E. coli strains, plasmids, and DNA oligomers are listed in Tables 1 and 2. Bacteria were grown in Luria-Bertani broth (LB), LB-agar (1.8% agar; Difco), or M9 minimal medium (which includes 0.4% glucose as a carbon source) containing 1 μg ml−1 thiamine (19) at 37°C with shaking at 200 rpm. Ampicillin (Amp; 100 μg ml−1), kanamycin (Kan; 25 μg ml−1), or tetracycline (Tet; 7.5 μg ml−1) was used as needed.

TABLE 1.

Description of E. coli strains and plasmids used in this study

Strain or plasmid Genotype, description, or purpose Reference or source
Strains
    TG1 E. coli K-12 supE thi-1 Δ(lac-proAB) Δ(mcrB-hsdSM)5 (rK− mK−) (traD36 proAB+ lacIqZΔM15) 19
    DY378 E. coli W3110 λcI857 Δ(cro-bioA) 24
    KL16 E. coli K-12 thi1 relA1 spoT1 50
    MG1655 E. coli K-12 F− lambda− rph-1 51
    DY330 E. coli W3110 ΔlacU169 gal490 [λc1857 Δ(cro-bioA)] 24
    DY330/p-fhs DY330 harboring pACDH-fhs (Tetr) This study
    TG1/p-fhs TG1 harboring p-fhs (Tetr) This study
    TG1 ΔfolD/p-fhs TG1 with a deletion of folD harboring p-fhs (Kanr Tetr) This study
    TG1 ΔfolD-fhs TG1 with a deletion of folD harboring a single copy of fhs in the chromosome (Kanr) This study
    TG1 ΔfolD/p-fhs/pQE60 TG1 ΔfolD/p-fhs strain harboring pQE60 (Kanr Tetr Ampr) This study
    TG1 ΔfolD-fhs/pQE60 TG1 ΔfolD-fhs harboring pQE60 (Kanr Ampr) This study
    TG1 ΔfolD-fhs/p-folD TG1 ΔfolD-fhs harboring p-folD (Kanr Ampr) This study
    TG1 ΔfolD/p-fhs/p-folD TG1 ΔfolD/p-fhs harboring p-folD (Kanr Tetr Ampr) This study
    TG1 ΔfolD/p-fhs/p-folA TG1 ΔfolD/p-fhs harboring p-folA (Kanr Tetr Ampr) This study
    TG1 ΔfolD-fhs/p-FBT TG1 ΔfolD-fhs harboring p-FBT (Kanr Tetr) This study
Plasmids
    pNTR-SD Library genes cloned at SfiI sites (Ampr) 20
    pBAD-SfiI pBAD-SfiI is a derivative of pBAD-HisB with two SfiI restriction sites following the His6 tag (Ampr) This study
    p-purN purN cloned at the SfiI site of pBAD-SfiI (Ampr) This study
    p-purD purD cloned at the SfiI site of pBAD-SfiI (Ampr) This study
    p-folA folA cloned at the SfiI site of pBAD-SfiI (Ampr) This study
    pCP20 FLP+ λ cI857+ λPR Repts Apr Cmr 23.
    pACDH Plasmid with ACYC ori of replication, which is compatible with ColE1 ori of replication plasmids (Tetr) 52
    p-fhs Fhs cloned between NcoI and EcoRI sites of pACDH (Tetr) This study
    p-fhs-kan Derivative of p-fhs with both kan and tet markers This study
    pQE60 Expression vector harboring T5 promoter (Ampr) Qiagen
    p-folD folD cloned at NcoI and BglII sites in pQE60 (Ampr) This study
    p-FBT The pLOI707HE vector containing the slr0642 cDNA of folate-biopterin transporter (FBT) family (Tetr) 30
    pTrc99C E. coli expression vector (Ampr) Amersham
    pTrc-NdeI Derivative of pTrc99C 53

TABLE 2.

List of primers

Primer Sequence (5′–3′)
pACDH-KI-Ch-FP GCCATGTTTGTATTAATTAACAACGTTTTTCTAAGCTTTGGGTCTCGGCTGGCACGACAG
pACDH-KI-Ch-RP AATGCTTCGCGGCGATCCAGCGTTTTATAAAGCTTCATCAGACGGTATCGATAAGCTTGA
Ch-KI-C-FP TGGTTTAGGCGTGCTTAAGG
Ch-KI-C-RP AAAGCGTTTAAATCCGGTATGA
folD-KO-FP ACGTGCGGATGTTTACCTAAAGAAAATGTCGCCATGGTGTAGGCTGGAGCTGCTTCG
folD-KO-RP CCTTCGATCTACGTAACAGATGGAATCCTCTCTCTGCATATGAATATCCTCCTT
pBAD-pNTR-FP CATCATCATCATCATGGGGCCATGAGGGCC
pBAD-pNTR-RP CCAGGCAAATTCTGTTTTATGGCCTCATAGGCC
Fhs-pTrc-FP CCATGGGACATATGAAAAATGATA
Cpe-fhs-FP TGCGGACATATGAAAAATG
Cpe-fhs-RP TATCATGAATTCCCTAAAAC
fhs-RP TATCATGAATTCCCTAAAAC
folD-C-FP ACGTAACCCATGGAATCCTCTC
folD-C-RP AGCAAGCTTCACAGCTCAACGTG
FolD-FP GTAACCATGGCAGCAAAGATTATTGACGGT
FolD-RP TCGAAGATCTCTCATCCTGTGGATCATGAT

Cloning of fhs.

Standard recombinant DNA methods were employed. Cpe-fhs-FP and fhs-RP primers were used to amplify fhs from Clostridium perfringens genomic DNA. The amplicon (∼1.9 kb) was cloned into pJET1.2 (ThermoFischer), followed by its subcloning into pTrc-NdeI at NdeI and EcoRI sites to generate pTrc-fhs (Ampr). Subsequently, fhs was amplified from pTrc-fhs using fhs-pTrc-FP and fhs-RP and subcloned in pACDH at NcoI and EcoRI sites to generate p-fhs (Tetr). In p-fhs, transcription of fhs was driven by the lac promoter.

Cloning of folD, folA, purN, and purD and purification of FolD, PurN, and PurD.

