Skip to main content
PLOS One logoLink to PLOS One
. 2015 Feb 13;10(2):e0118165. doi: 10.1371/journal.pone.0118165

Putative Porcine Embryonic Stem Cell Lines Derived from Aggregated Four-Celled Cloned Embryos Produced by Oocyte Bisection Cloning

Chawalit Siriboon 1,2, Yu-Hsuan Lin 2, Michel Kere 2, Chun-Da Chen 2, Lih-Ren Chen 3, Chien-Hong Chen 4, Ching-Fu Tu 4, Neng-Wen Lo 5, Jyh-Cherng Ju 1,2,6,7,8,*
Editor: Austin John Cooney9
PMCID: PMC4334543  PMID: 25680105

Abstract

We attempted to isolate ES cell lines using inner cell masses from high-quality cloned porcine blastocysts. After being seeded onto feeders, embryos had better (P < 0.05) attachment, outgrowth formation and primary colonization in both 2× and 3× aggregated cloned embryos (62.8, 42.6 and12.8% vs. 76.2, 55.2 and 26.2%, respectively) compared to the non-aggregated group (41.6, 23.4 and 3.9%). Effects of feeder types (STO vs. MEF) and serum sources (FBS vs. KSR) on extraction of cloned embryo-derived porcine ES cells were examined. More (17.1%) ntES cell lines over Passage 3 were generated in the MEF/KSR group. However, ntES cells cultured in KSR-supplemented medium had a low proliferation rate with defective morphology, and eventually underwent differentiation or apoptosis subsequently. Approximately 26.1, 22.7 and 35.7% of primary colonies were formed after plating embryos in DMEM, DMEM/F12 and α-MEM media, respectively. Survival rates of ntES cells cultured in α-MEM, DMEM and DMEM/F12 were 16.7, 4.3 and 6.8%, respectively (P > 0.05). We further examined the beneficial effect of TSA treatment of 3× aggregated cloned embryos on establishment of ntES cell lines. Primary colony numbers and survival rates of ntES cells beyond passage 3 were higher (P < 0.05) in those derived from TSA-treated 3× blastocysts (36.7 and 26.7%) than from the non-treated aggregated group (23.1 and 11.5%). These cells, remaining undifferentiated over 25 passages, had alkaline phosphatase activity and expressed ES specific markers Oct4, Nanog, Sox2, and Rex01. Moreover, these ntES cells successfully differentiated into embryoid bodies (EBs) that expressed specific genes of all three germ layers after being cultured in LIF-free medium. In conclusion, we have successfully derived putative porcine ntES cells with high efficiency from quality cloned embryos produced by embryo aggregation, and optimized the ES cell culture system suitable for establishing and maintaining ntES cell lines in undifferentiated state.

Introduction

Embryonic stem (ES) cells, a pluripotent cell population with the capacity of self-renewal and differentiation into all body cell types and lineages, have great potential for use in regenerative medicine, research, and production of transgenic animals for xenotransplantation, e.g. the α-gal knockout pig [13]. Recently, ES or ES-like cells were derived from somatic cell nuclear transfer (SCNT) embryos in mice [4], rabbits [5], cattle [6], primates [7], and pigs [8,9]. The combination of SCNT and stem cell technology has numerous clinical applications in cell therapy and xenotransplantation, including mass-production of organs suitable for xenotransplantation [8].

Limited success of establishing porcine ntES cell lines is mainly attributed to the low efficiency of SCNT due to poor embryonic development, presumably as a result of incomplete cellular reprogramming and inadequate support from the in vitro culture system [10]. That the developmental potential of in vitro-derived blastocysts was lower than that of in vivo blastocysts [11,12], these cloned blastocysts had less total cell numbers and low ratio of inner cell mass (ICM) to trophectoderm (TE) cells than their in vivo counterparts [13]. Therefore, to improve cloning efficiency in pigs and to establish competent ntES cells, it is necessary to produce high-quality cloned blastocyst embryos. We previously reported that cloned porcine embryos treated with a histone deacetylation inhibitor (TSA) had enhanced histone acetylation and superior development compared to control embryos [14]. It is well known that reconstructed porcine embryos treated with TSA have an altered acetylation status of histone proteins, leading to enhanced reprogramming of the somatic genome and improved cloning efficiency [15,16].

The other crucial factor causing failure of embryo development is a suboptimal ratio of ICM and/or TE to total cell numbers [17,18]. However, in some studies, embryo aggregation improved embryo development in vitro [19]. Lee et al. [20] reported that aggregation of porcine embryos improved blastocyst rates, total cell numbers, and Oct4 expression. Similarly, we previously demonstrated that embryo aggregation improved developmental competency and the ratio of ICM to total cell numbers in cloned porcine embryos [29]. Although there were some claims that clone-clone aggregations did not improve embryo development in mice, it was noteworthy that total cell numbers and Oct4 expression levels were increased [21,22].

Putative porcine ES cells can be derived from early embryos, but they subsequently lose their pluripotency with repeated culture [2327]. In that regard, most of these ES-like cells lacking definitive pluripotency markers failed to maintain their undifferentiated status [27], perhaps due to suboptimal culture conditions, since a great majority of the cells did not survive expansion during long-term culture. It is noteworthy that successful establishment of ES cells by SCNT with subsequent production of germline chimeras has apparently only been reported for mice and cattle [4,28].

The aim of this study was to improve the efficiency of establishing ntES cell lines by aggregation of genetically identical clones at the four-cell stage. After determining the beneficial effects of embryo aggregation and TSA treatment of cloned embryos on establishment of ntES cell lines, culture conditions were optimized to maintain putative porcine ntES cell lines and their pluripotency.

Materials and Methods

Animal Use and Ovary Collection

Oocytes were all aspirated from the ovaries collected from a local abattoir, where pigs were slaughtered with an electric shock and with guideline tightly stipulated by governmental standard operation procedure. This study was carried out in strict accordance with the Guideline recommended and approved (Permit Number: 97–95) by the Institutional Animal Care and Use Committee (IACUC) of the National Chung Hsing University.

Production of Cloned and Parthenogenetic Embryos

Cumulus-oocyte complexes (COCs), aspirated from abattoir-derived ovarian follicles, were in vitro matured (IVM) in a 100-μL droplet of maturation medium (TCM 199 supplemented with 10% porcine follicular fluid and 10% FBS) containing gonadotropins (10 IU/mL hCG and 10 IU/mL PMSG) at 39°C under 5% CO2.

After IVM for 41 hours, matured oocytes with first polar body were incubated in 3.3 mg/mL pronase in HEPES-buffered TCM 199 supplemented with 33% fetal bovine serum (FBS) for 20 seconds and washed twice with HEPES-buffered TCM-199 (with 10% FBS; designated T10). After washing, oocytes were placed in 40 μL of T10 medium containing 2.5 mg/mL cytochalasin B (10 oocytes per droplet). For cloning with handmade cloning (HMC) or oocyte bisection technique (OBCT), oocytes were rotated with a fire-polished glass pipette to identify the membrane protrusion or first polar body for oriented bisection with a microblade, as described [29] under a stereomicroscope. After bisection, demi-ooplasts were washed twice in T10.

