Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Nov 20.
Published in final edited form as: Mol Cell. 2014 Oct 9;56(4):541–550. doi: 10.1016/j.molcel.2014.09.021

Negamycin interferes with decoding and translocation by simultaneous interaction with rRNA and tRNA

Yury S Polikanov 1,2, Teresa Szal 3, Fuyan Jiang 3,4, Pulkit Gupta 3, Ryoichi Matsuda 5, Masataka Shiozuka 5, Thomas A Steitz 1,2,†, Nora Vázquez-Laslop 3,†, Alexander S Mankin 3
PMCID: PMC4334386  NIHMSID: NIHMS635946  PMID: 25306922

SUMMARY

Negamycin (NEG) is a ribosome targeting antibiotic which exhibits clinically promising activity. Its binding site and mode of action have remained unknown. We solved the structure of the Thermus thermophilus ribosome bound to mRNA and three tRNAs, in complex with NEG. The drug binds to both small and large ribosomal subunits at 9 independent sites. Resistance mutations in the 16S rRNA unequivocally identified the binding site in the vicinity of the conserved helix 34 (h34) in the small subunit as the primary site of antibiotic action in the bacterial and, possibly, eukaryotic ribosome. At this site, NEG contacts 16S rRNA as well as the anticodon loop of the A-site tRNA. Although the NEG site of action overlaps with that of tetracycline (TET), the two antibiotics exhibit different activities: while TET sterically hinders binding of aminoacyl-tRNA to the ribosome, NEG stabilizes its binding thereby inhibiting translocation and stimulating miscoding.

Keywords: Negamycin, antibiotic, 70S ribosome, X-ray structure, inhibition of translation, miscoding, translocation inhibitor

INTRODUCTION

The natural peptide-like antibiotic negamycin (NEG) [2-(3,6-diamino-5-hydroxyhexanoyl)-methylhydrazino]acetic acid] (Figure 1A), which exhibits inhibitory activity against Gram-negative and Gram-positive bacterial pathogens, was originally isolated from Streptomyces strains (Hamada et al., 1970) more than four decades ago. Although early biochemical experiments suggested that NEG inhibits protein synthesis (Mizuno et al., 1970a, b), its mode of action remained enigmatic because various in vitro studies suggested that it could inhibit steps of translation as diverse as initiation (Mizuno et al., 1970b), decoding (Mizuno et al., 1970b; Uehara et al., 1972) and termination (Uehara et al., 1974, 1976b). The putative miscoding activity of NEG has made it an appealing candidate for the treatment of human genetic disorders caused by nonsense mutations. NEG or its synthetic analogs have demonstrated promising activity in stimulating premature stop codon bypass and partially restoring expression of several disease-related genes inactivated by nonsense mutations (Allamand et al., 2008; Arakawa et al., 2003; Floquet et al., 2011; Taguchi et al., 2012). These findings have made the need to uncover the site and the mode of action of NEG even more compelling.

Figure 1. Binding of NEG to the T. thermophilus 70S ribosome.

Figure 1

Open in a new tab

(A) Structural formula of NEG. (B) The refined model of NEG at Site 1 is displayed in its respective electron density. The unbiased (Fobs – Fcalc) difference Fourier electron density map is contoured at 3σ. Carbon atoms are colored yellow, nitrogens – blue, oxygens – red. (C) NEG binding sites in the small (left) and large (right) subunits of the T. thermophilus 70S ribosome. The refined positions of NEG are shown by yellow spheres. Residues of the 16S rRNA mutated in the NEG-resistant mutants are shown in red. The locations of L1 stalk, central protuberance (CP) and L7/L12 stalk of the 50S subunit are indicated for orientation. (D) NEGr mutations in the E. coli 16S rRNA (E.coli numbering is used throughout). See also Figures S2, S3 and Movie S1.

Lack of understanding of the mechanism of NEG action has been further exacerbated by conflicting reports regarding its binding site. In vitro studies suggested that NEG associates with an RNA fragment mimicking helix 44 of the small ribosomal subunit rRNA (Arakawa et al., 2003), which harbors the binding site of miscoding-inducing aminoglycoside antibiotics (Griffey et al., 1999; Purohit and Stern, 1994). However, ribosomes isolated from aminoglycoside resistant bacterial strains remained sensitive to NEG (Uehara et al., 1972). Soaking crystals of the large ribosomal subunit of the archaeon Haloarcula marismortui with 5 mM NEG revealed that the antibiotic binds at an unexpected site that lies close to the opening of the nascent peptide exit tunnel (Schroeder et al., 2007). Unfortunately, it was impossible to confirm the functional significance of the exit tunnel binding site because of the inability to isolate and map NEG-resistance mutations and due to the difficulty of crystallizing more physiologically-relevant ribosome-antibiotic complexes (Corchuelo et al., 1981; Schroeder et al., 2007; Uehara et al., 1972).

We reasoned that structural and functional studies of the antibiotic complexed to the ribosome in a functionally meaningful state could provide a more compelling and consistent view of the site and mode of NEG action. In this work, we solved the 2.7 Å resolution crystal structure of the bacterial (Thermus thermophilus) 70S ribosome in complex with mRNA, three tRNAs and NEG, which shows binding of the drug to 9 independent sites. Resistance mutations in 16S rRNA unequivocally identify one of them as the main site of antibiotic action. Here, NEG interacts simultaneously with 16S rRNA and the A-site bound tRNA. Strikingly, although the NEG binding site largely overlaps with that of tetracycline, the two antibiotics exhibit opposite activities: while tetracycline prevents accommodation of aminoacyl-tRNA in the A site due to a steric clash with the anticodon, NEG likely stabilizes tRNA binding, leading to an increase in the frequency of translation errors and inhibition of translocation.

RESULTS AND DISCUSSION

The crystal structure of NEG bound to the Thermus thermophilus 70S ribosome

To identify the site of action of NEG in the bacterial ribosome, we solved the crystal structure of the T. thermophilus 70S ribosome in complex with NEG, a short mRNA and three deacylated tRNAs, at 2.7 Å resolution. The complex of 70S ribosomes with mRNA and tRNAs was first crystallized and then crystals were soaked in 250 µM solution of NEG. It should be noted that this concentration of NEG significantly exceeded its IC50 in the cell-free translation system (Figure S1); because the inhibitor’s IC50 and dissociation constant are only loosely correlated, we used a high NEG concentration in the crystallization experiments to ensure that the drug binding site was sufficiently saturated. The structure was solved by molecular replacement using the atomic coordinates of the T. thermophilus 70S ribosome (PDB entries: 4QCM, 4QCN (Polikanov et al., 2014b)). In order to localize the NEG binding site(s) within the ribosome, we calculated an unbiased difference Fourier map using the observed amplitudes from the crystal and the amplitudes and phases that were derived from a model of the ribosome without the bound antibiotic. Peaks of positive electron density resembling distinct features of the NEG chemical structure (Figure 1A) were observed at 9 different locations in both copies of the ribosome in the asymmetric unit (Figure 1B–C, Figure S2; Movie S1). Four of the NEG binding sites are located on the 30S subunit (Sites 1–4), while the remaining five sites are on the 50S subunit (Sites 5–9). An atomic model of NEG was manually fitted into the difference Fourier map at each location and their coordinates were refined. The statistics for data processing and refinement are shown in Table 1.

Table 1.

X-ray diffraction data collection and refinement statistics.

Crystal 70S–NEG
Diffraction Data
Space Group P212121
Unit Cell Dimensions, Å (a × b × c) 208.25 × 443.61 × 619.30
Wavelength, Å 0.9795
Resolution range (outer shell), Å 361-2.70 (2.77-2.70)
I/σI (outer shell with I/σI=1) 8.77 (1.00)
Resolution at which I/σI=1, Å 2.70
Resolution at which I/σI=2, Å 2.88
CC(1/2) at which I/σI=1, % 29.7
Completeness (outer shell), % 97.2 (98.6)
Rmerge (outer shell)% 12.8 (126.6)
No. of crystals used 1
No. of Reflections    Observed
Used:        Unique		 5,273,366
1,505,170
Redundancy 3.50
Wilson B-factor, Å2 54.2
Refinement
Rwork/Rfree, % 21.0/25.7
No. of Non-Hydrogen Atoms
RNA 200,015
Protein 91,187
Ions (Mg, K, Zn, Fe) 2,043
Waters 3,049
Ramachandran Plot
Favored regions, % 93.85
Allowed regions, % 4.92
Outliers, % 1.24
Deviations from ideal values (RMSD)
Bond, Å 0.006
Angle, degrees 1.026
Chirality 0.044
Planarity 0.005
Dihedral, degrees 16.365
Open in a new tab

Rmerge = Σ |I – <I>| / Σ I, where I is the observed intensity and <I> is the average intensity from multiple measurements.

Rwork = Σ|Fobs – Fcalc| / Σ Fobs. For calculation of Rfree, 5% of the truncated dataset was excluded from the refinement.

The multitude of binding sites likely reflects promiscuous interactions of the small, flexible, positively charged antibiotic molecule with the large porous ribosome built on a polyanionic RNA scaffold (Voss et al., 2006). It is unlikely, therefore, that all of the observed binding sites are functionally-relevant, moreover that the NEG concentration used for crystal soaking likely significantly exceeds physiologically-relevant concentrations of the antibiotic. With one exception (Site 1), most of these pockets are located far from the known ribosomal functional centers. Furthermore, none of them overlap with the NEG binding site previously observed in the archaeal 50S subunit (Schroeder et al., 2007) or with the 16S rRNA helix 44, which was putatively implicated as the NEG interacting partner by RNA fragment binding studies (Arakawa et al., 2003). Some other antibiotics bind to several ribosomal sites, of which usually only one or few represent the true targets of drug action (Borovinskaya et al., 2007a; Brodersen et al., 2000; Pioletti et al., 2001; Schlunzen et al., 2003). Therefore, we used genetic tools to establish the site where NEG binding interferes with ribosome function.

Mapping the site of NEG action in the bacterial ribosome

To determine the true site of action of NEG in the bacterial ribosome, we selected resistant mutants using the E. coli strain SQ110DTC that, besides being hypersensitive to a large range of antibiotics, possesses only one rrn allele which facilitates isolation of ribosomal mutations (Orelle et al., 2013). Plating 109 cells onto an agar plate containing 160 µg/mL of NEG (5-fold the minimal inhibitory concentration [MIC]) resulted in the appearance of several resistant colonies. Sequencing of the 23S rRNA gene did not reveal alterations at any position. However, in all sequenced NEG-resistant clones, mutations were found in the 16S rRNA gene. These mutations (U1052G, U1060A, and A1197U) were clustered in the middle section of helix 34 (h34) (Figure 1D). They are located in close proximity to the decoding center in the 30S ribosomal subunit and, most importantly, they are positioned immediately adjacent to the NEG Site 1 observed in our crystal structure (Figure 1C).

In order to verify that h34 mutations found in the analyzed clones were necessary and sufficient to confer NEG resistance, two of the mutations, U1060A and A1197U, were individually engineered in the 16S rRNA gene of the rRNA operon in plasmid pAM552. Plasmids carrying the mutations were introduced into the antibiotic-hypersensitive ΔtolC variant of the E. coli strain SQ171 that lacks all the chromosomal rrn alleles (Asai et al., 1999; Bollenbach et al., 2009). The mutations increased NEG resistance 4-fold (U1060A) or 16-fold (A1197U) (Table 2). Therefore, in spite of the multiplicity of antibiotic binding sites observed in the crystal complex, the resistance mutations clustered around the drug-binding Site 1 in h34 of the 16S rRNA unequivocally identified it as the primary target of NEG action. Accordingly, we focus our subsequent analysis specifically on this site.

Table 2.

Minimal inhibitory concentrations of NEG and TET for E. coli.

E. coli strain Resistance
mechanism		 MIC µg/mL
(fold change relative to wild type)
NEG TET
SQ110DTC wt 32 0.5
U1052G >256 (>8) 0.125 (0.25)
U1060A >256 (>8) n. d.
A1197U >256 (>8) n. d.
SQ171DTC wta 32 0.125
U1060A 128 (4) 0.5 (4)
A1197U 512 (16) 1 (8)
U1060A/A1197U 32 (1) 0.125 (1)
G966U 16 (0.5) 0.5 (4)
G1058C 128 (4) 0.5 (4)
BL21 wtb 64 0.5
TetM 64 (1) 16 (32)
Open in a new tab
a

SQ171 cells transformed with pAM552 plasmid carrying wild type rrnB operon.

b

BL21 cells transformed with an empty vector pET11a.

NEG binding to the site of its action requires proper configuration of the 16S rRNA backbone

In Site 1, the extended hydrophilic antibiotic forms multiple hydrogen bonds with the backbone of nucleotides 965, 966, 1054, and 1197 (Figures 2 and S3C). The terminal carboxylic moiety of NEG forms a magnesium-mediated contact with the phosphate group of nucleotide 1052. None of the contacts of the antibiotic with the ribosome directly involve rRNA bases. Rather, the drug recognizes specific sugar-phosphate backbone atoms, whose proper spatial arrangement defines the position of the drug in its binding site. Therefore, the 16S rRNA resistance mutations that were identified, all of which disrupt h34 base pairs (Figure 1D), likely interfere with drug binding by changing the geometry of the h34 backbone. Two of the E. coli mutations, U1060A and A1197U, break the same base pair in h34 (Figure 1D). It is noteworthy that in the T. thermophilus ribosome, which readily binds NEG, the U–A base pair at this location is replaced with the C–G base pair, underscoring the importance of Watson-Crick interactions rather than the identity of the nucleotide for the antibiotic binding. Disruption of the 1060–1197 base pair by NEGr mutations likely perturbs hydrogen bonding of the antibiotic to the residue 1197 backbone (Figure 2E). If this view is correct, then combining these two resistance mutations in the same cell would reconstitute the base-pair and hence restore sensitivity to the drug. Indeed, the simultaneous presence of U1060A and A1197U mutations in the E. coli 16S rRNA reverted NEG sensitivity to the wild type level (Table 2), thereby confirming that the proper structure of the h34 backbone is required for the efficient binding of the antibiotic to its site of action in the small ribosomal subunit.

Figure 2. NEG Site 1 in the 70S ribosome.

Figure 2

Open in a new tab

(A, B, C) Overview of the NEG binding Site 1 (yellow) in the T. thermophilus 70S ribosome viewed from three different perspectives. The 30S subunit is shown in light yellow, 50S subunit is light blue, mRNA is shown in magenta and tRNAs are displayed in green (A site), dark blue (P-site), and orange (E-site). In (A), the 30S subunit is viewed from the intersubunit interface (50S subunit and A site tRNA were removed for clarity). In (A) and (B), the location of helix 34 of 16S rRNA is highlighted by black outline. (D, E, F) Close-up views of the NEG binding Site 1 shown in panels (A), (B), and (C), respectively. Magnesium ion is shown in green. Nucleotides, whose mutations in E. coli confer NEG resistance, are boxed. See also Figure S3 and Movie S1.

NEG interacts with the A-site tRNA

In fast growing cells, the majority of the ribosomes are involved in active translation. Therefore, when cells are exposed to an antibiotic, the inhibitor interacts predominantly with the translating ribosomes associated with functional ligands such as mRNA, tRNAs, and translation factors. The contacts of the inhibitor with the ligands of translation can be pivotal for its inhibitory action. Thus, crystallographic structures of an antibiotic complexed to the ribosome in the functional state should more accurately reveal the mechanisms of drug action than structures of the inhibitor bound to the vacant ribosome or individual ribosomal subunits. Indeed, analysis of intermolecular contacts established by NEG in the Site 1 shows that the antibiotic forms extensive interactions with the anticodon of the A-site tRNA. The N4 secondary amine (Figure 1A) of NEG is at hydrogen-bonding distance from the non-bridging oxygen atoms of the 5’-phosphate of nucleotide 34 of the A-site tRNA (Figure 2D). In addition, the terminal carboxyl group of NEG interacts with the non-bridging oxygen of the 3’-phosphate of the same tRNA residue via a hydrated magnesium ion, further strengthening the interactions of the drug with the tRNA.

Interaction of NEG with tRNA may inhibit translocation

The simultaneous multiple contacts of NEG with 16S rRNA and tRNA suggest that the drug may increase the affinity of tRNA to the A site, leading to some predictable consequences. Specifically, the tighter tRNA binding is expected to interfere with translocation because clearance of the A site and relocation of the tRNA-mRNA complex will require higher activation energy. We tested this possibility by analyzing the effect of NEG on translocation using a toe-printing assay (Hartz et al., 1988). This approach allows for detection of the ribosome pausing on mRNA during in vitro translation; the pattern of transiently stalled ribosomes is indicative of the mode of antibiotic action (Orelle et al., 2013). The well-known inhibitors of translocation, viomycin (VIO) or kanamycin (KAN) (Wilson, 2009), cause the appearance of a series of evenly-spaced weak toe-printing bands corresponding to ribosomes that have randomly paused during their progression through the mRNA codons (Orelle et al., 2013) (Figure 3A). The presence of NEG in the translation reaction produces a set of bands whose positions coincide with those observed for VIO or KAN (Figure 3A), indicating similarity in the modes of action of these antibiotics. We noted that tetracycline (TET), which inhibits translation by preventing binding of aminoacyl-tRNA in the A site (Wilson, 2009), also generates codon-spaced toe-printing bands (Orelle et al., 2013) (Figure 3A). However, a number of the TET bands were shifted by one nucleotide relative to those of NEG, VIO or KAN – a previously described toe-printing effect associated with the lack of an A-site tRNA in the stalled ribosome (Jerinic and Joseph, 2000; Orelle et al., 2013). Thus, the results of toe-printing analysis argue that NEG exerts its action after accommodation of aminoacyl-tRNA in the A site and inhibits ribosome progression through mRNA, possibly by impeding translocation.

Figure 3. Mechanism of NEG action.

Figure 3

Open in a new tab

(A) Toe-printing analysis of antibiotic effects upon translation of the natural gene osmC or a synthetic gene RST2. Antibiotics thiostrepton (THS), negamycin (NEG), viomycin (VIO), kanamycin (KAN) and tetracycline (TET) were present in the reaction at 100 µM. The antibiotic-induced toe-printing bands corresponding to ribosomes stalled at the 5’-end proximal codons of the genes are indicated by red dots for NEG, green dots for VIO and KAN, and orange dots for TET. The control antibiotic THS arrests the ribosome at the initiator codon. The initiator and subsequent codons are marked by open and filled triangles, respectively. (B) Effect of NEG on translocation of ribosomes from the 1st (AUG) to the 2nd (UUU) codon of m291 mRNA (partial relevant sequence shown in the upper panel). Where indicated, ribosomes were incubated with NEG at 10, 100 or 1000 µM prior to the addition of EF-G and GTP. The triangles show the toe-printing bands corresponding to the position of ribosomes at the initiator codon (white triangle – empty A-site; grey triangle – Phe-tRNAPhe-occupied A site) or ribosomes translocated to the second codon (black triangle). The bar graph shows the translocation efficiency (%) estimated by the ratio of the intensity of the bands indicated by the black and grey triangles. Data are represented as mean +/− SEM. (C) Disk diffusion assay revealing the miscoding activity of NEG. Cells transformed with pBR322bla-stop were plated on LB agar without (bottom) or with 25 µg/mL of ampicillin (top). In the absence of ampicillin, diffusion of antibiotics paromomycin (PAR), spectinomycin (SPC) or NEG inhibits bacterial growth. In the presence of ampicillin, cell growth occurs only with miscoding-inducing antibiotics PAR and NEG which allow expression of functional ß-lactamase, as revealed by nitrocefin staining. The inactivating nonsense mutation in the bla gene of the pBR322bla-stop plasmid is shown above the plates. See also Figure S1.

Of note, increasing concentration of NEG in the reaction did not increase the ribosome stalling at the earlier mRNA codons (Figure S1B). This result indicates that even at saturation, NEG does not block translocation dramatically, but only slows it down at each codon. Multiplication of even a weak inhibitory effect over many codons of a protein-coding gene would result in severe inhibition of protein production at a relatively low NEG concentration.

We further directly tested the effect of NEG on translocation in a model assay that monitors the EF-G catalyzed relocation of the ribosome from the start AUG codon of the phage T4 gene 32 mRNA to the second UUU codon (Figure 3B). The presence of NEG decreased the extent of translocation at a 30-second time point corresponding to the kinetic slope of the reaction, thus confirming that binding of the antibiotic slows down progression of the ribosome along mRNA, likely due to impeded translocation.

NEG may induce miscoding by stabilizing aminoacyl-tRNA binding in the A site

Antibiotics like paromomycin (PAR) or streptomycin (STR), which similarly to NEG may strengthen tRNA binding to the A site, promote miscoding (Karimi and Ehrenberg, 1994; Peske et al., 2004) (Figure S4). Previous data indicated that NEG might induce amino acid misincorporation in bacterial cell-free extracts (Mizuno et al., 1970b; Uehara et al., 1972). In order to verify whether NEG stimulates in vivo miscoding in bacteria, we engineered a reporter system in which a premature UGA stop codon interrupts the bla gene in the pBR322 plasmid (“pBR322bla-stop”), preventing expression of functional ß-lactamase. Survival of pBR322bla-stop-transformed cells in the presence of the ß-lactam antibiotic ampicillin depends solely upon the ability of the translating ribosomes to bypass the premature stop codon in the bla gene by misreading it as a sense codon. In the absence of other antibiotics, growth of the lawn of cells transformed with pBR322bla-stop on a LB-agar plate is inhibited by 25 µg/mL ampicillin (Figure 3C). In contrast, diffusion of NEG from a disk impregnated with the drug allowed cell growth on the ampicillin plate (Figure 3C). Similarly, PAR, a translation error-inducing aminoglycoside, also promoted growth on ampicillin, while spectinomycin (SPC), which does not induce miscoding (Wilson, 2009), did not. Expression of the catalytically active ß-lactamase in the cells surrounding the disks with NEG or PAR was confirmed by staining with nitrocefin, an indicator of ß-lactamase activity (O'Callaghan et al., 1972). This result demonstrates substantial miscoding activity of NEG in bacterial cells which likely stems from its ability to promote illegitimate aminoacyl-tRNA binding to the ribosomal A site programmed with stop codon. While ‘traditional’ miscoding antibiotics, e.g. PAR or STR, stimulate tRNA binding by altering the conformation of the A site (Ogle and Ramakrishnan, 2005), NEG apparently achieves a similar effect by establishing direct interactions with the A-site tRNA. We should indicate, however, that our data are insufficient to comment on codon- or tRNA- specificity of NEG-induced miscoding.

The readthrough activity we observed in bacteria is reminiscent of the reported NEG ability to stimulate premature stop codon bypass in mammalian cells (Allamand et al., 2008; Arakawa et al., 2003). The alignment of the structures of the 70S ribosome in complex with NEG and the vacant yeast 80S ribosome (Ben-Shem et al., 2011) showed that the drug could form similar interactions with both bacterial 16S rRNA and eukaryotic 18S rRNA, despite their evolutionary divergence (Figure 4). Therefore, it is possible that, in both the bacterial and eukaryotic ribosomes, NEG induces stop codon readthrough by binding to the same site in the vicinity of h34 of rRNA of the small subunit.

Figure 4. Superposition of 16S rRNA in the vicinity of NEG binding Site 1 with 18S rRNA.

Figure 4

Open in a new tab

(A) Superposition of h34 of 16S rRNA (light yellow) from current 70S-NEG structure with homologous region of 18S rRNA (cyan) from yeast (PDB entry 3U5C (Ben-Shem et al., 2011)). Superposition is based on the alignment of nucleotides 1029–1050 of T. thermophilus 16S rRNA with nucleotides 1266–1287 of yeast 18S rRNA. (B) Close-up view of NEG Site 1 on the 70S ribosome showing 16S rRNA nucleotides interacting with NEG, superimposed with corresponding nucleotides of the 18S rRNA. In (A) and (B), nucleotides of 16S rRNA are labeled using the E. coli numbering system. In (B), yeast numbering is shown in brackets. Note that particular atoms involved in NEG binding have similar locations in both 16S rRNA and 18S rRNA.

Our structure of the ribosome-NEG functional complex offers a possible explanation for the previously reported varying miscoding capacity of NEG derivatives (Uehara et al., 1976a). The placement of the drug in Site 1 is fixed by the interaction between its positively charged β-amino group and the 5’-phosphate of G1197. Stereo-configuration of the C7 carbon atom carrying this amino group is pivotal for orienting the antibiotic and its binding to tRNA. Indeed, inverting its stereo configuration dramatically diminished drug-induced miscoding (Uehara et al., 1976a). In contrast, the C9-linked hydroxyl is not involved in any major interactions, as removal of this group or its methylation had no effect on miscoding (Uehara et al., 1976a). Finally, any bulky substitutions at the terminal amino group of NEG will prevent the drug from fitting into its binding pocket. Consistently, its acylation prevented drug binding and miscoding (Uehara et al., 1976a).

Binding in Site 1 cannot explain NEG effect upon translation termination

One of the activities reported previously for NEG was inhibition of translation termination (Uehara et al., 1974). We were unable to find any convincing rationale for this activity on the basis of NEG binding to Site 1. Aligning the 70S-NEG structure with those of the ribosome complexed with Class I release factors did not show any interference or specific interactions between the drug and either of the release factors (Figures S5A and S5B). However, binding of NEG to Site 5 in the large ribosomal subunit results in a steric clash with the amino acid residue Gln253 of T. thermophilus RF1 (Laurberg et al., 2008) (Figures S5C and S5D). Competition between NEG and RF1 for mutually-exclusive binding to the 70S ribosome is also indirectly supported by the observation that ribosome crystals containing RF1 significantly lose their diffracting ability upon soaking with NEG (data not shown). This could be the result of NEG-induced disorder in 70S-RF1 crystals. Nevertheless, it should be noted that even if binding of NEG in Site 5 interferes with peptide release, this activity has a negligible contribution to the overall antibiotic effect because none of the resistance mutations were found in the vicinity of this site.

NEG and TET: same site, different modes of action

Besides NEG, antibiotics of two other classes, TET and SPC, interact with h34 in 16S rRNA (Borovinskaya et al., 2007b; Brodersen et al., 2001; Carter et al., 2000; Jenner et al., 2013; Pioletti et al., 2001). While the binding site of SPC is separated from that of NEG by more than 20 Å, TET and NEG bind to overlapping sites, in which they share some of the interactions with 16S rRNA (Figure 5). Both antibiotics form extensive hydrogen bonding interactions with the sugar-phosphate backbone of the h34 nucleotides 1197 and 1198. At the same time, they do not interact with the nucleobases, except for partial stacking of TET against C1054. The main difference in the binding modes of the two antibiotics with rRNA is that TET anchors onto the ribosome primarily through interactions with h34, forming only a single Mg2+-mediated interaction with the backbone of h31 nucleotide 966, whereas NEG exhibits multiple direct interactions with the backbone of nucleotides 965 and 966 from the h31 loop (Figure 2F).

Figure 5. NEG and TET have overlapping binding sites but different mechanisms of action.

Figure 5

Open in a new tab

(A) Overview of the superimposed binding sites of TET (blue) and Site 1 of NEG (yellow) in the 30S subunit. The view and the coloring of 16S rRNA, mRNA and tRNAs are the same as in Figure 2A. Nucleotides 964–966 from h31 of the 16S rRNA, which are involved in NEG binding, are not shown for clarity. NEG structure is from the current work, TET is from PDB entry 4G5K (Jenner et al., 2013). All structures were aligned based on h34 of the 16S rRNA. (B, C, D) Close-up views of the binding sites shown in (A). (B) NEG and TET bind to the overlapping sites but occupy different space. (C) Interaction of NEG with the A-site tRNA possibly leading to tighter binding. (D) Co-occupancy of the ribosome with TET and A-site tRNA is impossible because of the steric clash of the drug with the tRNA anticodon.

In spite of their overlapping binding sites in the ribosome, the mechanisms of TET and NEG action are quite different. NEG fits snugly between helices 34 and 31 of the 16S rRNA and the backbone of the tRNA anticodon in the A site (Figure 5C), while ribosome-bound TET clashes with the tRNA anticodon (Figure 5D). As a result of this difference, NEG likely increases the affinity of the tRNA to the ribosomal A site, while TET and its derivatives compete with aminoacyl-tRNA binding (Blanchard et al., 2004; Brodersen et al., 2000; Jenner et al., 2013).

Idiosyncrasies in the contacts of NEG and TET with the ribosome prompted us to test the cross-resistance conferred by the previously known TET-resistance mechanisms and the newly discovered NEGr mutations. The NEGr mutations U1060A and A1197U rendered E. coli cells resistant to TET, whereas combining these mutations in the same ribosome restored the wild type sensitivity for both TET and NEG (Table 2), suggesting that the undisrupted secondary structure of h34 is required for efficient binding of both antibiotics. The TETr mutation G1058C (Ross et al., 1998) also increased NEG resistance (Table 2). In contrast, TETr mutation G966U (Dailidiene et al., 2002; Gerrits et al., 2003; Gerrits et al., 2002; Nonaka et al., 2005) rendered cells hypersensitive to NEG (Table 2), whereas NEGr mutation U1052G increased sensitivity to TET, accentuating the difference in interactions of these chemically dissimilar antibiotics with the ribosome. A unique mechanism of TET resistance involves the action of the ribosome protection proteins (e.g. TetM), which have been suggested to promote dissociation of the drug by transient binding to the ribosome and altering the conformation of the antibiotic binding site (Dönhöfer et al., 2012; Spahn et al., 2001). Expression of TetM in E. coli BL21 cells increased TET MIC by 32-fold (Mikolajka et al., 2011) (Table 2) but had no effect on NEG sensitivity (Table 2). This result suggests that the TetM-induced alteration of the TET binding pocket does not trigger release of the bound NEG, further stressing the conclusion that NEG and TET establish substantially distinct interactions with the 30S ribosomal subunit.

The use of a ribosomal functional complex for the structural analysis made it possible to observe important interactions between NEG and tRNA which likely stimulate tRNA binding and, as we propose, are critical for the mechanism of drug action. Our structure and the newly gained insights into the mode of NEG action can suggest future directions for optimizing the clinically-relevant activities of the drug. For example, extending the carboxyl end of NEG or adding bulky substitutions to the N3 position (Figure 1A) will likely lead to a clash with the A-site tRNA and acquiring ‘TET-like’ activity at the expense of NEG-specific properties. In contrast, small substitutions at the amino terminus or at C8 may stabilize NEG binding to the ribosome and/or tRNA, potentially further improving its miscoding capacity. We believe that understanding the interactions and operation of NEG in its functional site in the ribosome will provide the structural framework for future improvement of this protein synthesis inhibitor for medical purposes.

Our results also show that the affinity of the aminoacyl-tRNA to the ribosome must be carefully balanced in order to provide efficient acceptor substrate binding without compromising accuracy and speed of translocation. Perturbing this balance by decreasing aminoacyl-tRNA affinity (e.g. by TET) or increasing it (e.g. by NEG) is detrimental for efficient protein synthesis.

EXPERIMENTAL PROCEDURES

Crystallographic structure determination

T. thermophilus 70S ribosomes, unmodified tRNAiMet and tRNAPhe from E. coli were purified as previously described (Junemann et al., 1996; Polikanov et al., 2012; Schmitt et al., 1999). Synthetic mRNA with the sequence 5’-GGC AAG GAG GUA AAA AUG UUC UAA-3’ was obtained from IDT (Coralville, IA). NEG was obtained from the Institute of Microbial Chemistry (Tokyo, Japan).

Ribosome-mRNA-tRNA complex was formed by programming of 5 µM 70S Tth ribosomes with 10 µM mRNA and incubation at 55°C for 10 minutes, followed by addition of 20 µM P- and A site tRNA substrates (with minor changes from (Voorhees et al., 2009)). Each of the last two steps was allowed to reach equilibrium for 10 minutes at 37°C. The final ionic conditions were: 5 mM HEPES-KOH (pH 7.6), 50 mM KCl, 10 mM NH4Cl and 10 mM Mg(CH3COO)2.

Crystals were grown by the vapor diffusion method in sitting drops at 19°C and stabilized as described (Polikanov et al., 2012) with NEG included only in the last stabilization buffer (250 µM NEG final concentration). Diffraction data were collected at beamline 24ID-C at the Advanced Photon Source and beamline X25 at the Brookhaven National Laboratory. All crystals belonged to the primitive orthorhombic space group P212121 with approximate unit cell dimensions of 210Å × 450Å × 620Å and contained two copies of the 70S ribosome per asymmetric unit. The initial molecular replacement solutions were refined by rigid body refinement with the ribosome split into multiple domains, followed by positional and individual B-factor refinement. The statistics for data processing and refinement are shown in Table 1.

Selection and analysis of NEG and TET resistant mutants

To isolate NEG resistant mutants, E. coli SQ110DTC cells (Orelle et al., 2013) were grown overnight at 37°C in LB medium containing selective antibiotic markers (50 µg/mL spectinomycin, 50 µg/mL kanamycin). The culture was diluted to OD600 = 0.05 and, upon reaching mid exponential phase (OD600 = 0.5), ca. 109 cells (~ 1 OD600 of the culture) were plated on a LB-agar plate containing 160 µg/mL NEG (5 fold MIC). Several colonies appeared on the plate after overnight incubation at 37°C. 16S and 23S genes were PCR amplified from the resistant colonies and sequenced (Orelle et al., 2013).

The T1060A and A1197T mutations were introduced in the 16S rRNA gene of plasmid pAM552 using the QuikChange Lightning Multi Site mutagenesis kit (Agilent Technologies). After verifying the presence of the mutation, the mutant plasmids were introduced into E. coli SQ171 ΔtolC strain (Asai et al., 1999; Bollenbach et al., 2009). MICs were determined by microbroth dilution method.

Plasmid pAM552 was engineered as follows: A 5.6 kb DNA fragment containing E. coli rrnB operon starting from the PL promoter and including both T1 and T2 terminators was PCR amplified from the pLK35 plasmid (Douthwaite et al., 1989) using primers Not-PL-rrnB (CCCGCGGCCGCGATCTCTCACCTACCAAACAATGCC) and Asc-Pl-rrnB2 (CCCGGCGCGCCGGCTTGTAGATATGACGACAGGAAGA). The bla-ori segment of the pGEX-2T plasmid was PCR amplified using primers Not-pGEXR (CGGGCGGCCGCCAGCAAAAGGCCAGGAACCGTAAAAAG) and Asc-pGEXD (CCCGGCGCGCCGGGAAATGTGCGCGGAACCCC). DNA fragments were cut with NotI and AscI restriction enzymes and ligated together. A unique PstI site was then introduced at the end of the bla gene by site-directed mutagenesis. This plasmid was further modified by introducing pTrc promoter in front of the bla gene, NdeI restriction enzyme at the bla gene start codon and Trp terminator followed by the PstI site after the end of the bla gene.

Toe-printing assay

Toe-printing analysis (Hartz et al., 1988) was performed following in vitro coupled transcription-translation reactions in the PURE system (New England Biolabs) with no antibiotic or in the presence of 100 µM thiostrepton, NEG, VIO, KAN, or TET. Template for osmC was amplified from genomic DNA and overlapping PCR was used to generate RST2 (Orelle et al., 2013).

Translocation assay

Translocation assay was carried out using the phage T4 gene 32 template (m291) essentially as described by (Shoji et al., 2006) with minor modifications as described in (Polikanov et al., 2014a).

In vivo miscoding activity

The TGA stop codon was inserted between codons 109–110 of the bla gene of pBR322 using the QuikChange kit (Agilent Technologies) and the primer (CA CCA GTC ACA GAA AAG TAG CAT CTT ACG GAT GGC AT). The resulting plasmid pBR322bla-stop was transformed into E. coli TB-1 cells.

Cells containing pBR322bla-stop were grown at 37°C overnight in LB medium with selective antibiotics (TET 10 µg/mL and streptomycin 25 µg/mL). Culture was diluted to OD600 = 0.05 and allowed to reach late exponential phase (OD600 ~ 1). 1.5 mL of cell culture were mixed with 13.5 mL of soft agar and poured into rectangular LB agar plates which contained 25 µg/mL ampicillin or no antibiotic. Filter discs containing PAR (7.5 µg), NEG (30µg) or SPE (10µg) were placed on top of the solidified soft agar. Following overnight incubation at 37°C, plates were sprayed with a solution of nitrocefin (10 mg/mL in DMSO), incubated at room temperature for 2 hours, and photographed. The color of the entire image was adjusted to better visualize staining.

Determining the effect of TetM expression on resistance to NEG

Plasmid pET46LIC-TetM (kindly provided by Drs. Wilson and Starosta, Gene Center, University of Munich) or the empty vector pET11a were transformed into E. coli BL21 (DE3) cells. Following 1 h incubation at 37°C of the transformed culture in LB medium, ampicillin was added to a final concentration of 100 µg/mL, and incubation continued overnight. Cultures were then diluted to OD600 = 0.05 and upon reaching OD600 = 0.2, TetM expression was induced with 0.5 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG) and MICs for TET and NEG were determined.

Supplementary Material

1
2
Download video file (45.7MB, mov)

ACKNOWLEDGMENTS

We thank L. Smith for bringing the negamycin project to our attention and for editing the manuscript, P. Moore for valuable discussions and critical reading of the manuscript, D. Wilson and A. Starosta for providing the TetM-encoding plasmid, R.L. Grodzicki for preparation of the unmodified tRNAs and critical reading of the manuscript, and members of the A.S.M. and T.A.S. laboratories for discussions. We thank the staff at the Advanced Photon Source (beamline 24ID) and at the National Synchrotron Light Source (beamline X25) for help during data collection, and the staff at the Richards Center at Yale University for computational support. This work was supported by NIH grants GM106386 (A.S.M. and N.V.-L.), GM022778 (T.A.S.), an Intramural Research Grant (23-5) for Neurological and Psychiatric Disorder from the National Center of Neurology and Psychiatry and a Grant-in-Aid #25650106 from Ministry of Education, Culture, Sports, Science and Technology, Japan (to R.M.). The SPARK program of the Stevenson High School supported summer internship of F.J.

Footnotes

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

AUTHOR CONTRIBUTIONS

A.S.M, N.V.-L. and Y.S.P. devised experiments; R.M. and M.S. provided the antibiotic negamycin; P.G. designed the reporter system; Y.S.P., T.S., F.J. and A.S.M. performed the experiments, A.S.M., N.V.-L. and Y.S.P. analyzed the data; A.S.M, N.V.-L, Y.S.P. and T.A.S. wrote the manuscript.

ACCESSION NUMBERS

Coordinates and structure factors for the Tth 70S ribosome in complex with NEG were deposited in the RCSB Protein Data Bank with accession codes 4RBH, 4RBI, 4RBJ and 4RBK.

REFERENCES

  1. Allamand V, Bidou L, Arakawa M, Floquet C, Shiozuka M, Paturneau-Jouas M, Gartioux C, Butler-Browne GS, Mouly V, Rousset JP, et al. Drug-induced readthrough of premature stop codons leads to the stabilization of laminin alpha2 chain mRNA in CMD myotubes. J. Gene Med. 2008;10:217–224. doi: 10.1002/jgm.1140. [DOI] [PubMed] [Google Scholar]
  2. Arakawa M, Shiozuka M, Nakayama Y, Hara T, Hamada M, Kondo S, Ikeda D, Takahashi Y, Sawa R, Nonomura Y, et al. Negamycin restores dystrophin expression in skeletal and cardiac muscles of mdx mice. J. Biochem. 2003;134:751–758. doi: 10.1093/jb/mvg203. [DOI] [PubMed] [Google Scholar]
  3. Asai T, Zaporojets D, Squires C, Squires CL. An Escherichia coli strain with all chromosomal rRNA operons inactivated: complete exchange of rRNA genes between bacteria. Proc. Natl. Acad. Sci. USA. 1999;96:1971–1976. doi: 10.1073/pnas.96.5.1971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ben-Shem A, Garreau de Loubresse N, Melnikov S, Jenner L, Yusupova G, Yusupov M. The structure of the eukaryotic ribosome at 3.0 A resolution. Science. 2011;334:1524–1529. doi: 10.1126/science.1212642. [DOI] [PubMed] [Google Scholar]
  5. Blanchard SC, Gonzalez RL, Kim HD, Chu S, Puglisi JD. tRNA selection and kinetic proofreading in translation. Nat. Struct. Mol. Biol. 2004;11:1008–1014. doi: 10.1038/nsmb831. [DOI] [PubMed] [Google Scholar]
  6. Bollenbach T, Quan S, Chait R, Kishony R. Nonoptimal microbial response to antibiotics underlies suppressive drug interactions. Cell. 2009;139:707–718. doi: 10.1016/j.cell.2009.10.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Borovinskaya MA, Pai RD, Zhang W, Schuwirth BS, Holton JM, Hirokawa G, Kaji H, Kaji A, Cate JH. Structural basis for aminoglycoside inhibition of bacterial ribosome recycling. Nat. Struct. Mol. Biol. 2007a;14:727–732. doi: 10.1038/nsmb1271. [DOI] [PubMed] [Google Scholar]
  8. Borovinskaya MA, Shoji S, Holton JM, Fredrick K, Cate JH. A steric block in translation caused by the antibiotic spectinomycin. ACS Chem. Biol. 2007b;2:545–552. doi: 10.1021/cb700100n. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Brodersen DE, Carter AP, Clemons WM, Jr, Morgan-Warren RJ, Murphy FVt, Ogle JM, Tarry MJ, Wimberly BT, Ramakrishnan V. Atomic structures of the 30S subunit and its complexes with ligands and antibiotics. Cold Spring Harb. Symp. Quant. Biol. 2001;66:17–32. doi: 10.1101/sqb.2001.66.17. [DOI] [PubMed] [Google Scholar]
  10. Brodersen DE, Clemons WM, Jr, Carter AP, Morgan-Warren RJ, Wimberly BT, Ramakrishnan V. The structural basis for the action of the antibiotics tetracycline, pactamycin, and hygromycin B on the 30S ribosomal subunit. Cell. 2000;103:1143–1154. doi: 10.1016/s0092-8674(00)00216-6. [DOI] [PubMed] [Google Scholar]
  11. Carter AP, Clemons WM, Brodersen DE, Morgan-Warren RJ, Wimberly BT, Ramakrishnan V. Functional insights from the structure of the 30S ribosomal subunit and its interactions with antibiotics. Nature. 2000;407:340–348. doi: 10.1038/35030019. [DOI] [PubMed] [Google Scholar]
  12. Corchuelo MC, Herzog A, Desmarez L, Lavalle R, Bollen A. Resistance to the peptide-like antibiotic negamycin in Escherichia coli. Biochem. Biophys. Res. Commun. 1981;100:1497–1503. doi: 10.1016/0006-291x(81)90688-4. [DOI] [PubMed] [Google Scholar]
  13. Dailidiene D, Bertoli MT, Miciuleviciene J, Mukhopadhyay AK, Dailide G, Pascasio MA, Kupcinskas L, Berg DE. Emergence of tetracycline resistance in Helicobacter pylori: multiple mutational changes in 16S ribosomal DNA and other genetic loci. Antimicrob. Agents Chemother. 2002;46:3940–3946. doi: 10.1128/AAC.46.12.3940-3946.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dönhöfer A, Franckenberg S, Wickles S, Berninghausen O, Beckmann R, Wilson DN. Structural basis for TetM-mediated tetracycline resistance. Proc. Natl. Acad. Sci. USA. 2012;109:16900–16905. doi: 10.1073/pnas.1208037109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Douthwaite S, Powers T, Lee JY, Noller HF. Defining the structural requirements for a helix in 23S ribosomal RNA that confers erythromycin resistance. J. Mol. Biol. 1989;209:655–665. doi: 10.1016/0022-2836(89)93000-3. [DOI] [PubMed] [Google Scholar]
  16. Floquet C, Rousset JP, Bidou L. Readthrough of premature termination codons in the adenomatous polyposis coli gene restores its biological activity in human cancer cells. PLoS One. 2011;6:e24125. doi: 10.1371/journal.pone.0024125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gerrits MM, Berning M, Van Vliet AH, Kuipers EJ, Kusters JG. Effects of 16S rRNA gene mutations on tetracycline resistance in Helicobacter pylori. Antimicrob. Agents Chemother. 2003;47:2984–2986. doi: 10.1128/AAC.47.9.2984-2986.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gerrits MM, de Zoete MR, Arents NL, Kuipers EJ, Kusters JG. 16S rRNA mutation-mediated tetracycline resistance in Helicobacter pylori. Antimicrob. Agents Chemother. 2002;46:2996–3000. doi: 10.1128/AAC.46.9.2996-3000.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Griffey RH, Hofstadler SA, Sannes-Lowery KA, Ecker DJ, Crooke ST. Determinants of aminoglycoside-binding specificity for rRNA by using mass spectrometry. Proc. Natl. Acad. Sci. USA. 1999;96:10129–10133. doi: 10.1073/pnas.96.18.10129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hamada M, Takeuchi T, Kondo S, Ikeda Y, Naganawa H. A new antibiotic, negamycin. J. Antibiot. 1970;23:170–171. doi: 10.7164/antibiotics.23.170. [DOI] [PubMed] [Google Scholar]
  21. Hartz D, McPheeters DS, Traut R, Gold L. Extension inhibition analysis of translation initiation complexes. Methods Enzymol. 1988;164:419–425. doi: 10.1016/s0076-6879(88)64058-4. [DOI] [PubMed] [Google Scholar]
  22. Jenner L, Starosta AL, Terry DS, Mikolajka A, Filonava L, Yusupov M, Blanchard SC, Wilson DN, Yusupova G. Structural basis for potent inhibitory activity of the antibiotic tigecycline during protein synthesis. Proc. Natl. Acad. Sci. USA. 2013;110:3812–3816. doi: 10.1073/pnas.1216691110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Jerinic O, Joseph S. Conformational changes in the ribosome induced by translational miscoding agents. J. Mol. Biol. 2000;304:707–713. doi: 10.1006/jmbi.2000.4269. [DOI] [PubMed] [Google Scholar]
  24. Junemann R, Wadzack J, Triana-Alonso FJ, Bittner JU, Caillet J, Meinnel T, Vanatalu K, Nierhaus KH. In vivo deuteration of transfer RNAs: overexpression and large-scale purification of deuterated specific tRNAs. Nucleic Acids Res. 1996;24:907–913. doi: 10.1093/nar/24.5.907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Karimi R, Ehrenberg M. Dissociation rate of cognate peptidyl-tRNA from the A-site of hyper-accurate and error-prone ribosomes. Eur. J. Biochem. 1994;226:355–360. doi: 10.1111/j.1432-1033.1994.tb20059.x. [DOI] [PubMed] [Google Scholar]
  26. Laurberg M, Asahara H, Korostelev A, Zhu J, Trakhanov S, Noller HF. Structural basis for translation termination on the 70S ribosome. Nature. 2008;454:852–857. doi: 10.1038/nature07115. [DOI] [PubMed] [Google Scholar]
  27. Mikolajka A, Liu H, Chen Y, Starosta AL, Marquez V, Ivanova M, Cooperman BS, Wilson DN. Differential effects of thiopeptide and orthosomycin antibiotics on translational GTPases. Chem. Biol. 2011;18:589–600. doi: 10.1016/j.chembiol.2011.03.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mizuno S, Nitta K, Umezawa H. Mechanism of action of negamycin in Escherichia coli K12. I. Inhibition of initiation of protein synthesis. J. Antibiot. 1970a;23:581–588. [PubMed] [Google Scholar]
  29. Mizuno S, Nitta K, Umezawa H. Mechanism of action of negamycin in Escherichia coli K12. II. Miscoding activity in polypeptide synthesis directed by snythetic polynucleotide. J. Antibiot. 1970b;23:589–594. [PubMed] [Google Scholar]
  30. Nonaka L, Connell SR, Taylor DE. 16S rRNA mutations that confer tetracycline resistance in Helicobacter pylori decrease drug binding in Escherichia coli ribosomes. J. Bacteriol. 2005;187:3708–3712. doi: 10.1128/JB.187.11.3708-3712.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. O’Callaghan CH, Morris A, Kirby SM, Shingler AH. Novel method for detection of beta-lactamases by using a chromogenic cephalosporin substrate. Antimicrob. Agents Chemother. 1972;1:283–288. doi: 10.1128/aac.1.4.283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ogle JM, Ramakrishnan V. Structural insights into translational fidelity. Annu. Rev. Biochem. 2005;74:129–177. doi: 10.1146/annurev.biochem.74.061903.155440. [DOI] [PubMed] [Google Scholar]
  33. Orelle C, Carlson S, Kaushal B, Almutairi MM, Liu H, Ochabowicz A, Quan S, Pham VC, Squires CL, Murphy BT, et al. Tools for characterizing bacterial protein synthesis inhibitors. Antimicrob. Agents Chemother. 2013;57:5994–6004. doi: 10.1128/AAC.01673-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Peske F, Savelsbergh A, Katunin VI, Rodnina MV, Wintermeyer W. Conformational changes of the small ribosomal subunit during elongation factor G-dependent tRNA-mRNA translocation. J. Mol. Biol. 2004;343:1183–1194. doi: 10.1016/j.jmb.2004.08.097. [DOI] [PubMed] [Google Scholar]
  35. Pioletti M, Schlunzen F, Harms J, Zarivach R, Gluhmann M, Avila H, Bashan A, Bartels H, Auerbach T, Jacobi C, et al. Crystal structures of complexes of the small ribosomal subunit with tetracycline, edeine and IF3. EMBO J. 2001;20:1829–1839. doi: 10.1093/emboj/20.8.1829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Polikanov YS, Blaha GM, Steitz TA. How hibernation factors RMF, HPF, and YfiA turn off protein synthesis. Science. 2012;336:915–918. doi: 10.1126/science.1218538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Polikanov YS, Osterman IA, Szal T, Tashlitsky VN, Serebryakova MV, Kusochek P, Bulkley D, Malanicheva IA, Efimenko TA, Efremenkova OV, et al. Amicoumacin A inhibits translation by stabilizing mRNA interaction with the ribosome. Mol. Cell. 2014a;X:X–X. doi: 10.1016/j.molcel.2014.09.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Polikanov YS, Steitz TA, Innis CA. A proton wire to couple aminoacyl-tRNA accommodation and peptide bond formation on the ribosome. Nat. Struct. Mol. Biol. 2014b;21:787–793. doi: 10.1038/nsmb.2871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Purohit P, Stern S. Interactions of a small RNA with antibiotic and RNA ligands of the 30S subunit. Nature. 1994;370:659–662. doi: 10.1038/370659a0. [DOI] [PubMed] [Google Scholar]
  40. Ross JI, Eady EA, Cove JH, Cunliffe WJ. 16S rRNA mutation associated with tetracycline resistance in a gram-positive bacterium. Antimicrob. Agents Chemother. 1998;42:1702–1705. doi: 10.1128/aac.42.7.1702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Schlunzen F, Harms JM, Franceschi F, Hansen HA, Bartels H, Zarivach R, Yonath A. Structural basis for the antibiotic activity of ketolides and azalides. Structure. 2003;11:329–338. doi: 10.1016/s0969-2126(03)00022-4. [DOI] [PubMed] [Google Scholar]
  42. Schmitt E, Blanquet S, Mechulam Y. Crystallization and preliminary X-ray analysis of Escherichia coli methionyl-tRNAMet(f) formyltransferase complexed with formyl-methionyl-tRNAMet(f) Acta Crystallogr. Sect. D Biol. Crystallogr. 1999;55:332–334. doi: 10.1107/S0907444998011780. [DOI] [PubMed] [Google Scholar]
  43. Schroeder SJ, Blaha G, Moore PB. Negamycin binds to the wall of the nascent chain exit tunnel of the 50S ribosomal subunit. Antimicrob. Agents Chemother. 2007;51:4462–4465. doi: 10.1128/AAC.00455-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Shoji S, Walker SE, Fredrick K. Reverse translocation of tRNA in the ribosome. Mol. Cell. 2006;24:931–942. doi: 10.1016/j.molcel.2006.11.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Spahn CM, Blaha G, Agrawal RK, Penczek P, Grassucci RA, Trieber CA, Connell SR, Taylor DE, Nierhaus KH, Frank J. Localization of the ribosomal protection protein Tet(O) on the ribosome and the mechanism of tetracycline resistance. Mol. Cell. 2001;7:1037–1045. doi: 10.1016/s1097-2765(01)00238-6. [DOI] [PubMed] [Google Scholar]
  46. Taguchi A, Nishiguchi S, Shiozuka M, Nomoto T, Ina M, Nojima S, Matsuda R, Nonomura Y, Kiso Y, Yamazaki Y, et al. Negamycin analogue with readthrough-promoting activity as a potential drug candidate for duchenne muscular dystrophy. ACS Med. Chem. Lett. 2012;3:118–122. doi: 10.1021/ml200245t. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Uehara Y, Hori M, Kondo S, Hamada M, Umezawa H. Structure-activity relationships among negamycin analogs. J. Antibiot. 1976a;29:937–943. doi: 10.7164/antibiotics.29.937. [DOI] [PubMed] [Google Scholar]
  48. Uehara Y, Hori M, Umezawa H. Negamycin inhibits termination of protein synthesis directed by phage f2 RNA in vitro. Biochim. Biophys. Acta. 1974;374:82–95. doi: 10.1016/0005-2787(74)90201-9. [DOI] [PubMed] [Google Scholar]
  49. Uehara Y, Hori M, Umezawa H. Specific inhibition of the termination process of protein synthesis by negamycin. Biochim. Biophys. Acta. 1976b;442:251–262. doi: 10.1016/0005-2787(76)90495-0. [DOI] [PubMed] [Google Scholar]
  50. Uehara Y, Kondo S, Umezawa H, Suzukake K, Hori M. Negamycin, a miscoding antibiotic with a unique structure. J. Antibiot. 1972;25:685–688. doi: 10.7164/antibiotics.25.685. [DOI] [PubMed] [Google Scholar]
  51. Voorhees RM, Weixlbaumer A, Loakes D, Kelley AC, Ramakrishnan V. Insights into substrate stabilization from snapshots of the peptidyl transferase center of the intact 70S ribosome. Nat. Struct. Mol. Biol. 2009;16:528–533. doi: 10.1038/nsmb.1577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Voss NR, Gerstein M, Steitz TA, Moore PB. The geometry of the ribosomal polypeptide exit tunnel. J. Mol. Biol. 2006;360:893–906. doi: 10.1016/j.jmb.2006.05.023. [DOI] [PubMed] [Google Scholar]
  53. Wilson DN. The A–Z of bacterial translation inhibitors. Crit. Rev. Biochem. Mol. Biol. 2009;44:393–433. doi: 10.3109/10409230903307311. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS635946-supplement-1.pdf (5.5MB, pdf)
2
Download video file (45.7MB, mov)

RESOURCES