Genetic diversity of Moringa peregrina species in Saudi Arabia with ITS sequences

Abstract

The genus Moringa was the family of Moringaceae and Moringa oleifera and Moringa peregrina are the most famous species of Moringa. M. peregrina is widely grown in Saudi Arabia, Iran and India. Therefore, based on these reports, this study aimed to investigate the first systematic attempt to regulate the genetic diversity of the species M. peregrina in Saudi Arabian samples collected from several geographic locations using internal transcribed sequences. Genomic DNA was separated by CTAB extraction method and PCR was performed. Later on, DNA sequencing was performed for PCR products with ITS. In conclusion, the present study affords the first report on genetic stability of M. peregrina using ITS analysis in Saudi Arabia. Further studies are suggested in order to study in different regions.

1. Introduction

Moringa peregrina (Moringaceae) species is commonly known as the miracle tree, consists of 13 species from tropical and subtropical climates and ranges in size from tiny herbs to massive trees. The Moringa tree has a wide range of use in the areas of agriculture, health, and industry for developing countries. Moringa serves as a medicinal plant, animal fodder, and a food source for humans. However, the Moringa tree is most praised for its nutritional abilities and consists of vitamin and mineral concentrations (Ghodsi et al., 2014). Morton (1991) reported that the most common species are M. peregrina (forsk) fieri (syn. M aptera Gaertns, M arabica (Lam.) Pens., M. zeylanica Sieb; Balanus myrepsica Blackm), M. stenopetala Cufod, M. borziana Mattel, M. longituba Engl, M. concanensis Nimmo, M. ovalifolia Dinter and A. Berger, M. drouhardii, M. hildebrantii (Tsaknis et al., 1988). M. peregrina (Forssk.) Fiori is also widely grown, but to a much lesser extent than M. oleifera in Saudi Arabia, India and south of Iran (Somali et al., 1984; Ghodsi et al., 2014).

M. peregrina is distributed in the region extended from the red sea to all the Arabian Peninsula. The genus M. peregrine is growing in many regions of the Kingdom of Saudi Arabia. It is a fast growing tree (Abd El-Wahab, 1995). It has a grayish-green bark, long, alternate leaves, and yellowish white to pink, showy, fragrant flowers (Boulos et al., 2000). M. peregrine is used for nutrition and medicine in many countries in Middle East. Ecology and nature of growth of the M. peregrine were studied by Zaghloul et al. (2010) and Gomaa and Pico (2011). Antimicrobial activities of M. peregrine oil extracted from seeds were fully studied. The oil had inhibitory effects on Staphylococcus aureus, Staphylococcus epidermidis, Pseudomonas aeruginosa, Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, Candida albicans, C. tropicalis and C. glabrata (Lalas et al., 2002). The chemical properties of M. peregrina were studied by El-Batran et al. (2005). The pharmaceutical functions were investigated as well and proved a significant role as anti-cancer drug for colon and breast cancer cells (El-Alfy et al., 2011). Seeds of M. peregrina have anti-oxidant effects and play role in improving the health and resistance of diseases.

There is shortage of knowledge on the genetics of M. peregrina, even though recently few reports on genetic assessments using inter simple sequence repeat (ISSR) (Al Khateeb et al., 2013). The aim of this study was to investigate the first systematic attempt to regulate the genetic diversity of the species M. peregrina in Saudi Arabian samples collected from several geographic locations using internal transcribed sequences.

2. Materials and methods

2.1. Plant material

In this study, I have collected 14 plants of M. peregrina species from 14 of Saudi Arabia: A (n = 4): Jabal Al-Ajrad, B (n = 3): Jabal Wargan, C (n = 4): Al-Oula, D (n = 2): Wadi Tharad and E (n = 2): Wadi Nawan regions in Saudi Arabia. The localities of all samples are confirmed in Fig. 1a and b. The plants were identified and classified according to the morphological and taxonomical features of the plant flowers, leaves and stem (Fig. 2a–c). All samples were labeled and stored in freezer until processed.

Figure 1a.

A map shows the locations of all samples.

Figure 1b.

Map showing location for samples D and E.

Figure 2.

Morphology of M. peregrina (plant stem, leaves and flowers). (a) Moringa peregrina, 16 Dec 2007 Dunafa Island, Aden by Al Khulaidi. (b) Moringa peregrina, 16 Dec 2007 Dunafa Island, Aden by Al Khulaidi. (c) Moringa peregrina, Shabwa, 21 January 2010.

2.2. Extraction of genomic DNA

CTAB extraction method was performed to separate the genomic DNA from the plant tissues. A total of 200 mg of the M. peregrina tissues were removed from storage and ground with a 60 °C CTAB buffer (2% CTAB, 100 mM Tris–HCl pH 8.0, 20 mM ethylenediaminetetraaceticacid (EDTA), and 1.4 M NaCl) and transferred into 1.5 ml Eppendorf tubes. Tubes were vortexed and incubated at 60 °C for 30 min., then cold chloroform:isoamyl alcohol (24:1) solution was added, mixed and centrifuged at 9000 rpm for 15 min. Cold isopropanol was added and mixed with the supernatant in a new tube and kept at −20 °C for 30 min to precipitate the DNA. Tubes were centrifuged at 14,000 rpm for 15 min. DNA precipitate was washed with 70% ethanol and left to air dry. DNA was re-suspended in 20 μl of TE buffer (10 mM Tris–HCl pH 8.0 and 1 mM EDTA).