Cell fusion was performed with a two-step protocol consisting of two consecutive electric pulses. First, the enucleated cytoplast was transferred to the HEPES-TCM-199 droplet containing 1 mg/mL phytohaemagglutinin (PHA) for 5 seconds, and then moved to a T10 droplet holding fibroblasts. Each cytoplast was then allowed to pair with one fibroblast cell. The cytoplast-fibroblast pairs were incubated in the fusion medium (0.3 M mannitol and 0.01% PVA) for 20 seconds, and then transferred to the fusion chamber (two electrodes, 1 mm apart). Under a 0.6 kV/cm AC, cell pairs were aligned to the wire, with the fibroblasts farthest from the wire. Cell fusion was performed with one DC pulse at 2.0 kV/cm for 9 μseconds. The pairs were then transferred from the fusion chamber to the T10 drop and incubated for 1 hour before the second fusion.

For the second fusion, the remaining cytoplasts and the fused cytoplast-fibroblast pairs were transferred to the activation medium droplet (0.3 M mannitol, 0.1 mM MgSO4, 0.1 mM CaCl2 and 0.01% PVA) for equilibration. Then, they were aligned (0.6 kV/cm AC) with the fused pairs farthest from the wire, followed by a DC pulse (0.85 kV/cm) for 80 μseconds for the second fusion and initial activation. After elecrofusion and activation simultaneously, cytoplast-fibroblast triplets were incubated in T10 to allow complete fusion prior to chemical activation with 6-DMAP.

For production of parthenogenetic embryos, matured oocytes were activated by a DC pulse (2.2 kV/cm, 30 μseconds) in an activation chamber and then incubated in 6-DMAP for 4 hours under culture conditions as described [30].

Embryo Aggregation

After parthenogenetic activation, reconstructed embryos were washed three times with 200 μL porcine zygote medium-3 (PZM-3). Parthenogenetic and OBCT embryos were cultured individually for 2 days up to the four-cell stage in the WOW system covered with mineral oil at 39°C in an incubator containing 5% CO2 in air. Embryo aggregation was performed with the four-celled embryos, and aggregated embryos were cultured continuously for an additional 5 days

Preparation of STO and MEF Feeders

The STO fibroblasts were routinely cultured in DMEM supplemented with 10% FBS. Feeder cells were prepared using STO cells at less than 10 passages. After 80% confluency, the STO monolayers were exposed to 10 μg/mL mitomycin C (Sigma-Aldrich) for 2 hours, and then mitomycin C was washed off with PBS. Those STO cells were re-suspended in culture medium and seeded at a density of 0.8 × 105 cells/cm2 in four-well dishes pre-coated with 0.1% gelatin.

Mouse embryonic fetal fibroblasts (MEFs) were isolated from fetuses at 13.5 day post coitum. The head, legs, and internal organs were removed by forceps and scissors in a 500 μL drop of 1% ABAM/PBS. After washing twice with 1% ABAM/PBS, the carcass was minced into small pieces with a surgical blade. Minced fetal tissues were washed by centrifugation (300 ×g for 10 min) and subsequently seeded into culture dishes with DMEM supplemented with 10% FBS at 37°C for 5–7 days. Derived MEF cells were cultured in DMEM medium supplemented with 10% FBS and sub-cultured when cells proliferated up to 80% confluence. At passages 3 and 4, once MEFs reached 80% confluence, they were treated with 10 μg/mL mitomycin-C (Sigma-Aldrich) for 3 hours to arrest mitosis, washed several times with PBS, and re-plated (0.8 × 105 cells/well) in gelatin-coated, four-well culture dishes.

Inactivation of both STO and MEFs feeders was done 24 h before plating blastocysts or passaging pluripotent cell lines. Two hours before using the feeder cells, the medium was removed and replaced with pES cell medium.

Outgrowth Culture Conditions

On Day 7, OBCT-derived and PA blastocysts were transferred from the culture dish to 200 μL drops of 3% ABAM/PBS for several washings. Thereafter, blastocysts were seeded onto a four-well dish containing a feeder layers with ES cell medium, according to experimental designs. The ES cell medium was supplemented with 1 mM L-glutamine (Sigma-Aldrich), 0.1 mM β-mercaptoethanol (Sigma-Aldrich), 10 mM MEM non-essential amino acids (Sigma-Aldrich), 0.03 mM adenosine (Sigma-Aldrich), 0.03 mM guanosine (Sigma-Aldrich), 0.03 mM cytidine (Sigma-Aldrich), 0.03 mM uridine (Sigma-Aldrich), 0.01 mM thymidine (Sigma-Aldrich), antibiotics (50 units/mL penicillin G, and 50 mg/mL streptomycin sulfate: Invitrogen), 5 ng/mL basic FGF, 20 ng/mL human recombinant LIF, 10 μM ROCK inhibitor (Y-27632; 1596–5; Biovision, Milpitas, CA, USA), and protein sources were either 15% FBS (Invitrogen) or 20% knock out serum replacement (KSR). Blastocysts were cultured for 5–7 days at 38.5°C in a 5% CO2 incubator and culture medium replaced with fresh ES cell medium every second day. When a colony enlarged to its full dimension, primary outgrowths were mechanically removed using a sterile glass pipette, and were transferred to a 100 μL drop of fresh medium for cutting into small pieces (30–50 cells per piece) with a microblade (ESE020, Bioniche Animal Health, Inc., Pullman, WA, USA) and mechanical pipetting under a stereomicroscope. Pieces of cells were then passaged and cultured on freshly prepared feeder-layers.

Subculture, Freezing, and Thawing of ntES Cells

The ntES cell colonies were passaged every 8–10 days by picking up an individual undifferentiated ES cell colony and transferring it to 100 μL ES cell medium, where colonies were mechanically dissociated (microblade) into small pieces. The ES cell pieces were transferred and cultured onto new fresh feeders in pES cell medium. Medium was changed after 42 hours of culture and reattached ES cell colonies were examined.

Protocols for freezing and thawing of pES cells were as described [31]. Briefly, ES cell colonies were dissected into smaller pieces and suspended in 100 mL freezing medium, consisting of 10% dimethylsulfoxide (DMSO, Sigma-Aldrich) and 90% FBS, and then placed into a cryotube. The cryotubes were transferred to -20°C and kept for 4 hours, prior to preserving at -80°C overnight. On the following day, the cryotubes were directly plunged into -196°C liquid nitrogen for long-term storage. To thaw pES cells, cryotubes were removed from liquid nitrogen and submerged in a 37°C water bath for 30 seconds. The thawed cells were washed with 1 mL pES cell medium by centrifugation at 3,000 rpm for 3 minutes. Supernatant was removed and new fresh pES cell medium was added to re-suspend pES cells for plating on new feeders.

Pluripotency Marker Assay

Alkaline phosphate (AP) staining was determined as described [32]. After culture, plates were rinsed twice in PBS and fixed in 4% formaldehyde in PBS for 15 minutes at room temperature; fixed cells were washed twice with PBS and then stained in AP solution for 15–30 minutes (until color development occurred). The AP staining buffer (100 mM Tris-HCl, 100 mM NaCl, and 50 mM MgCl2, pH 9.5) consisted of 0.25 M trizma maleate (Sigma T3128), 0.008 M MgCl2 (Sigma M8266), 0.17 g/L Fast Red TR salt (Sigma F8764), and 0.4 g/L α-naphthyl phosphate (Sigma N7255). Stained cells were observed under an inverted microscope after washing with PBS.

To analyze specific marker gene expressions, putative ES cell colonies were rinsed twice with Dulbecco’s phosphate buffered saline (DPBS, Gibco 21600–010) and then fixed in 4% paraformaldehyde for 30 minutes at room temperature. After fixation, colonies were rinsed three times with DPBS for 3 minutes each, and the cells were made permeable in 0.3% Triton X-100 (Sigma X100)/DPBS for 1 hour, followed by three washings with DPBS prior to incubation with blocking solution (DPBS + 2% skimmed milk) for 1 hour. Putative ES cells were incubated with primary antibodies, anti-Oct4 (Chemicon; AB3209), anti-Nanog (Abcam; ab115589), and anti-Sox2 (Abcam; ab97959). All antibodies were diluted in blocking solution (1:200) and incubated with samples overnight at 4°C after an additional three washes with 0.05% Tween-20/DPBS (15 minutes/wash). After incubation with primary antibody, ES cells were washed three times with 0.05% Tween-20/DPBS and then incubated with secondary antibodies for Oct4 (Alexa Fluor 546-conjugated goat anti-rabbit IgG; Invitrogen), Nanog (Alexa Fluor 594-conjugated donkey anti-goat IgG; Invitrogen), and Sox2 (Alexa Fluor 546-conjugated goat anti-rabbit IgG; Invitrogen) for 1 to 2 hours. Finally, fluorescent dye DAPI (1 μg/mL) was added to DPBS for nuclear staining, followed by two washes with DPBS for epifluorescence microscopy.

Karyotyping

Chromosomes of established pES1 and pES3 cells were assessed at passages 20 and 25, respectively. The ES cells were incubated in medium supplemented with 0.5 μg/mL colchicine (Sigma Aldrich; C9754) overnight at 37°C in an incubator with 5% CO2 in air. After trypsinization and treatment with hypotonic KCl (0.56%) for 20 minutes, cells were placed in a hypotonic solution, fixed in a 3:1 (v/v) mixture of methanol and acetic acid, and spread on clean microscopic slides by gentle dropping. After staining with Giemsa (1:20 dilution; Sigma Aldrich) for 20 minutes, numbers of chromosomes were examined at ×1000 magnification.

Gene Expression Analysis of ntES Cells

A small aliquot of the cell suspension was isolated and subjected to Reverse Transcription Polymerase Chain Reaction (RT-PCR) for expressions of genes listed in Table 1. Total RNAs were extracted using a total RNA extraction kit (Geneaid RT050). Cytoplasmic RNAs from pES cells were reverse-transcribed to generate first-strand cDNA. For this, 20 μL of total RNA, to which 2 μL of DNase I, 3 μL of DNase I 10× buffer, 0.25 μL of RNasin, 4.75 μL of ddH2O were added and reacted at 37°C for 25 minutes. After the first step, 1 μL EDTA and oligo-(dT) was added to the tube and reacted at 70°C for 5 minutes. Then, 1 μL RT enzyme (Promega M289A), 10 μL RT 5× buffer, 0.25 μL RNasin, 1 μL dNTP, 2.5 μL MgCl2, 3.25 μL ddH2O were added to the reaction and incubated for 1 hour. Aliquoted cDNAs were stored at -20°C until used.

Table 1. Primer Sequences and Related Information for PCR Analyses.

Target genes Primers Sequences (5’-3’) Annealing temperature (°C) Product size (bp)
Oct4 Forward agtgagaggcaacctggaga 55 166
Reverse tcgttgcgaatagtcactgc
Nanog Forward ttccttcctccatggatctg 56 214
Reverse atctgctggaggctgaggta
Sox2 Forward gccctgcagtacaactccat 61 216
Reverse gctgatcatgtcccgtaggt
Rex01 Forward cttcaaggagagcgcaaaac 52 299
Reverse tgtccccaatcaaaaatgct
GATA4 Forward ctcagaaggcagagagtgtg 59 281
Reverse ccgcattgcaagaggcctgg
BMP-4 Forward tgagcctttccagcaagttt 60 180
Reverse cttccccgtctcaggtatca
β-III tubulin Forward ttccagctcacccactctct 52 214
Reverse tgtcgatgcagtaggtctcg
β-actin Forward tgaaccctaaggccaaccgtg 60 267
Reverse tgtagccacgctcggtcagga

For PCR, a total volume of 25 μL reaction solution containing 2 μL of the RT reaction mix were added along with 18.7 μL of ddH2O, 2.5 μL of 10× PCR buffer (2.5 mM MgCl2), 0.5 μL of dNTPs (10 mM each; Fermentas R0182), 0.3 μL of Taq DNA polymerase (5 U/μL, Geneaid), 0.5 μL forward primer (10 μM), and 0.5 μL reverse primer (10 μM). The PCR was done by specific primer sets derived from the GenBank database. Primer sequences including sense and antisense, annealing temperatures used in the PCR reactions, and the expected product size are listed (Table 1). An aliquot (4–10 μL) of PCR products were separated on a 1.5% agarose gel and visualized under UV light after ethidium bromide staining.

Differentiation of pES Cells

For derivation of embryoid bodies (EBs), cells were cultured in pES cell medium without LIF and bFGF. The medium was refreshed daily for 10 days. Differentiation of EBs was confirmed, through RT-PCR screening for expression of markers (Table 1) associated with mesoderm (Bone Morphogenetic Protein-4, BMP-4), ectoderm (β-III tubulin) and endoderm (GATA4).

For spontaneous in vitro differentiation, day 7 EBs were mechanically dissociated and cells were plated directly onto gelatin-coated 4-well dishes in ES cell medium without inhibitors for adherent and spontaneous differentiation. After one week, cells were subjected to immunocytochemical analysis for embryonic germ layer lineages of the differentiated EB and were screened for the presence of differentiation markers: troponin I (for mesoderm; GeneTex; GTX113028), neurofilament light (NFL, for ectoderm; Millipore; AB9568), cytokeratin (for ectoderm; Sigma; C-2562), and α-fetoprotein (AFP, for endoderm; Santa Cruz; SC-8108).

Experimental Designs

To determine optimal conditions for in vitro culture of porcine ICM cells, a series of experiments were conducted, as follows:

Experiment 1: Competency of Aggregated Cloned and PA Porcine Blastocysts for Derivation of ES Cell Colonies. Blastocysts were derived from aggregated OBCT embryos (1×, one-embryo; 2×, two-embryo aggregation; 3×, three-embryo aggregation) and 3× PA embryos at Day 7 of in vitro culture. After being washed four times with 3% ABAM in PBS, they were seeded onto mitomycin C-inactivated mouse STO feeder cells in a four-well culture dish containing ES cell medium (DMEM medium supplemented with 1 mM L-glutamine, 0.1 mM b-2-mercaptoethanol, 10 mM MEM nonessential amino acids, 0.03 mM adenosine, 0.03 mM guanosine, 0.03 mM cytidine, 0.03 mM uridine, 0.01 mM thymidine, 50 units/mL penicillin G, 50 mg/mL, 20 ng/mL bFGF, 20 ng/mL human recombinant LIF (hLIF), streptomycin, and 15% FBS). Blastocysts were cultured for 5–7 days to derive primary outgrowths and colonies.

Experiment 2: Competency of Aggregated Cloned Blastocysts for Derivation of ES Cells Cultured with Various Feeder Cells and Sera. Two feeder cells were used for culture of 3× cloned embryos to derive primary outgrowths and ES cell colonies. Thereafter, 3× cloned Day-7 embryos were either seeded onto mitomycin C-inactivated STO cells or MEF feeders in a four-well dish containing ES cell medium (DMEM medium supplemented with either 15% FBS or 20% KSR). Blastocysts were cultured for 5–7 days to derive primary outgrowths and colonies.

Experiment 3: Competency of Aggregated Cloned Blastocysts to Derive ES Cell Lines in Various Culture Media. Three culture media (DMEM, DMEM/F12 and alpha-MEM) were tested in this experiment. First, 3× cloned embryos of Day 7 were cultured onto mitomycin C-inactivated MEF feeder cells in a four-well culture dish containing DMEM, DMEM/F12 or α-MEM ES cell medium supplemented with 15% FBS. After 5–7 days of culture, numbers of primary outgrowths and ES cell colonies were observed and recorded.

Experiment 4: Effect of TSA Treatment on Establishment of ntES Cell Lines. In this experiment, 3× aggregated cloned blastocysts derived from TSA-treatment (for 24 hours) and non-treated embryos after activation were used to derive ntES cell lines, which were considered as being established if they survived repeated passaging and freezing. These ES cells were characterized by expressions of alkaline phosphatase activity, pluripotency marker genes (Oct4, Nanog, Sox2, and Rex01), and differentiation capacity.

Statistical Analyses

All data were subjected to analysis of variance (ANOVA) using the General Linear Model (GLM) procedure in SAS, Version 9 (SAS Institute, Cary NC, USA), followed by Tukey’s test. Percentile data were arcsine-transformed before ANOVA and differences between treatment groups at P < 0.05 was considered significant.

Results

Experiment 1: Competency of Aggregated Cloned and PA Porcine Blastocysts for Derivation of ES Cell Colonies

Day-7 aggregated embryos derived by OBCT and PA processes (Fig. 1A-B) were tested for their ability to form outgrowths and primary ES cell colonies. Attached embryos in 2× and 3× aggregated groups (62.8 and 76.2%, respectively) performed better (P < 0.05) than those of 1× and 3×PA group (41.6 and 44.3%, respectively; Table 2). Outgrowths and primary colonies were detected 5–8 days after initial seeding. Similarly, more outgrowths were formed in 2× and 3× aggregated (42.6 and 55.2%, respectively) groups than those in 1× and 3×PA groups (23.4 and 25.3%; P < 0.05). In addition, 12.8 to 26.2% of primary colonies were observed in 2× and 3× groups, higher than those from 1× group (3.9%), but similar to that of 3×PA group (13.9%). The putative porcine ES cells had typical ES cell morphology, with compact colonies and distinct borders (Fig. 2B-C). However, most of the colonies only maintained typical ES morphology for one or two passages and then either differentiated or degenerated. However, five ES cell lines derived from the 3× group maintained proliferation without differentiation beyond three passages (Table 2).

Fig 1. Morphologies of aggregated cloned and PA blastocyst embryos.

Fig 1

(a) Day-7 cloned porcine blastocysts produced by OBCT and embryo aggregation. 1×: single cloned embryo; 2×: two cloned embryos were aggregated in a well, and 3×: three cloned embryos were aggregated in a well. (b) Day-7 3× aggregated porcine parthenogenetic embryos. Scale bar = 100 μm.

Table 2. Competency of Aggregated Cloned and Parthenogenetic (PA) Porcine Blastocysts for Derivation of ES Cell Colonies.

Aggregated embryos No. embryos Primary colonies No. lines > passage 3 (%)
Total embryos Attached embryos (%) Outgrowth (%)
77 32 (41.6) b 18 (23.4) b 3 (3.9) c 0
94 59 (62.8) a 40 (42.6) a 12 (12.8) b 0
172 131 (76.2) a 95 (55.2) a 45 (26.2) a 5 (2.9)
3×PA 79 35 (44.3) b 20 (25.3) b 11 (13.9) a b 0

Number of replicates = 12

a-cWithin a column, means without a common superscript differed (P < 0.05).

1× = one OBCT cloned embryo was cultured in a well; 2× = two OBCT cloned embryos were aggregated in a well; 3× = three OBCT cloned embryos were aggregated in a well; 3×PA = three PA embryos were aggregated in a well

Fig 2. Formation of ntES cell colonies derived from the blastocyst embryos of the 3× cloned embryos.

Fig 2

(a) A 3× blastocyst embryo (day 7) and (b) embryonal outgrowths with clearly ICM cells (red arrow) after culture for 5–8 days. (c) Typical morphology of a putative porcine ntES cell colony after passage. Scale bar = 100 μm.

Experiment 2: Competency of Aggregated Cloned Blastocysts for Derivation of ES Cells Cultured with Various Feeder Cells and Sera

We further investigated the effects of various feeder cells and types of serum on deriving primary outgrowths and ES cell colonies. The Day-7 3× OBCT embryos were either seeded onto mitomycin C-inactivated mouse STO cells or MEF feeder cell layers in a four-well culture dish with ES cell medium (DMEM medium supplemented with either 15% FBS or 20% KSR). Various feeders and sera had no effect (P > 0.05) on ES cell establishment efficiency in terms of embryo attachment, outgrowths, and primary colony formation. More ES-like cell lines proliferated beyond passage 3 (17.1%) in MEF feeders and in ES cell medium supplemented with 20% KSR (Table 3). However, ES-like cell cultured in the medium supplemented with KSR had compromised pluripotency, defective morphology, and eventually became differentiated or subsequently died.

Table 3. Competency of Aggregated Cloned Blastocysts for Derivation of ES Cells Cultured on Different Feeder Cells with Sera.

Feeder cells Serum* No. embryos Primary colonies No. more than passage 3 (%)
Total embryos Attached embryos (%) Outgrowth (%)
STO FBS 39 30 (76.9) 24 (61.1) 18 (46.2) 1 (2.6)
KSR 37 22 (59.5) 15 (40.5) 11 (29.7) 3 (8.1)
MEF FBS 36 28 (77.8) 21 (58.3) 17 (47.2) 2 (5.6)
KSR 35 19 (54.3) 16 (45.7) 12 (34.3) 6 (17.1)

Number of replicates = 7

*ES cell medium was supplemented with 15% FBS or 20% KSR

Experiment 3: Competency of Aggregated Cloned Blastocysts to Derive ES Cell Lines in Various Culture Media

Effects of various culture media on the growth of porcine ICM cells were compared (Table 4). There were no differences (P > 0.05) among treatment groups in embryo attachment rate, outgrowths, and primary colony formation. Percentages of ES-like cell lines beyond passage 3 in DMEM, DMEM/F12, and α-MEM medium were 4.3, 6.8, and 16.7%, respectively.

Table 4. Competency of Aggregated (3×) Cloned Porcine Blastocysts to Derive ES Cell Lines in Various Culture Media.

Medium No. embryos Primary colonies No. more than passage 3 (%)
Total embryos Attached embryos (%) Outgrowth (%)
DMEM 46 25 (54.3) 18 (39.1) 12 (26.1) 2 (4.3)
DMEM/F12 44 24 (54.5) 17 (38.6) 10 (22.7) 3 (6.8)
α-MEM 42 26 (61.9) 18 (42.9) 15 (35.7) 7 (16.7)

Number of replicates = 7

Experiment 4: Effect of TSA Treatment in 3× Aggregated Embryos on Derivation of Porcine ntES Cell Lines

The effect of TSA treatment in 3× aggregated embryos on the establishment of ntES-like cells is shown in Table 5. There was no difference in the efficiency with which outgrowth formation could be established from the TSA-treated blastocysts compared to the control (38.5 and 46.7%, respectively; P > 0.05). Primary outgrowths from the cloned embryos started to develop 4–6 days after plating onto MEF layers. Over the next 8–10 days, these colonies grew to 2–5 mm in diameter without changes in their morphology. The primary colony formation rate was greater (P < 0.05) in the TSA-treated group (36.7%) than the control (23.1%). Eight of the 11 (26.7% of plated embryos) primary colonies obtained from 30 TSA-treated 3× aggregated cloned embryos survived repeated passaging and freezing, and continued to grow without apparent changes in their morphology, thereby outperforming the control (11.5%, P < 0.05).

Table 5. Effect of TSA Treatment in 3× Aggregated Embryos on the Establishment of Putative Porcine ntES-Like Cell Lines.

TSA (30 nM) Total embryos Primary outgrowth (%) Primary colonies (%) No. survived beyond passage 3 (%)
- 26 10 (38.5) 6 (23.1) b 3 (11.5) b
+ 30 14 (46.7) 11 (36.7) a 8 (26.7) a

Number of replicates = 4

a,bWithin a column, means without a common superscript differed (P < 0.05).

The ES-like cell colonies also had typical ES cell morphology including densely packed, small and round nuclei with well-defined boundaries and expression of AP activity (Fig. 3). Based on immunofluorescence staining and RT-PCR analysis, our ES-like cell colonies consisted entirely of those cells expressing Oct4, Nanog, Sox2, and Rex01 (Figs. 4 and 5).

Fig 3. Alkaline phosphatase (AP) activity and karyotypes of ntES cells derived from aggregated cloned blastocysts.

Fig 3

(a) A phase-contrast image of ntES cell colony with positive AP activity at passage 3. (b) Karyotyping by Giemsa staining of ntES cell line PES1 at passage 20 with 75% of normal karyotype, and (c) PES3 line at passage 28 with a normal karyotype ratio of 85%. Scale bar = 100 μm.

Fig 4. Immunofluorescence staining of pluripotency markers in ntES cell colonies derived from aggregated cloned embryos.

Fig 4

Expressions of pluripotency markers (Oct4, Nanog and Sox2) are shown (red) in PES3 at passage 15 (left panel) and PES1 at passage 10 (right panel). Nuclei are stained with DAPI (blue). Scale bars = 100 μm.

Fig 5. Characterization of ntES cells by real time RT-PCR analysis.

Fig 5

Expressions of Oct4, Nanog, Sox2, and Rex01genes in (A) PES1 at passages 8, (B) PES3 at passages 15 and (C) pig fibroblast cells.

When the ES cells were cultured for 10 days on plastic petri dishes, cystic embryoid bodies formed (Fig. 6A). Expression levels of several ES cell specific genes of three embryonic germ layer cells were assessed for 10-day-old embryoid bodies. The mRNA transcripts of mesoderm (BMP-4), ectoderm (β-III tubulin) and endoderm (GATA4) were detected by RT-PCR (Fig. 6B). In addition, when day 7 EBs (Fig. 7A) were disaggregated and grown in gelatin-coated surface, they attached to culture dishes (Fig. 7B) after one day of culture. Some neuron-like cells showed obvious Nissl bodies (Fig. 7C) after cultured for 3 days, but became more epithelial cell-like morphology (Fig. 7D) after cultured for 7 days. Other cells showed the expression of troponin I, NFL, cytokeratin and AFP (Fig. 7E-H), respectively, indicating that subpopulations of cells representative of all three germ layers could be obtained.

Fig 6. Differentiation of ntES cells in embryoid bodies (EB) and RT-PCR detection of genes typical for three germ layers.

Fig 6

(a) Light microscopic images of EB cultured for 10 days. (b) Expressions of the genes representing all three germ layers, GATA4 (endoderm), β-III tubulin (ectoderm), and BMP-4 (mesoderm) in EB derived from PES1 (A), PES3 (B), and the negative control is represented by undifferentiated PES3 cells (C). Scale bars = 100 μm.

Fig 7. In vitro differentiation ability of porcine ntES cells after induction of EB formation.

Fig 7

(a) Light microscopic images of EB cultured for 7 days. (b) EB attachment to gelatin-coated surface of culture dishes. (c) The neuron-like cells with obvious Nissl bodies after cultured for 3 days. (d) The epithelial-like cells morphology after cultured for 7 days. (e-h) Confirmation of the expression of differentiation marker troponin I (mesoderm), NFL and cytokeratin (ectoderm), and AFP (endoderm) from differentiated cells by the immunocytochemical analysis. Scale bars = 100 μm.

Discussion

The objective of the present study was to optimize production and culture conditions supporting primary culture of porcine ICM cells and stably passaged ES cell lines derived from cloned blastocysts. It is noteworthy that the success of establishing putative porcine ES cell lines is affected by several factors, including sources of embryos, ICM isolation methods, feeder cells, culture conditions, and culture media [3339]. To establish putative porcine ES cell lines, blastocyst quality is among the most crucial factors affecting outgrowth and colony formation. Although porcine blastocysts have been produced with SCNT [14,15], in general, their quality was inferior to those produced in vivo. In this study, embryo aggregation technique provided the efficiency and quality to establishment of ntES cells, including embryo attachment rates, outgrowths, and primary colonies which explained that aggregation-derived blastocysts had enhanced cell-cell communication and thus facilitated development of outgrowths and also expression of pluripotency marker Oct4 of the established ntES cells [21]. Consistently, outgrowth formation was observed after culture of aggregated porcine-canine interspecies embryos onto feeder cells in ES cell medium [40]. Moreover, mouse parthenote (PA)-derived ES cells were established by aggregating PA embryos at the eight-cell stage [41].

The effects of feeders, sera, and media on putative porcine ES cell culture have been widely studied. It is generally agreed that ES cell lines established from different labs had diverse adaption to different culture conditions. In addition to providing options of culture systems from lab to lab, any subtle changes of potential factors affecting the outcome are worth to be re-examined and confirmed in a new system. Therefore, in this present study we attempted to derive and to optimize ES cell culture system by testing several crucial factors such as feeders, sera and media. The feeder cell is among the well-known essential factors for both establishment and maintenance of ES cell lines. One of the most important functions of feeders is to serve as an attachment matrix for cells and to secrete cytokines, e.g. LIF and other paracrine factors that may stimulate ES cell growth and inhibit differentiation [42]. In the present study, we demonstrated that the establishment of putative ES cell lines was more efficient on MEF than on STO feeders. This could be described that culture of putative porcine ES cells on STO feeders had a low attachment rate with less primary colony formation; furthermore, the majority of the cultured cells became differentiated after passaging [25,43]. According to Ropeter et al. [44], MEFs were better feeder cells for culturing ES cells which yielded more passages of putative ES cell lines. In addition, porcine embryonic fibroblast (PEF) cells and were also better than the STO feeders [42]. This phenomenon could be attributed to the reduced secreting activity of STO, since fewer microtubular structures were present in the STO cells [42]. Putative porcine ES cell lines have been derived by culturing cloned blastocysts onto MEF feeders for various passages [8,9]. Nevertheless, in some studies, STO feeder cells were also used to culture putative porcine ES cells derived from fertilized embryos for more than 10 passages [31,45].

It has been widely reported that FBS is beneficial to maintaining the morphology and pluripotency state of pig ES cells [31,38,46]. However, Goldsborough et al. (1998) also reported that FBS contained some major factors causing differentiation of ES cell lines. Recently, several studies have demonstrated that the defined serum-free supplement or knockout serum replacement (KSR) can be used to maintain ES cells in an undifferentiated state [8,9]. However, in the present study, there was no difference observed in the efficiency of deriving ES cell when embryos were plated in ES cell culture medium supplemented with either FBS or KSR. However, putative ES cells cultured in the medium supplemented with KSR showed a lower pluripotency marker expression, defective morphologies, and were readily differentiated during subsequent passages.

Although murine ES cells have been well-established, the culture system for putative porcine ES cells has apparently not been optimized [25,31,42,43,45,4750]. Strojek et al. [51] reported that DMEM with 10% FCS yielded best results for ES cell establishment, although none of those cells were successfully subcultured for beyond five passages. Another study reported that two putative porcine ES cell lines were established using cloned porcine blastocysts cultured in DMEM/F12 supplemented with 20% KSR, which maintained the ES cells undifferentiated over 52 passages [8]. In the present study, various basal media (DMEM, DMEM/F12, and α-MEM) were compared using cloned and aggregated embryos produced by OBCT for ES cell derivation. We established ES cell lines in all three media tested, with α-MEM media having the greatest efficiency (16.7%, no. ES cell more than passage 3). In addition, we also used TSA in our cloning procedure to produce quality blastocysts for isolation of ES cell lines, as it enhanced blastocyst development of cloned embryos [14]. Previous work in mice and pigs also suggested that TSA could increase ES cell derivation rates in cloned embryos [9,52]. In the present study, higher proportions of ES cell lines were obtained from TSA-treated embryos (26.7%) compared to the untreated group (11.5%). This may be, at least in part, associated with the improved quality of cloned embryos, which was also supported by a recent study in human ntES cells (Tachibana et al., 2013). In their study, a human ntES cell line was derived from two high-quality oocytes donated by healthy volunteers [53].

In total, 11 cell lines were established in this study, of which the PES3 (derived from TSA-treated embryos) and PES1 (from control embryos) propagated rapidly with normal colony morphology upon repeated passaging. These cells expressed pluripotency marker genes (Oct4, Nanog, Sox2, and Rex01), and readily formed embryoid bodies in suspension culture, with the expression of genes representing all three germ layers (endoderm: GATA4; mesoderm: BMP-4; ectoderm: β-III tubulin). Moreover, the EB derived-differentiated cells exhibited various types of morphologies and expressed cell lineages of all three germ layers. Unfortunately, although teratoma formation is regarded as one of an essential pluripotency characteristics of ES cells, we failed to obtain teratomas after cell transfer into SCID mice (five replicates, 3–5×106 morphologically undifferentiated ES cells), indicating these ES cell lines may not be sufficiently competent to become germline transmissible (data not shown). However, to date, there is no report of teratoma formation using pluripotent cell lines derived from either cloned or non-cloned porcine embryos. For instance, putative porcine ES cells generated by Anderson et al. (1996) failed to form teratomas via transplantation into the kidney capsule of athymic mice [54]. Recently, subcutaneously injection of porcine ES cells into non-obese diabetic/severe combined immunodeficient (NOD/SCID) mice were also unable to demonstrate teratoma formation [55]. Similarly, Kim et al. [8] reported that transplanted porcine ntES cells did not form teratomas in immuno-compromised mice, indicating more studies are required to derive truly pluripotent ntES cells in pigs, most likely by the use of small molecule signaling inhibitors or forced expression of pluripotency-related genes, such as Oct4, Sox2, Klf4, and c-Myc [5659].

In conclusion, we have first successfully established and improved the efficacy of establishing putative porcine ES cell lines (pES1 and pES3 cells) using ICMs of quality blastocysts produced by OBCT and embryo aggregation. These cells can maintain undifferentiation and display typical ES cell pluripotency markers, EB forming capacity and differentiation into cell lineages of three germ layers. This report provides a new method to improve the efficiency of establishing ES cell lines which is of use in both agricultural and biomedical research. Nevertheless, it warrants more work to improve the quality of ES cell lines established, possibly by reversing these cells to their naïve status.

Acknowledgments

This study was supported in part by grants from China Medical University Hospital (DMR-103-104), the National Science Council (NSC# 96-2313-B-005-013, NSC# 98-2628-B005-019-MY3, and NSC# 101-2313-B-005-013-MY3), Executive Yuan and the Ministry of Education, Taiwan, Republic of China, under the ATU plan. We are also grateful to Dr. John Kastelic, Professor, University of Calgary, Canada, for his critical reading and suggestions to improve this manuscript.

Data Availability

All relevant data are within the paper.

Funding Statement

This study was supported in part by grants from China Medical University Hospital (DMR-103-104), the National Science Council (NSC# 96-2313-B-005-013, NSC# 98-2628-B005-019-MY3, and NSC# 101-2313-B-005 -013 -MY3), Executive Yuan and the Ministry of Education, Taiwan, Republic of China, under the ATU plan. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Lai L, Kolber-Simonds D, Park KW, Cheong HT, Greenstein JL, Im GS, et al. (2002) Production of alpha-1, 3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science 295: 1089–1092. [DOI] [PubMed] [Google Scholar]
  • 2. Chen G, Qian H, Starzl T, Sun H, Garcia B, Wang X, et al. (2005) Acute rejection is associated with antibodies to non-Gal antigens in baboons using Gal-knockout pig kidneys. Natural Medicine 11: 1295–1298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Yamada K, Yazawa K, Shimizu A, Iwanaga T, Hisashi Y, Nuhn M, et al. (2005) Marked prolongation of porcine renal xenograft survival in baboons through the use of alpha1,3-galactosyltransferase gene-knockout donors and the cotransplantation of vascularized thymic tissue. Natural Medicine 11: 32–34. [DOI] [PubMed] [Google Scholar]
  • 4. Wakayama T, Tabar V, Rodriguez I, Perry AC, Studer L, Mombaerts P (2001) Differentiation of embryonic stem cell lines generated from adult somatic cells by nuclear transfer. Science 292: 740–743. [DOI] [PubMed] [Google Scholar]
  • 5. Fang ZF, Gai H, Huang YZ, Li SG, Chen XJ, Shi JJ, et al. (2006) Rabbit embryonic stem cell lines derived from fertilized, parthenogenetic or somatic cell nuclear transfer embryos. Experimental Cell Research 312: 3669–3682. [DOI] [PubMed] [Google Scholar]
  • 6. Wang L, Duan E, Sung LY, Jeong BS, Yang X, Tian XC (2005) Generation and characterization of pluripotent stem cells from cloned bovine embryos. Biology of Reproduction 73: 149–155. [DOI] [PubMed] [Google Scholar]
  • 7. Byrne JA, Pedersen DA, Clepper LL, Nelson M, Sanger WG, Gokhale S, et al. (2007) Producing primate embryonic stem cells by somatic cell nuclear transfer. Nature 450: 497–502. [DOI] [PubMed] [Google Scholar]
  • 8. Kim S, Kim JH, Lee E, Jeong YW, Hossein MS, Park SM, et al. (2010) Establishment and characterization of embryonic stem-like cells from porcine somatic cell nuclear transfer blastocysts. Zygote 18: 93–101. 10.1017/S0967199409990372 [DOI] [PubMed] [Google Scholar]
  • 9. Vassiliev I, Vassilieva S, Truong KP, Beebe LF, McIlfatrick SM, Harrison SJ, et al. (2011) Isolation and in vitro characterization of putative porcine embryonic stem cells from cloned embryos treated with trichostatin A. Cellular Reprogramming 13: 205–213. 10.1089/cell.2010.0102 [DOI] [PubMed] [Google Scholar]
  • 10. Pratt SL, Sherrer ES, Reeves DE, Stice SL (2006) Factors influencing the commercialization of cloning in the pork industry. Society of Reproduction and Fertility supplement 62: 303–315. [PubMed] [Google Scholar]
  • 11. Thompson JG (1997) Comparison between in vivo derived and in vitro produced pre-elongation embryos from domestic ruminants. Reproduction, Fertility and Development 9: 341–354. [DOI] [PubMed] [Google Scholar]
  • 12. Wang WH, Abeydeera LR, Han YM, Prather RS, Day BN (1997) Morphologic evaluation and actin filament distribution in porcine embryos produced in vitro and in vivo . Journal of Reproduction and Fertility 111: 101–108. [DOI] [PubMed] [Google Scholar]
  • 13. Koo DB, Kang YK, Park JS, Park JK, Chang WK, Lee KK, et al. (2004) A paucity of structural integrity in cloned porcine blastocysts produced in vitro . Theriogenology 62: 779–789. [DOI] [PubMed] [Google Scholar]
  • 14. Chawalit S, Nguyen NT, Tseng JK, Lo NW, Tu CF, Ju JC (2012) Trichostatin A and ascorbic acid assist in the development of porcine handmade cloned embryos via different physiologic pathways. Reproductive Science 19: 976–986. 10.1177/1933719112440049 [DOI] [PubMed] [Google Scholar]
  • 15. Li J, Svarcova O, Villemoes K, Kragh PM, Schmidt M, Bogh IB, et al. (2008) High in vitro development after somatic cell nuclear transfer and trichostatin A treatment of reconstructed porcine embryos. Theriogenology 70: 800–808. 10.1016/j.theriogenology.2008.05.046 [DOI] [PubMed] [Google Scholar]
  • 16. Cervera RP, Martí-Gutiérrez N, Escorihuela E, Moreno R, Stojkovic M (2009) Trichostatin A affects histone acetylation and gene expression in porcine somatic cell nucleus transfer embryos. Theriogenology 72: 1097–1110. 10.1016/j.theriogenology.2009.06.030 [DOI] [PubMed] [Google Scholar]
  • 17. Giles JR, Foote RH (1995) Rabbit blastocyst: Allocation of cells to the inner cell mass and trophectoderm. Molecular Reproduction and Development 41: 204–211. [DOI] [PubMed] [Google Scholar]
  • 18. Macháty Z, Prather RS (1998) Strategies for activating nuclear transfer oocytes. Reproduction, Fertility and Development 10: 599–613. [DOI] [PubMed] [Google Scholar]
  • 19. Tang PC, West JD (2000) The effects of embryo stage and cell number on the composition of mouse aggregation chimaeras. Zygote 8: 235–243. [DOI] [PubMed] [Google Scholar]
  • 20. Lee SG, Park CH, Choi DH, Kim HS, Ka HH, Lee CK (2007) In vitro development and cell allocation of porcine blastocysts derived by aggregation of in vitro fertilized embryos. Molecular Reproduction and Development 74: 1436–1445. [DOI] [PubMed] [Google Scholar]
  • 21. Boiani M, Eckardt S, Leu NA, Schöler HR, McLaughlin KJ (2003) Pluripotency deficit in clone overcome clone–clone aggregation: Epigenetic complementation? EMBO Journal 22: 5304–5312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Terashita Y, Sugimura S, Kudo Y, Amano R, Hiradate Y, Sato E (2011) Improving the quality of miniature pig somatic cell nuclear transfer blastocysts: aggregation of SCNT embryos at the four-cell stage. Reproduction in Domestic Animals 46: 189–196. 10.1111/j.1439-0531.2010.01614.x [DOI] [PubMed] [Google Scholar]
  • 23. Moore K, Piedrahita JA (1997) The effects of human leukemia inhibitory factor (hLIF) and culture medium on in vitro differentiation of cultured porcine inner cell mass (pICM). In Vitro Cellular & Developmental Biology-Animal 33: 62–71. [DOI] [PubMed] [Google Scholar]
  • 24. Miyoshi K, Taguchi Y, Sendai Y, Hoshi H, Sato E (2000) Establishment of a porcine cell line from in vitro-produced blastocysts and transfer of the cells into enucleated oocytes. Biology of Reproduction 62: 1640–1646. [DOI] [PubMed] [Google Scholar]
  • 25. Li M, Ma W, Hou Y, Sun XF, Sun QY, Wang WH (2004) Improved isolation and culture of embryonic stem cells from Chinese miniature pig. Journal of Reproduction and Development 50: 237–244. [DOI] [PubMed] [Google Scholar]
  • 26. Kim HS, Son HY, Kim S, Lee GS, Park CH, Kang SK, et al. (2007) Isolation and initial culture of porcine inner cell masses derived from in vitro-produced blastocysts. Zygote 15: 55–63. [DOI] [PubMed] [Google Scholar]
  • 27. Vassiliev I, Vassilieva S, Beebe LF, Mcilfatrick SM, Harrison SJ, Nottle MB (2010) Development of culture conditions for the isolation of pluripotent porcine embryonal outgrowths from in vitro produced and in vivo derived embryos. Journal of Reproduction and Development. 56: 546–551. [DOI] [PubMed] [Google Scholar]
  • 28. Cibelli JB, Stice SL, Golueke PJ, Kane JJ, Jerry J, Blackwell C, et al. (1998) Transgenic bovine chimeric offspring produced from somatic cell-derived stem-like cells. Nature Biotechnology 167: 642–646. [DOI] [PubMed] [Google Scholar]
  • 29. Siriboon C, Tu CF, Kere M, Liu MS, Chang HJ, Ho LL, et al. (2013) Production of viable cloned miniature pigs by aggregation of handmade cloned embryos at the 4-cell stage. Reproduction, Fertility and Development 10.1071/RD12243. [DOI] [PubMed] [Google Scholar]
  • 30. Nguyen NT, Lin DP, Yen SY, Tseng JK, Chuang JF, Chen BY, et al. (2009) Sonic hedgehog promotes porcine oocyte maturation and early embryo development. Reproduction, Fertility and Development 21: 805–815. 10.1071/RD08277 [DOI] [PubMed] [Google Scholar]
  • 31. Chen LR, Shiue YL, Bertolini L, Medrano JF, BonDurant RH, Anderson GB (1999) Establishment of pluripotent cell lines from porcine preimplantation embryos. Theriogenology 52: 195–212. [DOI] [PubMed] [Google Scholar]
  • 32. Intawicha P, Ou YW, Lo NW, Zhang SC, Chen YZ, Lin TA, et al. (2009) Characterization of embryonic stem cell lines derived from New Zealand White Rabbit embryos. Cloning Stem Cells 11: 27–38. 10.1089/clo.2008.0040 [DOI] [PubMed] [Google Scholar]
  • 33. Brevini TA, Tosetti V, Crestan M, Antonini S, Gandolfi F (2007) Derivation and characterization of pluripotent cell lines from pig embryos of different origins. Theriogenology 67: 54–63. [DOI] [PubMed] [Google Scholar]
  • 34. Vackova I, Ungrova A, Lopes F (2007) Putative embryonic stem cell lines from pig embryos. Journal of Reproduction and Development 53: 1137–1149. [DOI] [PubMed] [Google Scholar]
  • 35. Hall V (2008) Porcine embryonic stem cells: a possible source for cell replacement therapy. Stem cell Reviews 4: 275–282. 10.1007/s12015-008-9040-2 [DOI] [PubMed] [Google Scholar]
  • 36. Telugu BP, Ezashi T, Roberts RM (2010) The promise of stem cell research in pig and other ungulate species. Stem Cell Reviews 6: 31–41. 10.1007/s12015-009-9101-1 [DOI] [PubMed] [Google Scholar]
  • 37. Telugu BP, Ezashi T, Roberts RM (2010) Porcine induced pluripotent stem cells analogous to naïve and primed embryonic stem cells of the mouse. The International Journal of Developmental Biology 54: 1703–1711. 10.1387/ijdb.103200bt [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Brevini TA, Pennarossa G, Attanasio L, Vanelli A, Gasparrini B, Gandolfi F (2010) Culture conditions and signalling networks promoting the establishment of cell lines from parthenogenetic and biparental pig embryos. Stem Cell Reviews 6: 484–495. 10.1007/s12015-010-9153-2 [DOI] [PubMed] [Google Scholar]
  • 39. Brevini TA, Pennarossa G, Gandolfi F (2010) No shortcuts to pig embryonic stem cells. Theriogenology 74: 544–550. 10.1016/j.theriogenology.2010.04.020 [DOI] [PubMed] [Google Scholar]
  • 40. Sugimura S, Narita K, Yamashiro H, Sugawara A, Shoji T, Terashita Y, et al. (2009) Interspecies somatic cell nuclear transfer with porcine oocytes as recipients: a novel bioassay system for assessing the competence of canine somatic cells to develop into embryos. Theriogenology 72: 549–559. 10.1016/j.theriogenology.2009.04.011 [DOI] [PubMed] [Google Scholar]
  • 41. Shan ZY, Wu YS, Shen XH, Li X, Xue Y, Zheng Z, et al. (2012) Aggregation of pre-implantation embryos improves establishment of parthenogenetic stem cells and expression of imprinted genes. Development, Growth & Differentiation 54: 481–488. 10.1111/bph.13094 [DOI] [PubMed] [Google Scholar]
  • 42. Li M, Zhang D, Hou Y, Jiao L, Zheng X, Wang WH (2003) Isolation and culture of embryonic stem cells from porcine blastocysts. Molecular Reproduction and Development 65: 429–434. [DOI] [PubMed] [Google Scholar]
  • 43. Talbot NC, Rexroad CE Jr, Pursel VG, Powell AM, Nel ND (1993) Culturing the epiblast cells of the pig blastocyst. In Vitro Cellular & Developmental Biology-Animal 29: 543–554. [DOI] [PubMed] [Google Scholar]
  • 44. Ropeter Scharfenstein M, Neubert N, Prelle K, Holt W (1996) Identification, isolation and culture of pluripotent cells from the porcine inner cell mass. Journal of Animal Breeding and Genetics 113: 427–436. [Google Scholar]
  • 45. Piedrahita JA, Anderson GB, Bondurant RH (1990) On the isolation of embryonic stem cells: Comparative behavior of murine, porcine and ovine embryos. Theriogenology 34: 879–901. [DOI] [PubMed] [Google Scholar]
  • 46. Yang JR, Shiue YL, Liao CH, Lin SZ, Chen LR (2009) Establishment and characterization of novel porcine embryonic stem cell lines expressing hrGFP. Cloning Stem Cells 11: 235–244. 10.1089/clo.2008.0050 [DOI] [PubMed] [Google Scholar]
  • 47. Evans MJ, Notarianni E, Laurie S, Moor RM (1990) Derivation and preliminary characterization of pluripotent cell lines from porcine and bovine blastocysts. Theriogenology 33: 125–128. [Google Scholar]
  • 48. Hochereau de Reviers MT, Perreau C (1993) In vitro culture of embryonic disc cells from porcine blastocysts. Reproduction Nutrition Development 33: 475–483. [DOI] [PubMed] [Google Scholar]
  • 49. Anderson GB, Choi SJ, Bondurant RH (1994) Survival of porcine inner cell masses in culture and after injection into blastocysts. Theriogenology 42: 204–212. [DOI] [PubMed] [Google Scholar]
  • 50. Wianny F, Perreau C, Hochereau de Reviers MT (1997) Proliferation and differentiation of porcine inner cell mass and epiblast in vitro . Biology of Reproduction 57: 756–764. [DOI] [PubMed] [Google Scholar]
  • 51. Strojek RM, Reed MA, Hoover JL, Wagner TE (1990) A method for cultivating morphologically undifferentiated embryonic stem cells from porcine blastocysts. Theriogenology 33: 901–913. [DOI] [PubMed] [Google Scholar]
  • 52. Kishigami S, Mizutani E, Ohta H, Hikichi T, Thuan NV, Wakayama S, et al. (2006) Significant improvement of mouse cloning technique by treatment with trichostatin A after somatic nuclear transfer. Biochemical and Biophysical Research Communications 340: 183–189. [DOI] [PubMed] [Google Scholar]
  • 53. Tachibana M, Amato P, Sparman M, Gutierrez NM, Tippner-Hedges R, Ma H, et al. (2013) Human embryonic stem cells derived by somatic cell nuclear transfer. Cell 153: 1228–1238. 10.1016/j.cell.2013.05.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Anderson GB, BonDurant RH, Goff L, Groff J, Moyer AL (1996) Development of bovine and porcine embryonic teratomas in athymic mice. Animal Reproduction Science 45: 231–240. [DOI] [PubMed] [Google Scholar]
  • 55. Park JK, Kim HS, Uh KJ, Choi KH, Kim HM, Lee T, et al. (2013) Primed pluripotent cell lines derived from various embryonic origins and somatic cells in pig. PLOS One 8(1). 10.1371/journal.pone.0052481 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Haraguchi S, Kikuchi K, Nakai M, Tokunaga T (2012) Establishment of self-renewing porcine embryonic stem cell-like cells by signal inhibition. Journal of Reproduction and Development 58: 707–716. [DOI] [PubMed] [Google Scholar]
  • 57. Ezashi T, Telugu BP, Alexenko AP, Sachdev S, Sinha S, Roberts RM (2009) Derivation of induced pluripotent stem cells from pig somatic cells. Proceedings of the National Academy of Sciences of the United States of America 106: 10993–10998. 10.1073/pnas.0905284106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Fujishiro SH, Nakano K, Mizukami Y, Azami T, Arai Y, Matsunari H, et al. (2013) Generation of naive-like porcine-induced pluripotent stem cells capable of contributing to embryonic and fetal development. Stem Cells and Development 22: 473–482. 10.1089/scd.2012.0173 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Liao YJ, Liao CH, Liao JW, Yuan K, Liu YZ, Chen YS, et al. (2014) Establishment and characterization of novel porcine induced pluripotent stem cells expressing hrGFP. Stem Cell Research & Therapy 4(5). 10.4172/2157-7633.1000208 25625754 [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES