Abstract
Mycoplasma bovis isolates with decreased susceptibilities to tetracyclines are increasingly reported worldwide. The acquired molecular mechanisms associated with this phenomenon were investigated in 70 clinical isolates of M. bovis. Sequence analysis of the two 16S rRNA-encoding genes (rrs3 and rrs4 alleles) containing the primary binding pocket for tetracycline (Tet-1 site) was performed on isolates with tetracycline hydrochloride MICs of 0.125 to 16 μg/ml. Mutations at positions A965T, A967T/C (Escherichia coli numbering) of helix 31, U1199C of helix 34, and G1058A/C were identified. Decreased susceptibilities to tetracycline (MICs, ≥2 μg/ml) were associated with mutations present at two (A965 and A967) or three positions (A965, A967, and G1058) of the two rrs alleles. No tet(M), tet(O), or tet(L) determinants were found in the genome of any of the 70 M. bovis isolates. The data presented correlate (P < 0.0001) the mutations identified in the Tet-1 site of clinical isolates of M. bovis with decreased susceptibility to tetracycline.
INTRODUCTION
The bacterial pathogen Mycoplasma bovis causes a variety of clinical manifestations in cattle, including respiratory disease, mastitis, arthritis, and otitis, which result in substantial economic losses (1). The tetracyclines are among the few important antimicrobial agents that may be used to treat M. bovis infections (2).
Tetracyclines are broad-spectrum antimicrobials that have been widely used in human and veterinary medicine (3). They inhibit protein synthesis by binding to the 30S ribosomal subunit and blocking an attachment of aminoacyl-tRNA to the A site (3). Resistance to tetracyclines is common in many bacterial species and may be achieved by (i) an energy-dependent efflux of the drug across the cell membrane mediated by efflux pumps, (ii) the presence of ribosomal protection proteins that confer tetracycline resistance, either by a reduction of the affinity of ribosomes to tetracyclines or by releasing the bound antimicrobial from the ribosome, (iii) the enzymatic inactivation of the drug, or (iv) the mutations in the 16S rRNA genes that affect the binding sites of tetracyclines (4).
In Mollicutes, two mechanisms of resistance to tetracyclines have been identified so far, both of which are in Mollicutes species that infect humans. These include ribosomal protection by tet(M) determinants, described in naturally tetracycline-resistant strains of Mycoplasma hominis and Ureaplasma spp. (5, 6), as well as target modification with point mutation(s) in the 16S rRNA genes of in vitro obtained mutants of Mycoplasma pneumoniae (positions 968 and 1193) and M. hominis (positions 346, 965 to 967, and 1054) (7).
Even though high MICs to tetracyclines have been identified in many Mycoplasma spp. of veterinary importance (reviewed in reference 8), including M. bovis (9–15), the genetic background for decreased susceptibility has not been elucidated in either field isolates or mutants selected in vitro. M. bovis contains one or two rRNA operons (rrn). Indeed, analysis of genome sequences of M. bovis type strain PG45 and two field strains, isolated in China, revealed that two out of the three annotated genomes (type strain PG45 and HB0801) (16, 18) contained two tandem rrn alleles (rrn3 and rrn4), both of which consisted of 16S rRNA (rrs3 [gene ID MBOPG45 0956] and rrs4 [MBOPG45 0958]) and 23S rRNA (rrl3 [MBOPG45 0957] and rrl4 [MBOPG45 0959]), while in strain Hubei-1, only one rrn was identified (17). No putative tet(M) determinant was found in the annotated genomes of M. bovis.
The aim of this study was to investigate the mechanisms associated with acquired decreased susceptibilities to tetracyclines in M. bovis isolates.
MATERIALS AND METHODS
Mycoplasma bovis isolates and growth conditions.
A total of 70 M. bovis field isolates from Israel (n = 33; 1995 to 2011), the United Kingdom (n = 11; 2000 to 2009), Germany (n = 11; 1978 to 1991), Spain (n = 2; 1993), Australia (n = 3; 2006), Hungary (n = 6; 2006 to 2010), Lithuania (n = 3; 2007 to 2010), and Cuba (n = 1; 1980 [19]) were tested in this study, and their details are given in Table 1. Each isolate originated from different farms, was selected at random, and had no epidemiological link to other isolates unless indicated otherwise. The reference type strain M. bovis PG45 was obtained from the National Collection of Type Cultures, United Kingdom (strain NCTC10131, corresponding to ATCC 25523).
TABLE 1.
No. | Straina | Yr | Country | Clinical sign | MIC (μg/ml) | Mutation in the Tet-1 site of: |
|||||
---|---|---|---|---|---|---|---|---|---|---|---|
rrs3 |
rrs4 |
||||||||||
A965 | A967 | G1058 | A965 | A967 | G1058 | ||||||
PG45 | 1962 | USA | Mastitis | 0.06 | |||||||
1 | 422 | 1980 | Cuba | Respiratory | 0.125 | ||||||
2 | 330-2 | 2005 | Israel | Mastitis | 0.125 | ||||||
3 | KS6 | 1995 | Israel | Respiratory | 0.125 | ||||||
4 | 357/81 | 1981 | Germany | Mastitis | 0.125 | T | |||||
5 | 213 | 2008 | Israel | Respiratory | 0.25 | NRb | NR | NR | |||
6 | 212/81 | 1981 | Germany | Respiratory | 0.25 | ||||||
7 | 997/79 | 1979 | Germany | Respiratory | 0.25 | ||||||
8 | 362/88 | 1991 | Germany | Mastitis | 0.25 | NR | NR | NR | |||
9 | 2DA | 2006 | Australiac | Respiratory | 0.25 | ||||||
10 | 2EA | 2006 | Australiac | Respiratory | 0.25 | T | T | ||||
11 | 018/91 | 1981 | Germany | Mastitis | 0.25 | T | |||||
12 | 780/78 | 1978 | Germany | Mastitis | 0.5 | ||||||
13 | 002/91 | 1991 | Germany | Respiratory | 0.5 | ||||||
14 | 589/78 | 1978 | Germany | Respiratory | 0.5 | ||||||
15 | 097/81 | 1981 | Germany | Respiratory | 0.5 | ||||||
16 | 277/83 | 1983 | Germany | Mastitis | 0.5 | NR | NR | NR | |||
17 | 268B07 | 2007 | United Kingdom | Arthritis | 0.5 | T | |||||
18 | 100/91 | 1991 | Germany | Respiratory | 0.5 | T | NR | NR | NR | ||
19 | 7028 | 2007 | Israel | Respiratory | 0.5 | T | |||||
20 | 742B08 | 2008 | United Kingdom | Mastitis | 0.5 | T | |||||
21 | 99B08 | 2008 | United Kingdom | Respiratory | 0.5 | T | |||||
22 | 57R | 2000 | United Kingdom | Respiratory | 0.5 | T | T | ||||
23 | 155 | 1999 | Israel | Respiratory | 0.5 | T | C | ||||
24 | HA | 2006 | Australiac | Arthritis | 0.5 | T | T | ||||
25 | 116/93 | 1993 | Spain | Mastitis | 1 | C | C | ||||
26 | 145/93 | 1993 | Spain | Mastitis | 1 | C | C | ||||
27 | 393B08 | 2008 | United Kingdom | Mastitis | 2 | T | T | T | T | ||
28 | 341B09 | 2009 | United Kingdom | Mastitis | 2 | T | T | T | T | ||
29 | 346B09 | 2009 | United Kingdom | Mastitis | 2 | T | T | T | T | ||
30 | KS3 | 1995 | Israel | Respiratory | 2 | T | T | T | T | ||
31 | 144B08 | 2008 | United Kingdom | Respiratory | 2 | T | T | T | T | ||
32 | 6099 | 2007 | Israel | Mastitis | 2 | T | T | T | T | ||
33 | 345B09 | 2009 | United Kingdom | Mastitis | 2 | T | T | T | T | ||
34 | 5180B | 2006 | Israel | Respiratory | 2 | T | T | T | T | ||
35 | 68891 | 2010 | Israel | Respiratory | 2 | T | T | T | T | ||
36 | 9088 | 2008 | Israel | Respiratory | 2 | T | T | T | T | ||
37 | 510 | 2011 | Israel | Mastitis | 2 | T | T | T | T | ||
38 | F92 | 2010 | Hungaryc | Respiratory | 2 | T | T | T | T | ||
39 | 5028C | 2008 | Israel | Respiratory | 4 | T | T | T | T | ||
40 | 4426 | 2008 | Israel | Respiratory | 4 | T | T | T | T | ||
41 | 5936D | 2008 | Israel | Respiratory | 4 | T | T | T | T | ||
42 | 1590E | 2010 | Israel | Mastitis | 4 | T | T | T | T | ||
43 | 72084E | 2010 | Israel | Genital | 4 | T | T | T | T | ||
44 | 7227 | 2008 | Lithuaniac | Respiratory | 4 | T | T | T | T | ||
45 | 72242E | 2010 | Israel | Respiratory | 4 | T | T | T | T | ||
46 | 71931 | 2010 | Lithuaniac | Respiratory | 4 | T | T | T | T | ||
47 | 6866 | 2008 | Hungaryc | Respiratory | 4 | T | T | T | T | ||
48 | 1366E | 2010 | Israel | Respiratory | 4 | T | T | T | T | ||
49 | 8830 | 2006 | Hungaryc | Respiratory | 4 | T | T | A | T | T | A |
50 | 293B09 | 2009 | United Kingdom | Respiratory | 4 | T | T | A | T | T | A |
51 | 3374 | 2006 | Hungaryc | Respiratory | 4 | T | T | A | T | T | A |
52 | 18R | 2002 | United Kingdom | Respiratory | 4 | T | T | A | T | T | A |
53 | 92279B | 2010 | Israel | Respiratory | 4 | T | C | A | T | C | A |
54 | 2029 | 2006 | Hungaryc | Respiratory | 4 | T | T | A | T | T | A |
55 | 1716 | 2007 | Israel | Respiratory | 4 | T | T | A | T | T | A |
56 | 13 | 2008 | Israel | None | 4 | T | T | A | T | T | A |
57 | 3036-1 | 2007 | Hungaryc | Respiratory | 4 | T | T | A | T | T | A |
58 | 3181/3C | 2006 | Israel | Respiratory | 4 | T | T | A | T | T | A |
59 | 2670 | 2005 | Israel | Respiratory | 8 | T | T | A | T | T | A |
60 | 9603 | 2007 | Lithuaniac | Respiratory | 8 | T | T | A | T | T | A |
61 | 88127 | 2010 | Israel | Respiratory | 8 | T | T | NR | NR | NR | |
62 | 6512 | 2008 | Israel | Respiratory | 8 | T | T | T | T | A | |
63 | 869D | 2008 | Israel | Respiratory | 8 | T | T | T | T | A | |
64 | 432 | 2008 | Israel | Mastitis | 8 | T | T | C | T | T | |
65 | 8934F | 2005 | Israel | Respiratory | 8 | T | T | A | T | T | A |
66 | 170F | 2005 | Israel | Respiratory | 8 | T | T | A | T | T | A |
67 | 3222 | 2005 | Israel | Respiratory | 8 | T | T | A | T | T | A |
68 | 94724 | 2011 | Israel | Respiratory | 8 | T | C | A | T | C | A |
69 | 861 | 2005 | Israel | Respiratory | 8 | T | C | A | T | C | A |
70 | 8998-2 | 2007 | Israel | Respiratory | 16 | T | T | A | T | T | A |
The same superscript uppercase letter (A to F) indicates that M. bovis strains were isolated from the same shipment or on the same farm.
NR, not relevant, M. bovis isolate with one rrn.
M. bovis isolates isolated in Israel from imported calves in quarantine stations.
All the isolates were propagated at 37°C in standard M. bovis broth medium (19) supplemented with 0.5% (wt/vol) sodium pyruvate and 0.005% (wt/vol) phenol red (pH 7.8) (20). Isolates of M. bovis were identified by immunofluorescence of colonies using species-specific conjugated antiserum. Aliquots of cultures were stored at −80°C until used. An aliquot was then thawed, and the number of CFU per ml was determined by performing serial 10-fold dilutions in broth, plating each dilution on agar, incubating for 96 h, and then counting the colonies as described previously (21).
Tetracycline susceptibility.
The susceptibilities of M. bovis isolates to tetracycline hydrochloride (≥95% active substance; Sigma, Rehovot, Israel) were tested by the agar dilution method as described previously (12) using M. bovis agar plates (19). Briefly, 2-fold dilutions of tetracycline from 0.03 to 32 μg/ml were incorporated onto the agar plates. Five microliters of each isolate, containing 1 × 105 to 1 × 106 CFU/ml, was spotted onto the agar plates. Plates were incubated at 37°C with 5% CO2 for 4 days. The NCTC M. bovis type strain PG45, which is regularly tested in the laboratory, was used as a control to ensure that the results were consistent with results obtained previously (22). The procedure was repeated independently three times for the reference strain PG45 and for 50% of the isolates, selected at random, with the same results obtained within a single 2-fold dilution (data not shown).
Amplification of the M. bovis primary tetracycline binding site.
Sequence analysis of the primary binding pocket for tetracycline (the Tet-1 site) was performed for all 70 M. bovis field isolates tested in this study. Genomic DNA was extracted from 400 μl of logarithmic-phase broth culture using the Maxwell DNA isolation kit for cells/tissues and the Maxwell 16 apparatus (Promega) according to the manufacturer's instructions. The 16S rRNA-encoding gene (rrs3 and rrs4 alleles) containing the Tet-1 site, formed by residues 1054 to 1056 and 1196 to 1200 of helix 34 and residues 964 to 967 of helix 31 (numbers corresponding to Escherichia coli 16S rRNA), was amplified in M. bovis isolates using the primers listed in Table 2. The primer sets MB-282-F–MB-tet3/4-R and MB-rrs-3F–MB-287-R allowed the amplification of rrs3 and rrs4, respectively (Table 2). The primers were developed and commercially synthesized (Sigma, Rehovot, Israel) based on the nucleotide sequence of M. bovis type strain PG45 (NCBI reference sequence NC_014760.1 [16]) and strain HB0801 (NC_009497.1) (18).
TABLE 2.
Primer designation | Primer source | Primer sequence (5′ to 3′) | Target amplified | Amplification protocol | Size of the amplified product (bp)a |
---|---|---|---|---|---|
MB-282-F | MBOPG45 0282 | GGATATCTAACGCCGTGTCT | MBOPG45 0282 (3′ end), rrs3 | 98°C for 30 s; 40 cycles of 98°C for 5 s, 60°C for 5 s, 72°C for 1 min; a final stage at 72°C for 3 min | 1,857 |
MB-tet3/4-R | rrs3 and rrs4 | CGTTCTCGTAGGGATACCT | |||
MB-rrs-3F | rrs3 and rrs4 | CGAGAGTTTGATCCTGGCTC | rrs4 (3′ end), MBOPG45 0287 (5′ end) | 98°C for 30 s; 40 cycles at 98°C for 5 s, 64°C for 5 s, 72°C for 2 min; a final stage at 72°C for 3 min | 5,294 |
MB-287-R | MBOPG45 0287 | CTAATTCCAAGTGCCACTAGCG |
The length of the PCR products is according to M. bovis type strain PG45.
PCRs were carried out in 50-μl volumes containing 250 ng of template DNA, 1 μl of Phire Hot Start II DNA polymerase (Thermo Scientific, Waltham, MA, USA), 10 μl of 5× Phire reaction buffer, 1 μl of 10 mM deoxynucleoside triphosphate (dNTP), and 1 µl of 20 μM each primer. PCR amplifications were carried out in a C1000 series thermocycler (Bio-Rad, Hercules, CA, USA). The conditions for the PCRs are specified in Table 2.
The amplicons were then extracted and purified from the gel using the MEGAquick-spin PCR and agarose gel DNA extraction system (iNtRON Biotechnology, South Korea). Sequencing was performed at the DNA Sequencing Unit at the Weizmann Institute (Rehovot, Israel). Sequence editing, consensus, and alignment construction were performed using DNASTAR software, version 5.06/5.51 (Lasergene, Inc., Madison, WI, USA) and BioEdit (Ibis Biosciences [23]). The numbering of each nucleotide was based on the respective 16S rRNA gene of E. coli unless indicated otherwise.
Screening of M. bovis isolates for the presence of tetracycline resistance determinants.
To check for the presence of tet(M), tet(O), and tet(L) determinants, all 70 M. bovis isolates and the PG45 type strain were subjected to DNA dot blot analysis. Briefly, for each isolate, approximately 1 μg of M. bovis genomic DNA was spotted onto a positively charged nylon membrane. The tet(M)-, tet(O)-, and tet(L)-related probes were amplified using genomic DNA of beta-hemolytic streptococci group G (GGS) containing these determinants (obtained from a collection of the Department of Clinical Microbiology and Infectious Diseases, Hadassah-Hebrew University Medical Center, Jerusalem, Israel). The primers and PCR conditions used for tet(M), tet(O), and tet(L) amplifications were as previously described (24–26). The obtained tet(M), tet(O), and tet(L) PCR amplicons were purified from the gel as described above and sequenced, and their nucleotide sequences were compared to the data present in the NCBI Nucleotide Database (http://blast.ncbi.nlm.nih.gov).
The tet(M), tet(O), and tet(L) amplicons were subsequently labeled by digoxigenin (DIG) following the manufacturer's protocol (Roche Diagnostics GmbH, Mannheim, Germany). Spotted DNA was then hybridized with DIG-labeled probes, washed, incubated with alkaline phosphatase (AP)-tagged anti-DIG antibody, and detected as previously described by Lysnyansky et al. (27). Chemiluminescence detection and imaging were performed using a G:BOX Chemi XR5 scanner (Syngene, Cambridge, United Kingdom). Genomic DNAs of the GGS isolates containing tet(M), tet(O), and tet(L) determinants were used as positive controls.
In addition, PCR amplification of tet(M) was performed on genomic DNA of all 70 M. bovis isolates using the primers (tetMF and tetMR) and PCR conditions previously described by Blanchard et al. (28).
Statistical analysis.
The significance of observed associations between the presence of mutations within the 16S rRNA gene(s) and decreased susceptibility to Tet was analyzed using Fisher's exact test. Two-tailed P values were calculated using the GraphPad QuickCalc website (http://graphpad.com/quickcalcs/contingency1/). P < 0.05 was considered statistically significant.
RESULTS
DNA sequence analysis of the 16S rRNA-encoding genes of M. bovis isolates with different susceptibilities to tetracycline.
The MICs of the 70 M. bovis field isolates ranged from 0.125 to 16 μg/ml, as shown in Fig. 1 and Table 1. A bimodal distribution of the MICs was identified, indicating decreased susceptibilities in isolates in the higher range of MICs (≥2 μg/ml) (Fig. 1). Indeed, 44/70 (63%) isolates had MICs of 2 to 16 μg/ml. At least two isolates per defined MIC were identified for further analyses, except at the MIC of 16 μg/ml, as only one isolate was found (Fig. 1, Table 1).
The sequence analysis of the Tet-1 site of 16S rRNA-encoding genes (rrs3 and rrs4 alleles) showed that 5/70 M. bovis isolates had one rrs allele (two isolates with an MIC of 0.25 μg/ml, two with an MIC of 0.5 μg/ml, and one with an MIC of 8 μg/ml). The distribution of mutations in the Tet-1 site relative to the tetracycline MICs is shown in Table 1. Two cohorts of isolates were identified.
The first cohort contained 26 M. bovis isolates with MICs of ≤1 μg/ml. In 13/26 isolates, no mutations were identified at positions 964 to 967 of helix 31 or at positions 1054 to 1056 and 1196 to 1200 of helix 34 in either rrs allele. However, a single mutation at position A965T or A967T of the rrs3 allele was found in seven isolates, two isolates contained the A965T and A967T mutations in rrs4, and four isolates had mutations at position A967T/C in rrs3 and rrs4 alleles (Table 1, isolate numbers 1 to 26).
The second cohort contained 44 M. bovis isolates with MICs of ≥2 μg/ml. Twenty-two out of 44 isolates possessed the double mutations AGA 965 to 967 TGT in the two rrs alleles, 18 isolates contained triple mutations (AGA 965 to 967 TGT/C and G1058A) in the two rrs alleles, and 3 isolates contained the double mutations AGA 965 to 967 TGT in the two rrs alleles and a G1058C mutation in rrs3 (one isolate) or a G1058A mutation in rrs4 (two isolates). In addition, one isolate (with only one rrn) contained the double mutations AGA 965 to 967 TGT (Table 1, isolate numbers 27 to 70).
In addition, three isolates with MICs of 2 to 4 μg/ml tetracycline had a U1199C mutation in rrs3, and 20 M. bovis isolates with MICs of 2 to 8 μg/ml tetracycline contained the C1192A mutation in one rrs (12 isolates) or in both rrs alleles (8 isolates). These mutations were not identified in M. bovis isolates with MICs of 0.125 to 1 μg/ml (data not shown). It should be noted that other mutations/nucleotide substitutions were also identified within the rrs3 allele of some isolates (at positions 1005 [2 strains, with MICs of 0.125 and 0.5 μg/ml], 1013 [24, with MICs of 0.125 to 8 μg/ml], 1281 [6, with MICs of 0.125 to 8 μg/ml], and 1331 [1, with an MIC of 0.5 μg/ml]) and/or within the rrs4 allele (at positions 1005 [2, with MICs of 0.125 and 0.5 μg/ml), 1013 [37, with MICs of 0.25 to 16 μg/ml], 1153 [61, with MICs of 0.125 to 16 μg/ml], 1184 [4, with MICs of 0.25 to 0.5 μg/ml], 1189 [1, with an MIC of 0.125 μg/ml], 1268 [59, with MICs of 0.125 to 16 μg/ml], and 1331 [1, with an MIC of 4 μg/ml]). None of these positions is located within or close to the Tet-1 site, and nucleotide substitution at position 1013 (A to G in rrs3 and G to A in rrs4) appeared to represent intra-rrs variability.
Screening of the M. bovis genomic DNA for the presence of tet(M), tet(O), and tet(L) determinants.
Genomic DNA samples of 70 M. bovis isolates with tetracycline MICs of 0.25 to 16 μg/ml were screened by dot blot analysis for the presence of tet(M), tet(O), and tet(L) genes as described in Materials and Methods. No positive signals were identified by any of the DIG-labeled probes (data not shown). In contrast, strong signals were detected for GGS-tet(M), tet(O), and tet(L) determinants used as positive controls. In addition, no PCR product was amplified using genomic DNA of the 70 M. bovis isolates and the PCR system developed by Blanchard et al. (28).
DISCUSSION
Tetracyclines are often used for the treatment of M. bovis-related infections, and thus tetracycline resistance in this organism is of increasing concern. In this study, the molecular mechanisms associated with M. bovis-decreased susceptibility to tetracycline were investigated. Our results showed that an increase of MICs to tetracycline (≥2 μg/ml) is correlated with the number of mutated nucleotide positions within the Tet-1 site of M. bovis field isolates. Indeed, 43/44 M. bovis isolates with MICs of ≥2 μg/ml contained two (A965T and A967T/C) or three (A965T, A967T/C, and G1058A/C) mutations in both the rrs3 and rrs4 alleles (from 4 to 6 mutated sites in total; P < 0.0001). The additional isolate had only one rrs allele, which contained A965T and A967T mutations (Table 1, number 61). In contrast, only single- or double-base-pair mutations (maximum of two mutated positions) were identified in 13/26 M. bovis isolates with MICs of ≤1 μg/ml tetracycline (Table 1, numbers 1 to 26). It is likely that the impact of single- or double-base-pair mutations on the susceptibility to tetracycline of M. bovis isolates containing two rrs alleles is minor. This can be explained by the fact that a nonmutated rrs copy may cover the function of the mutant copy. Indeed, from 12 out of 13 isolates with two rrs alleles, 10 were heterozygotes with MICs of ≤0.5 μg/ml. Two additional isolates (116/93 and 145/93) were homozygous for the single mutation A967C and had an MIC of 1 μg/ml tetracycline. More homozygotes for a single mutation should be tested to clarify whether one mutated position present in both of these rrs alleles may account for a slight increase in MIC (1 μg/ml). In addition, it will be of interest to test the correlation between the presence of single- or double-base-pair mutations and MICs of tetracycline in a cohort of M. bovis isolates with one rrs allele (unfortunately, only 5 isolates with one rrs allele were identified in our study [Table 1, numbers 5, 8, 16, 18, and 61]).
The Tet-1 site consists of two domains in 16S rRNA: helix 34 (residues 1054 to 1056 and 1196 to 1200) and the loop next to helix 31 (residues 964 to 967). It lies in a clamp-like pocket at the A site for binding of tRNA, as was previously shown by the crystal structures of Thermus thermophilus 30S ribosome-tetracycline complexes (29, 30). Mutations detected in this study were located within this site or close to it (position 1058). It has been shown that low-level resistance to tetracycline in Helicobacter pylori resulted from single- and double-base-pair mutations at positions 965 to 967 (31, 32), while high resistance to tetracycline was achieved by triple-base-pair mutation AGA 965 to 967 TTC (33, 34). In another study, three isolates with a single mutation (at positions 966, 967, or 1054), one isolate with a double mutation (at positions 346 and 965), and one isolate with a triple mutation (at positions 346, 965, and 966) were identified in mutants of M. hominis type strain PG21, selected in vitro using doxycycline (7). In the same study, an in vitro-obtained mutant of M. pneumoniae type strain FH harboring the single-base-pair mutation G1193A and another mutant with the double-base-pair mutations G1193A and T968C were also selected. It has been acknowledged that compared to the parent M. hominis and M. pneumoniae strains, the selected mutants showed decreased susceptibilities to tetracyclines; however, no remarkable increase in MICs was observed (only one mutant had an MIC of 8 μg/ml) (7).
In addition, decreased susceptibility to tetracycline acquired by a mutation of G to C at position 1058, located directly adjacent to the Tet-1 site, was previously described in clinical isolates of Propionibacterium acnes, Brachyspira hyodysenteriae, and Brachyspira intermedia (35–37). It has been suggested that a mutation at this position can influence the base pairing G1058 with U1199 and might lead to a conformational change and closing of the Tet-1 binding pocket (29). In our study, two additional mutated positions, C1192A and U1199C, were identified in groups of isolates with MICs of 2 to 8 and 2 to 4 μg/ml, respectively (data not shown). While the mutation U1199C itself may influence the binding of tetracycline to the Tet-1 site, mutation at position 1192 was shown to be associated with resistance to spectinomycin in E. coli (38, 39).
It is well documented that tetracycline resistance in M. hominis and Ureaplasma spp. with high MICs (≥32 μg/ml) is associated with the tet(M) determinant (5–7, 28, 40). However, tetracycline-susceptible Ureaplasma urealyticum and two M. hominis isolates harboring the tet(M) gene were recently identified (7, 40). While no mutations in the coding region of the tet(M) gene or in the promoter region were found in the tetracycline-susceptible U. urealyticum isolate, one of two M. hominis isolates had an insertion of insertion-like sequence ISMhom1 (IS30 gene family) upstream to tet(M), which possibly caused the lack of tet(M) transcription in this isolate (7, 40). In this study, no tet(M), tet(O), or tet(L) determinants were found in any of the 70 M. bovis isolates. Several assumptions can explain such results: (i) it may be that tetracycline resistance in M. bovis is not acquired via tet determinants, and (ii) no M. bovis isolates with high MICs were identified and tested in this study, a fact that may have negatively influenced the chance to detect those genes. The existence of M. bovis isolates with high MICs (≥64 μg/ml) to different tetracyclines has been shown (summarized in reference [8]); however, no isolates with such high MICs were found in our study, and only 1/70 isolates had an MIC of 16 μg/ml (Table 1). The possible explanation for this discrepancy is that there are many difficulties in comparing results obtained from the different studies due to the lack of standardization in the performance of the susceptibility assays, which includes use of different methods, different control isolates, and different tetracyclines. More isolates with MICs of ≥16 μg/ml should be tested to confirm the results obtained in this study.
In summary, we have identified mutations in the primary binding pocket for tetracycline of clinical isolates of M. bovis, which correlated with decreased susceptibilities to tetracycline. Moreover, the data presented here demonstrate that the increase in the MICs for tetracycline (≥2 μg/ml) in M. bovis field isolates correlated with the number of nucleotide positions affected within the Tet-1 site of the rrn3 and rrn4 alleles.
ACKNOWLEDGMENTS
We gratefully acknowledge the receipt of Streptococcus isolates from R. Nir-Paz, Department of Clinical Microbiology and Infectious Diseases, Hadassah-Hebrew University Medical Center, Jerusalem, Israel.
This research was supported by a research grant from the Emerging and Major Infectious Diseases of Livestock (EMIDA) Consortium from the Chief Scientist of the Ministry of Agriculture, Israel (847-0369), and the Israel Dairy Board (847-0366).
We declare no conflicts of interest.
REFERENCES
- 1.Nicholas RA, Ayling RD. 2003. Mycoplasma bovis: disease, diagnosis, and control. Res Vet Sci 74:105–112. doi: 10.1016/S0034-5288(02)00155-8. [DOI] [PubMed] [Google Scholar]
- 2.Giguere S. 2007. Tetracyclines and glycylcyclines, p 231–240. In Giguere S, Prescott JF, Baggot JD, Walker RD, Dowling PM (ed), Antimicrobial therapy in veterinary medicine, 4th ed. Wiley Blackwell, Hoboken, NJ. [Google Scholar]
- 3.Brysker A. (ed). 2005. Antimicrobial agents: antibacterials and antifungals. ASM Press, Washington, DC. [Google Scholar]
- 4.Chopra I, Roberts M. 2001. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev 65:232–260. doi: 10.1128/MMBR.65.2.232-260.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Roberts MC, Koutsky LA, Holmes KK, LeBlanc DJ, Kenny GE. 1985. Tetracycline-resistant Mycoplasma hominis strains contain streptococcal tetM sequences. Antimicrob Agents Chemother 28:141–143. doi: 10.1128/AAC.28.1.141. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Roberts MC, Hillier SL, Hale J, Holmes KK, Kenny GE. 1986. Tetracycline resistance and tetM in pathogenic urogenital bacteria. Antimicrob Agents Chemother 30:810–812. doi: 10.1128/AAC.30.5.810. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Degrange S, Renaudin H, Charron A, Pereyre S, Bebear C, Bebear CM. 2008. Reduced susceptibility to tetracyclines is associated in vitro with the presence of 16S rRNA mutations in Mycoplasma hominis and Mycoplasma pneumoniae. J Antimicrob Chemother 61:1390–1392. doi: 10.1093/jac/dkn118. [DOI] [PubMed] [Google Scholar]
- 8.Waites KB, Lysnyansky I, Bébéar CM. 2014. Emerging antimicrobial resistance in mycoplasmas of humans and animals, p 289–322. In Browning GF, Citti C (ed), Mollicutes: molecular biology and pathogenesis. Caister Academic Press, Poole, United Kingdom. [Google Scholar]
- 9.Ayling RD, Baker SE, Peek ML, Simon AJ, Nicholas RA. 2000. Comparison of in vitro activity of danofloxacin, florfenicol, oxytetracycline, spectinomycin and tilmicosin against recent field isolates of Mycoplasma bovis. Vet Rec 146:745–747. doi: 10.1136/vr.146.26.745. [DOI] [PubMed] [Google Scholar]
- 10.Thomas A, Nicolas C, Dizier I, Mainil J, Linden A. 2003. Antibiotic susceptibilities of recent isolates of Mycoplasma bovis in Belgium. Vet Rec 153:428–431. doi: 10.1136/vr.153.14.428. [DOI] [PubMed] [Google Scholar]
- 11.Rosenbusch RF, Kinyon JM, Apley M, Funk ND, Smith SC, Hoffman LJ. 2005. In vitro antimicrobial inhibition profiles of Mycoplasma bovis isolates recovered from various regions of the United States from 2002 to 2003. J Vet Diagn Invest 17:436–441. doi: 10.1177/104063870501700505. [DOI] [PubMed] [Google Scholar]
- 12.Gautier-Bouchardon AV, Ferre S, Le Grand D, Paoli A, Gay E, Poumarat F. 2014. Overall decrease in the susceptibility of Mycoplasma bovis to antimicrobials over the past 30 years in France. PLoS One 9:e87672. doi: 10.1371/journal.pone.0087672. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Uemura R, Sueyoshi M, Nagatomo H. 2010. Antimicrobial susceptibilities of four species of mycoplasma isolated in 2008 and 2009 from cattle in Japan. J Vet Med Sci 72:1661–1663. doi: 10.1292/jvms.10-0165. [DOI] [PubMed] [Google Scholar]
- 14.Francoz D, Fortin M, Fecteau G, Messier S. 2005. Determination of Mycoplasma bovis susceptibilities against six antimicrobial agents using the E test method. Vet Microbiol 105:57–64. doi: 10.1016/j.vetmic.2004.10.006. [DOI] [PubMed] [Google Scholar]
- 15.Soehnlen MK, Kunze ME, Karunathilake KE, Henwood BM, Kariyawasam S, Wolfgang DR, Jayarao BM. 2011. In vitro antimicrobial inhibition of Mycoplasma bovis isolates submitted to the Pennsylvania Animal Diagnostic Laboratory using flow cytometry and a broth microdilution method. J Vet Diagn Invest 23:547–551. doi: 10.1177/1040638711404155. [DOI] [PubMed] [Google Scholar]
- 16.Wise KS, Calcutt MJ, Foecking MF, Roske K, Madupu R, Methe BA. 2011. Complete genome sequence of Mycoplasma bovis type strain PG45 (ATCC 25523). Infect Immun 79:982–983. doi: 10.1128/IAI.00726-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Li Y, Zheng H, Liu Y, Jiang Y, Xin J, Chen W, Song Z. 2011. The complete genome sequence of Mycoplasma bovis strain Hubei-1. PLoS One 6:e20999. doi: 10.1371/journal.pone.0020999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Qi J, Guo A, Cui P, Chen Y, Mustafa R, Ba X, Hu C, Bai Z, Chen X, Shi L, Chen H. 2012. Comparative geno-plasticity analysis of Mycoplasma bovis HB0801 (Chinese isolate). PLoS One 7:e38239. doi: 10.1371/journal.pone.0038239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Rosengarten R, Behrens A, Stetefeld A, Heller M, Ahrens M, Sachse K, Yogev D, Kirchhoff H. 1994. Antigen heterogeneity among isolates of Mycoplasma bovis is generated by high-frequency variation of diverse membrane surface proteins. Infect Immun 62:5066–5074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hannan PC, Windsor GD, de Jong A, Schmeer N, Stegemann M. 1997. Comparative susceptibilities of various animal-pathogenic mycoplasmas to fluoroquinolones. Antimicrob Agents Chemother 41:2037–2040. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Waites KB, Duffy LB, Bebear CM, Matlow A, Talkington DF, Kenny GE, Totten PA, Bade DJ, Zheng X, Davidson MK, Shortridge VD, Watts JL, Brown SD. 2012. Standardized methods and quality control limits for agar and broth microdilution susceptibility testing of Mycoplasma pneumoniae, Mycoplasma hominis, and Ureaplasma urealyticum. J Clin Microbiol 50:3542–3547. doi: 10.1128/JCM.01439-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Gerchman I, Levisohn S, Mikula I, Lysnyansky I. 2009. In vitro antimicrobial susceptibility of Mycoplasma bovis isolated in Israel from local and imported cattle. Vet Microbiol 137:268–275. doi: 10.1016/j.vetmic.2009.01.028. [DOI] [PubMed] [Google Scholar]
- 23.Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98. [Google Scholar]
- 24.Aminov RI, Garrigues-Jeanjean N, Mackie RI. 2001. Molecular ecology of tetracycline resistance: development and validation of primers for detection of tetracycline resistance genes encoding ribosomal protection proteins. Appl Environ Microbiol 67:22–32. doi: 10.1128/AEM.67.1.22-32.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Nishimoto Y, Kobayashi N, Alam MM, Ishino M, Uehara N, Watanabe N. 2005. Analysis of the prevalence of tetracycline resistance genes in clinical isolates of Enterococcus faecalis and Enterococcus faecium in a Japanese hospital. Microb Drug Resist 11:146–153. doi: 10.1089/mdr.2005.11.146. [DOI] [PubMed] [Google Scholar]
- 26.Trzcinski K, Cooper BS, Hryniewicz W, Dowson CG. 2000. Expression of resistance to tetracyclines in strains of methicillin-resistant Staphylococcus aureus. J Antimicrob Chemother 45:763–770. doi: 10.1093/jac/45.6.763. [DOI] [PubMed] [Google Scholar]
- 27.Lysnyansky I, Yogev D, Levisohn S. 2008. Molecular characterization of the Mycoplasma bovis p68 gene, encoding a basic membrane protein with homology to P48 of Mycoplasma agalactiae. FEMS Microbiol Lett 279:234–242. doi: 10.1111/j.1574-6968.2007.01040.x. [DOI] [PubMed] [Google Scholar]
- 28.Blanchard A, Crabb DM, Dybvig K, Duffy LB, Cassell GH. 1992. Rapid detection of tetM in Mycoplasma hominis and Ureaplasma urealyticum by PCR: tetM confers resistance to tetracycline but not necessarily to doxycycline. FEMS Microbiol Lett 74:277–281. [DOI] [PubMed] [Google Scholar]
- 29.Pioletti M, Schlunzen F, Harms J, Zarivach R, Gluhmann M, Avila H, Bashan A, Bartels H, Auerbach T, Jacobi C, Hartsch T, Yonath A, Franceschi F. 2001. Crystal structures of complexes of the small ribosomal subunit with tetracycline, edeine and IF3. EMBO J 20:1829–1839. doi: 10.1093/emboj/20.8.1829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Brodersen DE, Clemons WM Jr, Carter AP, Morgan-Warren RJ, Wimberly BT, Ramakrishnan V. 2000. The structural basis for the action of the antibiotics tetracycline, pactamycin, and hygromycin B on the 30S ribosomal subunit. Cell 103:1143–1154. doi: 10.1016/S0092-8674(00)00216-6. [DOI] [PubMed] [Google Scholar]
- 31.Dailidiene D, Bertoli MT, Miciuleviciene J, Mukhopadhyay AK, Dailide G, Pascasio MA, Kupcinskas L, Berg DE. 2002. Emergence of tetracycline resistance in Helicobacter pylori: multiple mutational changes in 16S ribosomal DNA and other genetic loci. Antimicrob Agents Chemother 46:3940–3946. doi: 10.1128/AAC.46.12.3940-3946.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Wu JY, Kim JJ, Reddy R, Wang WM, Graham DY, Kwon DH. 2005. Tetracycline-resistant clinical Helicobacter pylori isolates with and without mutations in 16S rRNA-encoding genes. Antimicrob Agents Chemother 49:578–583. doi: 10.1128/AAC.49.2.578-583.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Trieber CA, Taylor DE. 2002. Mutations in the 16S rRNA genes of Helicobacter pylori mediate resistance to tetracycline. J Bacteriol 184:2131–2140. doi: 10.1128/JB.184.8.2131-2140.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Gerrits MM, Berning M, Van Vliet AH, Kuipers EJ, Kusters JG. 2003. Effects of 16S rRNA gene mutations on tetracycline resistance in Helicobacter pylori. Antimicrob Agents Chemother 47:2984–2986. doi: 10.1128/AAC.47.9.2984-2986.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Ross JI, Eady EA, Cove JH, Cunliffe WJ. 1998. 16S rRNA mutation associated with tetracycline resistance in a gram-positive bacterium. Antimicrob Agents Chemother 42:1702–1705. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Pringle M, Fellstrom C, Johansson KE. 2007. Decreased susceptibility to doxycycline associated with a 16S rRNA gene mutation in Brachyspira hyodysenteriae. Vet Microbiol 123:245–248. doi: 10.1016/j.vetmic.2007.02.019. [DOI] [PubMed] [Google Scholar]
- 37.Verlinden M, Boyen F, Pasmans F, Garmyn A, Haesebrouck F, Martel A. 2011. Antimicrobial susceptibility pattern of Brachyspira intermedia isolates from European layers. Microb Drug Resist 17:485–488. doi: 10.1089/mdr.2011.0082. [DOI] [PubMed] [Google Scholar]
- 38.Sigmund CD, Ettayebi M, Morgan EA. 1984. Antibiotic resistance mutations in 16S and 23S ribosomal RNA genes of Escherichia coli. Nucleic Acids Res 12:4653–4663. doi: 10.1093/nar/12.11.4653. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Makosky PC, Dahlberg AE. 1987. Spectinomycin resistance at site 1192 in 16S ribosomal RNA of E. coli: an analysis of three mutants. Biochimie 69:885–889. doi: 10.1016/0300-9084(87)90216-1. [DOI] [PubMed] [Google Scholar]
- 40.Beeton ML, Chalker VJ, Maxwell NC, Kotecha S, Spiller OB. 2009. Concurrent titration and determination of antibiotic resistance in Ureaplasma species with identification of novel point mutations in genes associated with resistance. Antimicrob Agents Chemother 53:2020–2027. doi: 10.1128/AAC.01349-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Lerner U, Amram E, Ayling RD, Mikula I, Gerchman I, Harrus S, Teff D, Yogev D, Lysnyansky I. 2014. Acquired resistance to the 16-membered macrolides tylosin and tilmicosin by Mycoplasma bovis. Vet Microbiol 168:365–371. doi: 10.1016/j.vetmic.2013.11.033. [DOI] [PubMed] [Google Scholar]