2.3. PCR amplification

The sequence of the internal transcribed spacer region of the ribosomal DNA (rDNA ITS) was obtained from the GenBank (http://www.ncbi.nlm.nih.gov/nucleotide) accession number (JX092071). The following ITS2 gene was used in this study; forward sequence (MPF) 5′TCGAATGAAAAAGCACGCCC3′ and reverse sequence 5′TTTTTAAGCCAACCGCGAGC3′ were designed for the amplification of M. peregrina. The expected size of the PCR product on gel electrophoresis is 344 bp. A total volume of 50 μl PCR mixture (3 μl genomic DNA, 25 μl PCR Master Mix., 1 μl of each primer and 20 μl distilled sterilized H₂O) was used. PCR amplification was carried out in a Techne thermocycler. The PCR thermocycling conditions were 95 °C for 3 min as initial denaturation step followed by 35 cycles of 95 °C for 30 s, denaturation; 60 °C 30 s, annealing; and 72.0 °C 60 s, extension the final extension was at 72.0 °C for 10 min. PCR products were run on 1% agarose gel containing ethidium bromide and visualized. The PCR products of the 14 samples were sent for sequencing using the same two primers used in the PCR amplification.

2.4. Analysis of sequencing data

The obtained sequences were checked out and then bootstrap neighbor-joining tree was generated using MEGA version 5.1. Comparisons with sequences in the GenBank database were achieved in BLASTN searches at the National Center for Biotechnology Information site (http://www.ncbi.nlm.nih.gov).

3. Results and discussion

3.1. PCR analysis

Fig. 3 shows the bands observed by 1% agarose gel electrophoresis of PCR products from 14 M. Peregrina species of Saudi Arabia. The two sets of primers were used in this study to amplify the ITS2 region. A 344 bp single band was observed for all the 14 PCR products of M. Peregrina species. All the samples have shown the bands without failing, indicating the presence of PCR products.

Figure 3.

Polymerase chain reaction of the internal transcribed spacer region of the ribosomal DNA (rDNA ITS) of M. peregrina plants. A: Jabal al Ajrad, B: Jabal Wargan, C: Al-Oula, D: Wadi Tharad, E: Wadi Nawan.

3.2. Phylogenic tree

The neighbor-joining tree of all the 14 sequenced samples of M. peregrina was generated as shown in Fig. 4. The tree topology visualized the results of multiple alignments. The perfect match between microsatellite clusters, ITS2 clades and amplicon sizes demonstrates that ITS2 is a reliable marker to identify groups of M. peregrina that remain undifferentiated morphologically. This result indicates that the genetic groups of M. peregrina constitute biological species. Furthermore, divergence between ITS2 alleles within each M. peregrina species is much lower than between species (Fig. 4). Such deep reciprocal monophyly suggests that the M. peregrina species did not exchange ITS2 alleles for a relatively long time. Absolute estimates on the timing since complete isolation would require a molecular clock, which is not available in psyllids.

Figure 4.

Neighbor-joining tree of all the 14 sequenced samples of M. peregrina.

The failure to amplify the ITS2 locus in other species with our diagnostic primers probably results from mutations in primer binding sites, which were chosen for their polymorphism within M. peregrina. The use of sets of primers will ensure successful identification of such individuals. The diagnostic PCR developed here is a fast, cost-effective and reliable tool to assign individuals of M. peregrina to genetic groups that appear to constitute divergent species. This tool will greatly facilitate studies that investigate the distribution areas of these species, their host plants and their ability to vector phytoplasma pathogens.

The PCR amplification and DNA sequencing success rate for ITS of M. peregrina gene was 100%. The amplified sequence length was 344 bp. A large number of pharmacological investigations have been directed toward the plant kingdom as a source of therapeutic agents. Some of these investigations were carried out on the species of Moringaceae family. These species that occur in the Red Sea area, Arabia, and the Indian subcontinent are all slender trees. The most economically valuable species, M. oleifera, is now cultivated in all the countries of the tropics. M. oleifera seems to be native to dry tropical areas in northwestern India, at the southwestern foot of the Himalayas. M. peregrina has a wider range, growing from the Dead Sea area sporadically along the Red Sea coasts to northern Somalia and around the Arabian Peninsula to the mouth of the Persian Gulf. Edible oils were extracted where the trees were cultivated, by boiling the seeds with water and collecting the oils from the surface of the water (Lalas et al., 2002). Moringa oil has been used in skin preparations and ointments since Egyptian times (Senugupta and Gupta, 1970). The bright yellow oil, with a pleasant taste, has been compared in quality with olive oil. The kernel contains 35–50% by weight of oil. Recent studies in Ghana showed that soap made with moringa oil was extremely good (Suarez et al., 2003). In conclusion, the present study affords the first report on genetic stability of M. peregrina using ITS analysis in Saudi Arabia. Further studies are suggested in order to study in different regions.