Standard genetic engineering techniques were used. Phosphoribosylglycinamide formyltransferase (purN), glycinamide ribonucleotide synthetase (purD), and dihydrofolate reductase (dhfr or folA) were PCR amplified using pBAD-pNTR-FP and pBAD-pNTR-RP primers from pNTR-SD-purN, -purD, and -folA plasmids (20), respectively, digested with SfiI and ligated to pBAD-SfiI (Ampr) at the same sites. E. coli folD was amplified using FolD-FP and FolD-RP, digested with NcoI and BglII, and cloned into the same sites of pQE60 to give rise to p-folD (Ampr). PurN and PurD were expressed in E. coli BL21 (Rosetta) upon induction with arabinose (0.02%). FolD expression in E. coli TG1/p-folD was induced with isopropyl-β-d-thiogalactopyranoside (IPTG; 0.5 mM). PurN, PurD, and FolD were purified using a HisTrap HP column (GE Healthcare).

GlyA, Fhs, and FolD assays.

E. coli TG1 (also referred to as TG1), TG1 ΔfolD::kan/p-fhs (Kanr Tetr; also referred to as the ΔfolD/p-fhs strain), and TG1 ΔfolD-fhs-kan (Kanr; also referred to as the ΔfolD-fhs strain) were grown in LB medium to an optical density at 600 nm (OD600) of ∼0.8 to 1.0. The cells were harvested, and the cell extracts were made in 50 mM Tris-HCl (pH 7.5) and 10 mM β-mercaptoethanol by ultrasonication, followed by centrifugation to remove cellular debris. GlyA, Fhs, and FolD assays were performed as described previously (7, 8, 21). A typical reaction mixture (320 μl) for GlyA assay contained 0.5 mM THF, 20 mM β-mercaptoethanol, 10 mM serine, 1 mM NADP+, 50 mM Tris-HCl (pH 8.2), cell extract (40 μg total protein), and E. coli FolD (2.5 μg). The reaction mixture for Fhs assay contained 50 mM sodium formate, 2.5 mM ATP, 0.5 mM THF, 20 mM β-mercaptoethanol, 50 mM KCl, 40 mM MgCl2, 50 mM Tris-HCl (pH 8.2), and cell extract (10 μg total protein) in 320 μl. FolD was assayed in a 320-μl reaction mixture containing 5,10-CH2-THF (1 mM), 20 mM β-mercaptoethanol, 1 mM NADP+, 50 mM Tris-HCl (pH 8.2), and cell extract (40 μg total protein). Aliquots (64 μl) were withdrawn at different times and added to 400 μl of 0.5% perchloric acid to stop the reaction, destroy NADPH, and convert the N10-fTHF to 5,10-CH+-THF, which was measured using its extinction coefficient (ε350 nm = 24,900 M−1 cm−1).

Generation of ΔfolD strains supported by a medium-copy-number or a single-copy fhs.

The folD gene was deleted using an established method (22). Briefly, a Kanr cassette was amplified from pKD4 by Pfu DNA polymerase using folD-KO-FP and folD-KO-RP primers. The DNA of interest (∼1.4 kb) was electroporated into E. coli DY330 harboring p-fhs (DY330/p-fhs). Colonies that appeared were screened for the folD locus using folD-C-FP and folD-C-RP. Later, the ΔfolD::kan allele was moved into E. coli TG1 harboring p-fhs (TG1/p-fhs) by P1-mediated transduction to generate TG1 ΔfolD::kan/p-fhs (also referred to as the ΔfolD/p-fhs strain). Transformation of TG1 ΔfolD::kan/p-fhs with pCP20 (23) resulted in excision of the Kanr cassette and generation of TG1 ΔfolD/p-fhs (Kans).

To generate a ΔfolD strain supported by a single copy of fhs, the kan marker obtained from pUC4K by EcoRI treatment was ligated to the p-fhs plasmid at the EcoRI site to construct p-fhs-kan. The fhs-kan region from p-fhs-kan was then PCR amplified using primers pACDH-KI-Ch-FP and pACDH-KI-Ch-RP. The amplicon was electroporated into E. coli DY378 (24). The transformants were selected on plates containing Kan. Colonies were screened for integration of fhs at the chb locus (chitobiose operon) by colony PCR using primers Ch-KI-C-FP and Ch-KI-C-RP. P1 phage raised on DY378 Δchb::fhs-kan was used to transduce TG1 ΔfolD/p-fhs (Kans Tetr) to generate TG1 ΔfolD Δchb::fhs-kan/p-fhs (Kanr Tetr), which was then subjected to curing of p-fhs. During curing of p-fhs, the F′ plasmid (traD36 proAB+ lacIqZΔM15) was also lost from this strain. This resulted in an additional requirement of proline in M9 minimal medium for this particular strain (referred to as TG1 ΔfolD-fhs Kanr).

Growth curves.

E. coli (three to four biological replicates) were grown in 2 ml of LB medium at 37°C with or without the desired antibiotic(s) as overnight cultures. The cultures were diluted (10−3) in M9 minimal medium, and 200 μl of these diluted cultures was added to the wells of a honeycomb plate. The plate was placed in automated Bioscreen C growth reader (Oy Growth, Helsinki, Finland). The culture growth was measured at the OD600 at 1-h intervals. Mean values with standard errors of the means (SEM) were plotted against time.

Estimation of N10-fTHF in cell extracts.

E. coli TG1 was grown in M9 minimal medium (300 ml) to an OD600 of 0.5 ± 0.1. The ΔfolD/p-fhs strain was grown in M9 minimal medium supplemented with formate (10 mM)/adenine (0.1 mg ml−1) and glycine (0.3 mg ml−1). The cultures were harvested, and the pellets were resuspended in N2-sparged buffer containing 50 mM Tris-HCl (pH 7.5) and 100 mM β-mercaptoethanol. The cells were lysed by sonication and centrifuged at 13,000 × g at 4°C for 30 min. The amount of N10-fTHF was quantified by an enzymatic method using PurN. In brief, the reaction mixture contained 50 mM Tris-HCl (pH 7.5), 10 mM glycine, 12 mM MgCl2, cell extract (5 mg total protein) or N10-fTHF (100 μM synthesized from 5,10-CH+-THF for the control reaction), 1 mM ATP, PurD (3 μg), and PurN (6 μg) in a volume of 500 μl. The reaction was started using 900 μM phosphoribosylamine (PRA) and monitored for 5 min at room temperature (25°C). PRA was synthesized and quantified as described before (25). The conversion of N10-fTHF to THF was measured at 312 nm using the molar absorption coefficient 12,000 M−1 cm−1 (26).

Estimation of the NADP+-to-NADPH ratio.

E. coli TG1 was grown to exponential phase in M9 minimal medium containing sodium formate (10 mM), whereas TG1 ΔfolD-fhs was grown in M9 minimal medium containing both sodium formate (10 mM) and glycine (0.3 mg ml−1). NADP+/NADPH quantification was done using a BioVision colorimetric kit (catalog number K347-100), according to the manufacturer's protocol. Each experiment was performed with at least two replicates.

Computational analysis of the occurrence of fhs.

Genomes were analyzed using SEED (27) and UniProt databases. The genomes of 104 eubacterial strains positive for the presence of fhs were used for the analysis. The aerobic, anaerobic, and facultative anaerobic nature of the strains was gathered from published reports. Data were represented in a pie diagram.

Growth competition experiments.

Exponential-phase cultures of E. coli TG1 and TG1/p-fhs (Tetr) were grown in M9 minimal medium (2 ml) supplemented with sodium formate (10 mM), whereas cultures of TG1ΔfolD-fhs (Kanr) were obtained in M9 minimal medium (2 ml) supplemented with both sodium formate (10 mM) and glycine (0.3 mg ml−1). Growth competitions between the mixed cells of E. coli TG1 and TG1/p-fhs (Tetr) were done in M9 minimal medium containing sodium formate (10 mM), whereas those between E. coli TG1 and TG1 ΔfolD-fhs (Kanr) were done in M9 minimal medium containing both sodium formate (10 mM) and glycine (0.3 mg ml−1). Vitamin C (10 mM) was added to screw-cap flat-bottom tubes containing medium for creating a hypoxic/microaerophilic environment (28). Hypoxic cultures were grown with slow stirring in a multipoint magnetic board at 37°C, and methylene blue was used as an oxygen indicator. Aliquots were taken at various times and dilution plated on LB plates. The colonies were picked randomly and patched on LB plates lacking any antibiotic or containing Tet or Kan to distinguish between E. coli TG1 (Kans Tets), TG1/p-fhs (Kans Tetr), and TG1 ΔfolD-fhs (Kanr Tets).

RESULTS

Generation of E. coli ΔfolD/p-fhs.

Both Fhs and FolD activities lead to the formation of N10-fTHF (Fig. 1) used in purine biosynthesis as well as in formylation of tRNAfMet. FolD is a highly conserved and an essential enzyme. To understand the physiological importance of FolD, we carried out deletion of the folD gene (by replacing it with a kan marker) from an E. coli strain harboring the Clostridium perfringens fhs gene on a medium-copy-number plasmid (p-fhs). Figure 2A shows organization of the folD locus in the E. coli genome. Both the wild-type and the deletion (ΔfolD::kan/p-fhs, also referred to as the ΔfolD/p-fhs strain) strains showed the expected amplicons of 0.9 kb and 1.4 kb, respectively, using folD-C-FP and folD-C-RP primers (Fig. 2B). As expected for an essential gene, we were unable to obtain folD deletion in the strain harboring an empty vector (lacking fhs). The ΔfolD/p-fhs strain grew well in LB medium (Fig. 2C). To further verify that the deletion strain lacked FolD, biochemical assays using cell extracts were performed. As shown in Fig. 2D, while the wild-type strain showed FolD dehydrogenase activity, the deletion strains supported by p-fhs did not.

FIG 2.

FIG 2

Confirmation of the folD deletion. (A) Organization of folD locus in E. coli. Lines with a single arrowhead indicate the location of the primers used for PCR, and those with double arrowheads represent the expected sizes of amplicons obtained with the primers (folD-C-FP and folD-C-RP) from the wild-type or ΔfolD strain. (B) Agarose gel electrophoresis. Lane M, lambda DNA digested with HindII and HindIII; lane 1, amplicon of folD (∼0.9 kb); and lane 2, amplicon of ΔfolD::kan region (∼1.4 kb). (C) Growth profile of TG1 ΔfolD/p-fhs in Luria-Bertani (LB) medium. (D) FolD activity was measured from aliquots drawn at different time intervals (0 to 20 min) from a reaction setup with cell extracts of TG1 and TG1 ΔfolD/p-fhs. The product N10-fTHF was measured as 5,10-CH+-THF (see Materials and Methods). Error bars represent SEM of at least two replicates. Data shown are representative of three such independent experiments performed at different times.

Deletion of folD in E. coli results in auxotrophy for purines and glycine.

The ΔfolD/p-fhs strain did not grow in M9 minimal medium. However, it showed growth when the medium was supplemented with purines (adenine, guanine, or inosine) and glycine (Table 3). Introduction of p-folD (Ampr) into the ΔfolD/p-fhs strain allowed its growth in M9 minimal medium without any supplementation of purines/glycine (Table 3), suggesting that the observed auxotrophies in the strain were primarily a consequence of folD deletion and not due to any polar effects of folD deletion.

TABLE 3.

Effect of various supplements on growth of E. coli TG1 ΔfolD derivatives in M9 minimal mediuma

Strain and supplement(s) Growth
ΔfolD/p-fhs/pQE60 strain
    None −
    Adenine −
    Guanine −
    Inosine −
    Glycine −
    Adenine + glycine +++
    Guanine + glycine +
    Inosine + glycine ++
ΔfolD/p-fhs/p-folD strain with no supplements ++++
a

E. coli TG1 ΔfolD/p-fhs was transformed with pQE60 (empty vector) or p-folD. Growth of the transformants was monitored in M9 minimal medium supplemented with various metabolites (see Materials and Methods).

Generation of a ΔfolD strain supported by single-copy fhs insertion.

To rule out the possibility that excess expression of Fhs from a medium-copy-number vector was responsible for the phenotypes listed in Table 3, we carried out single-copy integration of fhs (linked to a kan resistance marker) at the chb locus (ΔchbBCARF, chitobiose operon) (see Fig. S1A in the supplemental material). The chb locus was chosen to target fhs because the whole locus, including the promoter and operator, could be deleted without a consequence for our investigation (29). The single-copy integration of fhs (linked to the kan marker) in the genome of E. coli TG1 ΔfolD-fhs-kan (referred to as the ΔfolD-fhs strain) was also confirmed by PCR, resulting in a 3.9-kb amplicon (as opposed to 3.3-kb amplicon for the wild-type locus) using Ch-KI-C-FP and Ch-KI-C-RP primers (see Fig. S1B). Like the ΔfolD/p-fhs strain, this strain (ΔfolD-fhs) also lacked FolD activity (see Fig. S1C) and was auxotrophic for purines and glycine (see Table S1 in the supplemental material). Furthermore, these deficiencies could be rescued by complementation of the stains with p-folD (see Table S1 in the supplemental material). Such a similarity of the phenotypes of the two strains allowed us to use either or both of the strains in the following studies to suit the experimental design.

Supplementation of growth medium with formate alleviates purine auxotrophy.

To understand the mechanism of the purine auxotrophy of the fhs-supported ΔfolD strains, we performed biochemical assays for Fhs in cell extracts to determine their capacities to synthesize N10-fTHF, a metabolite required for purine biosynthesis. As shown in Fig. 3, the levels of Fhs produced in the ΔfolD/p-fhs and the ΔfolD-fhs strains, when supplied with sufficient substrate, were capable of synthesizing of at least four times higher levels of N10-fTHF than the original strain (compare with Fig. 2D). This observation suggests that the activity of Fhs produced in the cell was not limiting. When M9 minimal medium was supplemented with formate and glycine, it alleviated auxotrophy for purines in both the ΔfolD/p-fhs and ΔfolD-fhs strains (Fig. 4A and B). However, as assayed in the extracts of the cells grown in M9 medium containing formate/adenine and glycine, even in the strain harboring fhs on a plasmid (ΔfolD/p-fhs strain), deletion of folD resulted in a significantly lower steady-state accumulation of N10-fTHF (Fig. 5). Since glucose was provided as a carbon source, ATP was not limiting (see Fig. S2 in the supplemental material).

FIG 3.

FIG 3

In vitro Fhs activities of cell extracts to support formation of N10-fTHF. Fhs activity was measured at different time intervals (0 to 20 min) by withdrawing aliquots from the reaction setup with the cell extracts of TG1 and the ΔfolD strain harboring multiple copies of fhs (TG1 ΔfolD/p-fhs) and a single copy of fhs (TG1 ΔfolD-fhs). The product N10-fTHF was measured as 5,10-CH+-THF (Materials and Methods). Error bars represent SEM of at least two replicates. Data shown are representative of three such independent experiments performed at different times.

FIG 4.

FIG 4

Alleviation of purine auxotrophy in ΔfolD strains (supported by Fhs) by formate supplementation. TG1 and ΔfolD strains harboring multiple copies of fhs (ΔfolD/p-fhs) (A) or a single copy of fhs (ΔfolD-fhs) (B) were inoculated in M9 minimal medium supplemented with formate (10 mM) and/or glycine (0.3 mg ml−1) and monitored for their growth. wt, wild type.

FIG 5.

FIG 5

Steady-state levels of N10-fTHF in E. coli TG1 and ΔfolD strains. N10-fTHF was determined in cell extracts by a coupled enzyme assay (see Materials and Methods). E. coli TG1 was grown in M9 minimal medium, and TG1 ΔfolD/p-fhs was grown in M9 minimal medium supplemented with formate (F; 10 mM) plus glycine (G; 0.3 mg ml−1) or with adenine (A; 0.1 mg ml−1) plus glycine. Error bars represent SEM of two independent experiments. Each experiment was performed with three replicates. ***, P < 0.001.

Engineering THF uptake alleviates glycine auxotrophy in a ΔfolD strain.

To understand the mechanism of glycine auxotrophy in the folD deletion strains, we assayed the cell extracts for GlyA activities and observed no significant differences between the fhs-supported ΔfolD and the wild-type strains (Fig. 6A). The ΔfolD/p-fhs strain failed to grow in M9 minimal medium supplemented with serine alone or in combination with either adenine or formate (see Fig. S3 in the supplemental material). Thus, a more likely possibility for glycine auxotrophy of the folD deletion strains might be their deficiency for THF synthesis. To test for this, we decided to make use of a plasmid-borne gene of folate transporter (on p-FBT, Tetr) to enable E. coli to utilize folates from the medium (30). As shown in Fig. 6B, upon introduction of p-FBT into the ΔfolD-fhs strain, glycine auxotrophy of the strain could be alleviated by supplying THF in the growth medium. This observation indicated a THF deficiency in the fhs-supported ΔfolD strains, and it provided the basis for glycine auxotrophy.

FIG 6.

FIG 6

Mechanism of glycine auxotrophy in the ΔfolD strains. (A) Assay of GlyA activity. GlyA activity was measured at different time intervals (0 to 30 min) from aliquots drawn from a reaction setup with the cell extracts of E. coli TG1, TG1 ΔfolD/p-fhs, and TG1 ΔfolD-fhs. The product 5,10-CH2-THF was measured as 5,10-CH+-THF (see Materials and Methods). (B) Effect of engineering THF import on glycine auxotrophy. TG1 ΔfolD-fhs harboring p-FBT (TG1 ΔfolD-fhs/p-FBT) was grown in M9 minimal medium supplemented with formate (10 mM) and glycine (0.3 mg ml−1) or formate (10 mM) and THF (15 μM).

ΔfolD-fhs strain reveals an elevated NADP+-to-NADPH ratio.

A major role of FolD is to synthesize N10-fTHF, needed by PurN and PurH for purine synthesis and by formyl-Met-tRNAfMet transferase (Fmt) to formylate aminoacylated tRNAfMet. However, the FolD-mediated forward reaction also leads to production of NADPH. Other steps, for example, MetF-mediated conversion of 5,10-CH2-THF to 5-methyltetrahydrofolate (5-CH3-THF) and FolA-mediated conversion of dihydrofolate (DHF) to THF, consume NADH and NADPH, respectively. Hence, to understand the basis of THF deficiency, we estimated the NADP+-to-NADPH ratios in cell extracts of the ΔfolD-fhs strain. As shown in Fig. 7, the strains revealed an elevated ratio of NADP+ to NADPH, suggestive of a deficiency of NADH and/or NADPH. Importantly, such a deficiency of NADH and/or NADPH provided a rationale for THF deficiency in the ΔfolD strains (see below).

FIG 7.

FIG 7

Determination of NADP+-to-NADPH ratios. NADP+-to-NADPH ratios in cell extracts of the strains were estimated using a BioVision colorimetric kit. Error bars represent SEM of two independent experiments. Each experiment was performed with at least two replicates (**, P < 0.0001). WT, wild type.

Hypersensitivity of the ΔfolD strains to trimethoprim.

A major source of THF synthesis in cells is via FolA (dihydrofolate reductase [DHFR])-mediated reduction of DHF in the presence of NADPH (Fig. 1). Decrease in cellular levels of NADPH upon deletion of folD (Fig. 7) provided a mechanism of THF deficiency. To further test the impact of THF deficiency on the ΔfolD/p-fhs strain, we made use of trimethoprim. Trimethoprim (TMP) is a well-known inhibitor of FolA, which leads to inhibition of THF synthesis. Thus, a cell already deficient in THF would be expected to show hypersensitivity to TMP. As shown in Fig. 8A and B, the ΔfolD/p-fhs strain was found to be hypersensitive to TMP. Consistent with this observation, overexpression of FolA from a plasmid-borne copy of folA resulted in a better growth yield of the ΔfolD/p-fhs strain (Fig. 8C).

FIG 8.

FIG 8

Hypersensitivity of the ΔfolD/p-fhs strain to trimethoprim (TMP). TG1/p-fhs and TG1 ΔfolD/p-fhs strains were inoculated in LB medium (A) and in LB medium containing 1.8 μg ml−1 TMP (B) and monitored for their growth. (C) Impact of p-folA on the growth of TG1 ΔfolD/p-fhs in M9 minimal medium containing adenine (0.1 mg ml−1) and glycine (0.3 mg ml−1).

Fhs provides a fitness advantage to E. coli under hypoxic conditions.

While the presence of folD is absolutely conserved in all organisms, fhs is not. It is intriguing, therefore, why some organisms continue to retain fhs. To understand this phenomenon better, we carried out bioinformatics analysis for the presence of fhs in aerobic, anaerobic, and facultative anaerobic organisms (see Table S2 in the supplemental material). Our analysis indicates that fhs is more predominantly present in the strict and facultative anaerobes, accounting for about 76% of the organisms analyzed (Fig. 9A). To analyze if the organisms gain any fitness advantage by the presence of fhs during hypoxia, we carried out growth competition experiments between the strains expressing fhs and those not expressing fhs under hypoxic and aerobic conditions. As shown in Fig. 9B (panel i), while under aerobic conditions, E. coli TG1 harboring p-fhs was outcompeted by the strain not expressing fhs, under hypoxia (Fig. 9B, panel ii) the strain harboring p-fhs gained the upper hand. The advantage of p-fhs harboring E. coli TG1 was retained even when the starting inoculum was biased in favor of the wild-type strain (Fig. 9B, panel iii). A similar observation was made when fhs was present within the ΔfolD background in single copy (Fig. 9C, panels i and ii). The advantage of fhs under hypoxia, particularly in the presence of formate in the medium, was also observed in E. coli KL16 (see Fig. S4A in the supplemental material). However, in the case of E. coli MG1655, the hypoxia growth advantage (in the presence of fhs) was observed only when formate was also present in the medium (see Fig. S4B).

FIG 9.

FIG 9

Growth advantage by Fhs under hypoxia. (A) Distribution of fhs in different bacteria. Genomes were analyzed using SEED and UniProt databases. Genomes positive for the presence of fhs were used to prepare the pie diagram. (B) Growth competition between E. coli TG1 and TG1/p-fhs. (C) Growth competition between E. coli TG1 and TG1 ΔfolD-fhs. Cultures were mixed in different proportions as shown and grown under aerobic or hypoxic conditions. Total viable counts were determined at the different time points, and the percent abundance of each strain was plotted.

DISCUSSION

The one-carbon metabolic pathway has been extensively explored in both the prokaryotes and eukaryotes (31) and is a well-known target for both antimicrobial and anticancer drugs (32–36). In this study, we have shown that in E. coli, which naturally lacks fhs and possesses a de novo pathway of purine biosynthesis, the essential function of FolD could be compensated for by expression of a heterologous Fhs. While the strain with such a rewiring of one-carbon metabolism grows well in complex medium (Fig. 2C and 8A), in the minimal medium, it triggered requirements of formate (or purines) and glycine. Both of these auxotrophies allowed us to investigate the physiological importance of Fhs and FolD. Of the intracellular formate-generating reactions in E. coli, hydrolysis of N10-fTHF by PurU offers an unlikely means for any net generation of formate in the ΔfolD strain as the production of N10-fTHF by Fhs itself requires formate (37). Another pathway for generation of formate from pyruvate (catalyzed by pyruvate formate lyase [Pfl]) operates primarily under anaerobic conditions (38). Nonetheless, the observation that the ΔfolD/p-fhs strain sustains itself in minimal medium supplemented with glycine and purines suggests that, even under aerobic conditions, this pathway might be able to provide sufficient formate to support N10-fTHF synthesis (via Fhs) to at least meet the requirement of the formylation of tRNAfMet for initiation of protein synthesis. However, it may also be that low levels of formate arise from guanine nucleotides (39).

Glycine auxotrophy of the fhs-supported ΔfolD strains was primarily a consequence of THF deficiency, which most likely results from deficient production of NADPH in the absence of FolD (Fig. 7). However, it may be argued that the glycine cleavage system (GCS) (Fig. 1) also contributes to THF and glycine deficiencies to meet the cellular requirement of 5,10-CH2-THF. While it may seem surprising that FolD served as a major source of NADPH under the conditions used here, a more recent study using a human cell line has also shown that oxidation of 5,10-CH2-THF to N10-fTHF makes a major contribution to NADPH production (40). A consequence of the THF deficiency of the ΔfolD strain was its hypersensitivity to trimethoprim (TMP), a known inhibitor of dihydrofolate reductase (41). TMP binds with high affinity to bacterial DHFRs compared to vertebrate DHFRs (41). Importantly, the hypersensitivity of the ΔfolD strain suggests that the absence of FolD potentiates the role of TMP and may even overcome the resistance to TMP that results from dhfr gene amplification (e.g., in the experiment shown in Fig. 8C, overexpression of FolA from a multicopy-number plasmid led to only partial growth rescue). Therefore, we propose that inclusion of inhibitors that target FolD (42, 43) along with TMP treatment could make for effective antibacterials.

Bacteria living in anaerobic environments produce mixed acids through fermentation, and one-third of sugar carbon is converted to formate (44). Also, production of formate is pronounced during the shift from aerobic to anaerobic/microaerophilic growth conditions. Pyruvate formate lyase (Pfl) is activated under the latter growth conditions and converts pyruvate to acetyl coenzyme A (acetyl-CoA) and formate (45). These observations raise the question of whether Fhs could be offering a fitness advantage under anaerobic/microaerophilic growth conditions. As shown in Fig. 9, Fhs indeed provides a fitness advantage to E. coli TG1 under anaerobic conditions. The growth advantage is so striking that the Fhs-containing strain outcompetes the wild-type strain even when the strain is in the minority (Fig. 9B). Such a growth advantage of fhs under hypoxia, particularly in the presence of formate in the medium, was also observed in E. coli KL16. However, in the case of E. coli MG1655, the hypoxia growth advantage due to the presence of fhs was observed only when formate was also present in the medium (see Fig. S4 in the supplemental material). While the mechanism of the strain-dependent variations in the phenotypes is unclear, the two strains (TG1 and KL16) showing stronger phenotypes of growth advantages are relA mutants. Nevertheless, the experiments reveal that under hypoxic conditions, the presence of Fhs function offers a growth advantage. Fhs is known to be upregulated under anaerobic conditions in Staphylococcus aureus (46). Thus, the role of Fhs extends beyond providing N10-fTHF. It appears important to also avoid cellular toxicity caused by excess formate (47). However, in E. coli, formate could also be utilized by PurT as a substrate for purine biosynthesis (48). Other enzymes such as formate dehydrogenases (e.g., FDH-O and FDH-N) also metabolize formate to CO2. FDH-O and FDH-N have their catalytic domains pointed toward periplasmic space and thus require a formate transporter to oxidize formate. FocA in E. coli transports formate in and out of the cell to facilitate formate oxidation by FDH-O and FDH-N. Interestingly, focA and pflB are cotranscribed, thus facilitating delivery of formate to FDH-O and FDH-N (49). Under anaerobic conditions, FocA is constitutively active to export formate out of the cell. Notwithstanding these mechanisms of formate detoxification, formate utilization by Fhs might also contribute to the removal/detoxification of excess formate. Interestingly, it was also reported that Fhs constitutes up to 3 to 4% of dry weight of clostridial species (7). Furthermore, it may be speculated that under anaerobic conditions, N10-fTHF/purine production may be favored via Fhs, which may also explain why anaerobic organisms retain Fhs.

ACKNOWLEDGMENTS

We thank our laboratory colleagues for their suggestions on the manuscript and Andrew D. Hanson of the Horticultural Sciences Department, University of Florida, for the generous gift of the p-FBT plasmid.

This work was supported by grants from the Department of Science and Technology (DST) and the Department of Biotechnology (DBT), Government of India, New Delhi, India. U.V. is a J. C. Bose fellow of DST. S.S. is a Dr. D. S. Kothari postdoctoral fellow of the University Grants Commission, New Delhi, India. S.A. was supported by a senior research fellowship of the Council of Scientific and Industrial Research, New Delhi, India.

Footnotes

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JB.02365-14.

REFERENCES

  • 1.Smith DR, Doucette-Stamm LA, Deloughery C, Lee H, Dubois J, Aldredge T, Bashirzadeh R, Blakely D, Cook R, Gilbert K, Harrison D, Hoang L, Keagle P, Lumm W, Pothier B, Qiu D, Spadafora R, Vicaire R, Wang Y, Wierzbowski J, Gibson R, Jiwani N, Caruso A, Bush D, Dafer H, Patwell D, Prabhakar S, McDougall S, Shimer G, Goyal A, Pietrokovski S, Church GM, Daniels CJ, Mao J-I, Rice P, Nolling J, Reeve JN. 1997. Complete genome sequence of Methanobacterium thermoautotrophicum ΔH: functional analysis and comparative genomics. J Bacteriol 179:7135–7155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wasserfallen A, Nolling J, Pfister P, Reeve J, Conway de Macario E. 2000. Phylogenetic analysis of 18 thermophilic Methanobacterium isolates supports the proposals to create a new genus, Methanothermobacter gen. nov., and to reclassify several isolates in three species, Methanothermobacter thermautotrophicus comb. nov., Methanothermobacter wolfeii comb. nov., and Methanothermobacter marburgensis sp. nov. Int J Syst Evol Microbiol 50:43–53. doi: 10.1099/00207713-50-1-43. [DOI] [PubMed] [Google Scholar]
  • 3.Bult CJ, White O, Olsen GJ, Zhou L, Fleischmann RD, Sutton GG, Blake JA, FitzGerald LM, Clayton RA, Gocayne JD, Kerlavage AR, Dougherty BA, Tomb JF, Adams MD, Reich CI, Overbeek R, Kirkness EF, Weinstock KG, Merrick JM, Glodek A, Scott JL, Geoghagen NS, Venter JC. 1996. Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii. Science 273:1058–1073. doi: 10.1126/science.273.5278.1058. [DOI] [PubMed] [Google Scholar]
  • 4.Slesarev AI, Mezhevaya KV, Makarova KS, Polushin NN, Shcherbinina OV, Shakhova VV, Belova GI, Aravind L, Natale DA, Rogozin IB, Tatusov RL, Wolf YI, Stetter KO, Malykh AG, Koonin EV, Kozyavkin SA. 2002. The complete genome of hyperthermophile Methanopyrus kandleri AV19 and monophyly of archaeal methanogens. Proc Natl Acad Sci U S A 99:4644–4649. doi: 10.1073/pnas.032671499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Buchenau B, Thauer RK. 2004. Tetrahydrofolate-specific enzymes in Methanosarcina barkeri and growth dependence of this methanogenic archaeon on folic acid or p-aminobenzoic acid. Arch Microbiol 182:313–325. doi: 10.1007/s00203-004-0714-0. [DOI] [PubMed] [Google Scholar]
  • 6.Maeder DL, Anderson I, Brettin TS, Bruce DC, Gilna P, Han CS, Lapidus A, Metcalf WW, Saunders E, Tapia R, Sowers KR. 2006. The Methanosarcina barkeri genome: comparative analysis with Methanosarcina acetivorans and Methanosarcina mazei reveals extensive rearrangement within methanosarcinal genomes. J Bacteriol 188:7922–7931. doi: 10.1128/JB.00810-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Rabinowitz JC, Pricer WE Jr. 1962. Formyltetrahydrofolate synthetase. 1. Isolation and crystallization of enzyme. J Biol Chem 237:2898–2902. [PubMed] [Google Scholar]
  • 8.D'Ari L, Rabinowitz JC. 1991. Purification, characterization, cloning, and amino acid sequence of the bifunctional enzyme 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase from Escherichia coli. J Biol Chem 266:23953–23958. [PubMed] [Google Scholar]
  • 9.Pino P, Aeby E, Foth BJ, Sheiner L, Soldati T, Schneider A, Soldati-Favre D. 2010. Mitochondrial translation in absence of local tRNA aminoacylation and methionyl tRNA Met formylation in Apicomplexa. Mol Microbiol 76:706–718. doi: 10.1111/j.1365-2958.2010.07128.x. [DOI] [PubMed] [Google Scholar]
  • 10.Paukert JL, Straus LD, Rabinowitz JC. 1976. Formyl-methyl-methylenetetrahydrofolate synthetase-(combined). An ovine protein with multiple catalytic activities. J Biol Chem 251:5104–5111. [PubMed] [Google Scholar]
  • 11.Paukert JL, Williams GR, Rabinowitz JC. 1977. Formyl-methenyl-methylenetetrahydrofolate synthetase (combined); correlation of enzymic activities with limited proteolytic degradation of the protein from yeast. Biochem Biophys Res Commun 77:147–154. doi: 10.1016/S0006-291X(77)80176-9. [DOI] [PubMed] [Google Scholar]
  • 12.Whitehead TR, Park M, Rabinowitz JC. 1988. Distribution of 10-formyltetrahydrofolate synthetase in eubacteria. J Bacteriol 170:995–997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Crowley PJ, Gutierrez JA, Hillman JD, Bleiweis AS. 1997. Genetic and physiologic analysis of a formyl-tetrahydrofolate synthetase mutant of Streptococcus mutans. J Bacteriol 179:1563–1572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Johnson JL, Hamm-Alvarez S, Payne G, Sancar GB, Rajagopalan KV, Sancar A. 1988. Identification of the second chromophore of Escherichia coli and yeast DNA photolyases as 5,10-methenyltetrahydrofolate. Proc Natl Acad Sci U S A 85:2046–2050. doi: 10.1073/pnas.85.7.2046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H. 2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2:2006.0008. doi: 10.1038/msb4100050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Stover P, Schirch V. 1990. Serine hydroxymethyltransferase catalyzes the hydrolysis of 5,10-methenyltetrahydrofolate to 5-formyltetrahydrofolate. J Biol Chem 265:14227–14233. [PubMed] [Google Scholar]
  • 17.Murta SM, Vickers TJ, Scott DA, Beverley SM. 2009. Methylene tetrahydrofolate dehydrogenase/cyclohydrolase and the synthesis of 10-CHO-THF are essential in Leishmania major. Mol Microbiol 71:1386–1401. doi: 10.1111/j.1365-2958.2009.06610.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Li Y, Holmes WB, Appling DR, RajBhandary UL. 2000. Initiation of protein synthesis in Saccharomyces cerevisiae mitochondria without formylation of the initiator tRNA. J Bacteriol 182:2886–2892. doi: 10.1128/JB.182.10.2886-2892.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
  • 20.Saka K, Tadenuma M, Nakade S, Tanaka N, Sugawara H, Nishikawa K, Ichiyoshi N, Kitagawa M, Mori H, Ogasawara N, Nishimura A. 2005. A complete set of Escherichia coli open reading frames in mobile plasmids facilitating genetic studies. DNA Res 12:63–68. doi: 10.1093/dnares/12.1.63. [DOI] [PubMed] [Google Scholar]
  • 21.Schirch L, Gross T. 1968. Serine transhydroxymethylase. Identification as the threonine and allothreonine aldolases. J Biol Chem 243:5651–5655. [PubMed] [Google Scholar]
  • 22.Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640–6645. doi: 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Cherepanov PP, Wackernagel W. 1995. Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158:9–14. doi: 10.1016/0378-1119(95)00193-A. [DOI] [PubMed] [Google Scholar]
  • 24.Yu DG, Ellis HM, Lee EC, Jenkins NA, Copeland NG, Court DL. 2000. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A 97:5978–5983. doi: 10.1073/pnas.100127597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Cheng YS, Shen Y, Rudolph J, Stern M, Stubbe J, Flannigan KA, Smith JM. 1990. Glycinamide ribonucleotide synthetase from Escherichia coli: cloning, overproduction, sequencing, isolation, and characterization. Biochemistry 29:218–227. doi: 10.1021/bi00453a030. [DOI] [PubMed] [Google Scholar]
  • 26.Smith GK, Benkovic PA, Benkovic SJ. 1981. l(−)-10-Formyltetrahydrofolate is the cofactor for glycinamide ribonucleotide transformylase from chicken liver. Biochemistry 20:4034–4036. doi: 10.1021/bi00517a013. [DOI] [PubMed] [Google Scholar]
  • 27.Overbeek R, Begley T, Butler RM, Choudhuri JV, Chuang HY, Cohoon M, de Crecy-Lagard V, Diaz N, Disz T, Edwards R, Fonstein M, Frank ED, Gerdes S, Glass EM, Goesmann A, Hanson A, Iwata-Reuyl D, Jensen R, Jamshidi N, Krause L, Kubal M, Larsen N, Linke B, McHardy AC, Meyer F, Neuweger H, Olsen G, Olson R, Osterman A, Portnoy V, Pusch GD, Rodionov DA, Ruckert C, Steiner J, Stevens R, Thiele I, Vassieva O, Ye Y, Zagnitko O, Vonstein V. 2005. The subsystems approach to genome annotation and its use in the project to annotate 1000 genomes. Nucleic Acids Res 33:5691–5702. doi: 10.1093/nar/gki866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Taneja NK, Dhingra S, Mittal A, Naresh M, Tyagi JS. 2010. Mycobacterium tuberculosis transcriptional adaptation, growth arrest and dormancy phenotype development is triggered by vitamin C. PLoS One 5:e10860. doi: 10.1371/journal.pone.0010860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Verma SC, Mahadevan S. 2012. The chbG gene of the chitobiose (chb) operon of Escherichia coli encodes a chitooligosaccharide deacetylase. J Bacteriol 194:4959–4971. doi: 10.1128/JB.00533-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Eudes A, Kunji ER, Noiriel A, Klaus SM, Vickers TJ, Beverley SM, Gregory JF III, Hanson AD. 2010. Identification of transport-critical residues in a folate transporter from the folate-biopterin transporter (FBT) family. J Biol Chem 285:2867–2875. doi: 10.1074/jbc.M109.063651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Bailey LB. (ed). 2010. Folate in health and disease, 2nd ed. CRC Press, Boca Raton, FL. [Google Scholar]
  • 32.Fowler B. 1998. Genetic defects of folate and cobalamin metabolism. Eur J Pediatr 157:S60–S66. doi: 10.1007/PL00014306. [DOI] [PubMed] [Google Scholar]
  • 33.Rosenblatt D, Fowler B. 2006. Disorders of cobalamin and folate transport and metabolism, p 341–356. In Fernandes J, Saudubray J-M, Berghe G, Walter J (ed), Inborn metabolic diseases. Springer, Berlin, Germany. [Google Scholar]
  • 34.Duthie SJ. 2011. Folate and cancer: how DNA damage, repair and methylation impact on colon carcinogenesis. J Inherit Metab Dis 34:101–109. doi: 10.1007/s10545-010-9128-0. [DOI] [PubMed] [Google Scholar]
  • 35.Blount BC, Mack MM, Wehr CM, MacGregor JT, Hiatt RA, Wang G, Wickramasinghe SN, Everson RB, Ames BN. 1997. Folate deficiency causes uracil misincorporation into human DNA and chromosome breakage: implications for cancer and neuronal damage. Proc Natl Acad Sci U S A 94:3290–3295. doi: 10.1073/pnas.94.7.3290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Melnyk S, Pogribna M, Miller BJ, Basnakian AG, Pogribny IP, James SJ. 1999. Uracil misincorporation, DNA strand breaks, and gene amplification are associated with tumorigenic cell transformation in folate deficient/repleted Chinese hamster ovary cells. Cancer Lett 146:35–44. doi: 10.1016/S0304-3835(99)00213-X. [DOI] [PubMed] [Google Scholar]
  • 37.Nagy PL, Marolewski A, Benkovic SJ, Zalkin H. 1995. Formyltetrahydrofolate hydrolase, a regulatory enzyme that functions to balance pools of tetrahydrofolate and one-carbon tetrahydrofolate adducts in Escherichia coli. J Bacteriol 177:1292–1298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Sawers G, Bock A. 1988. Anaerobic regulation of pyruvate formate-lyase from Escherichia coli K-12. J Bacteriol 170:5330–5336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Rebelo J, Auerbach G, Bader G, Bracher A, Nar H, Hosl C, Schramek N, Kaiser J, Bacher A, Huber R, Fischer M. 2003. Biosynthesis of pteridines. Reaction mechanism of GTP cyclohydrolase I. J Mol Biol 326:503–516. doi: 10.1016/S0022-2836(02)01303-7. [DOI] [PubMed] [Google Scholar]
  • 40.Fan J, Ye J, Kamphorst JJ, Shlomi T, Thompson CB, Rabinowitz JD. 2014. Quantitative flux analysis reveals folate-dependent NADPH production. Nature 510:298–302. doi: 10.1038/nature13236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Hitchings GH, Burchall JJ. 1965. Inhibition of folate biosynthesis and function as a basis for chemotherapy. Adv Enzymol Relat Areas Mol Biol 27:417–468. [DOI] [PubMed] [Google Scholar]
  • 42.Temple CJ, Bennett LL Jr, Rose JD, Elliott RD, Montgomery JA, Mangum JH. 1982. Synthesis of pseudo cofactor analogues as potential inhibitors of the folate enzymes. J Med Chem 25:161–166. doi: 10.1021/jm00344a014. [DOI] [PubMed] [Google Scholar]
  • 43.Eadsforth TC, Maluf FV, Hunter WN. 2012. Acinetobacter baumannii FolD ligand complexes—potent inhibitors of folate metabolism and a re-evaluation of the structure of LY374571. FEBS J 279:4350–4360. doi: 10.1111/febs.12025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Ordal EJ, Halvorson HO. 1939. A comparison of hydrogen production from sugars and formic acid by normal and variant strains of Escherichia coli. J Bacteriol 38:199–220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Knappe J. 1987. Anaerobic dissimilation of pyruvate, p 199–220. In Neidhardt FC, Ingraham JL (ed), Escherichia coli and Salmonella: cellular and molecular biology. American Society for Microbiology, Washington, DC. [Google Scholar]
  • 46.Leibig M, Liebeke M, Mader D, Lalk M, Peschel A, Gotz F. 2011. Pyruvate formate lyase acts as a formate supplier for metabolic processes during anaerobiosis in Staphylococcus aureus. J Bacteriol 193:952–962. doi: 10.1128/JB.01161-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Warnecke T, Gill RT. 2005. Organic acid toxicity, tolerance, and production in Escherichia coli biorefining applications. Microb Cell Fact 4:25. doi: 10.1186/1475-2859-4-25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Nygaard P, Smith JM. 1993. Evidence for a novel glycinamide ribonucleotide transformylase in Escherichia coli. J Bacteriol 175:3591–3597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Beyer L, Doberenz C, Falke D, Hunger D, Suppmann B, Sawers RG. 2013. Coordination of FocA and pyruvate formate-lyase synthesis in Escherichia coli demonstrates preferential translocation of formate over other mixed-acid fermentation products. J Bacteriol 195:1428–1435. doi: 10.1128/JB.02166-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Low B. 1968. Formation of merodiploids in matings with a class of Rec− recipient strains of Escherichia coli K12. Proc Natl Acad Sci U S A 60:160–167. doi: 10.1073/pnas.60.1.160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Guyer MS, Reed RR, Steitz JA, Low KB. 1981. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harbor Symp Quant Biol 45:135–140. doi: 10.1101/SQB.1981.045.01.022. [DOI] [PubMed] [Google Scholar]
  • 52.Rao AR, Varshney U. 2002. Characterization of Mycobacterium tuberculosis ribosome recycling factor (RRF) and a mutant lacking six amino acids from the C-terminal end reveals that the C-terminal residues are important for its occupancy on the ribosome. Microbiology 148:3913–3920. [DOI] [PubMed] [Google Scholar]
  • 53.Singh NS, Ahmad R, Sangeetha R, Varshney U. 2008. Recycling of ribosomal complexes stalled at the step of elongation in Escherichia coli. J Mol Biol 380:451–464. doi: 10.1016/j.jmb.2008.05.033. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES