Skip to main content
NCBI home page
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2015 Feb 16;179(3):426–434. doi: 10.1111/cei.12471

Species-specific engagement of human nucleotide oligomerization domain 2 (NOD)2 and Toll-like receptor (TLR) signalling upon intracellular bacterial infection: role of Crohn’s associated NOD2 gene variants

M Salem *,✉, J B Seidelin *, S Eickhardt †, M Alhede †, G Rogler ‡, O H Nielsen *
PMCID: PMC4337675  PMID: 25335775

Abstract

Recognition of bacterial peptidoglycan-derived muramyl-dipeptide (MDP) by nucleotide oligomerization domain 2 (NOD2) induces crucial innate immune responses. Most bacteria carry the N-acetylated form of MDP (A-MDP) in their cell membranes, whereas N-glycolyl MDP (G-MDP) is typical for mycobacteria. Experimental murine studies have reported G-MDP to have a greater NOD2-stimulating capacity than A-MDP. As NOD2 polymorphisms are associated with Crohn's disease (CD), a link has been suggested between mycobacterial infections and CD. Thus, the aim was to investigate if NOD2 responses are dependent upon type of MDP and further to determine the role of NOD2 gene variants for the bacterial recognition in CD. The response pattern to A-MDP, G-MDP, Mycobacterium segmatis (expressing mainly G-MDP) and M. segmatisΔnamH (expressing A-MDP), Listeria monocytogenes (LM) (an A-MDP-containing bacteria) and M. avium paratuberculosis (MAP) (a G-MDP-containing bacteria associated with CD) was investigated in human peripheral blood mononuclear cells (PBMCs). A-MDP and M. segmatisΔnamH induced significantly higher tumour necrosis factor (TNF)-α protein levels in healthy wild-type NOD2 PBMCs compared with G-MDP and M. segmatis. NOD2 mutations resulted in a low tumour necrosis factor (TNF)-α protein secretion following stimulation with LM. Contrary to this, TNF-α levels were unchanged upon MAP stimulation regardless of NOD2 genotype and MAP solely activated NOD2- and Toll-like receptor (TLRs)-pathway with an enhanced production of interleukin (IL)-1β and IL-10. In conclusion, the results indicate that CD-associated NOD2 deficiencies might affect the response towards a broader array of commensal and pathogenic bacteria expressing A-MDP, whereas they attenuate the role of mycobacteria in the pathogenesis of CD.

Keywords: autophagy, Crohn's disease, muramyl dipeptide, Mycobacterium avium paratuberculosis, nucleotide oligomerization domain 2

Introduction

Sensing bacterial peptidoglycan (PGN) is crucial for the establishment and maintenance of a well-functioning immune system in healthy individuals. Pathogenic microorganisms are recognized by specific sensors, including Toll-like receptors (TLRs) and nucleotide oligomerization domain (NOD)-like receptors (NLRs) 1. Muramyl dipeptide (MDP) is a small bioactive fragment of the bacterial PGN that can be sensed by NLR receptors, such as NLRP3 and NOD2, and thereby lead to optimization of normal bacterial clearance 2,3. MDP activation of NLRP3 leads to the formation of intracellular multi-protein complexes, the inflammasomes, which are able to convert proinflammatory cytokines into biologically active forms 4. The activation of NOD2 downstream signalling leads to induction of nuclear factor-κB (NF-κB) and the production of proinflammatory cytokines such as tumour necrosis factor (TNF)-α 5,6. Further, NOD2 activates the cellular autophagy pathway by interacting with autophagy-related protein 16-like 1 (ATG16L1) 7. MDP stimulation of bone marrow-derived macrophages activates autophagy in wild-type (wt) macrophages, whereas NOD2-deficient macrophages remain unstimulated 7. Gene variants with subsequent decreased activity of NOD2 and ATG16L1 proteins are associated with an increased risk of developing the chronic intestinal disorder, Crohn's disease (CD), an inflammatory bowel disease characterized by a transmural and relapsing inflammation 8,9. NOD2 polymorphisms are also related to early onset of ileal CD 10, indicating that disease susceptibility is increased by altering signalling interactions between intestinal microbiota and the mucosal innate immunity.

Most Gram-negative and -positive bacteria carry the N-acetyl-muramyl-L-alanyl-D-isoglutamine PGN moiety, usually referred to as N-acetyl (A)-MDP 11. In contrast, PGN in mycobacteria and related the Actinomycetes is comprised of N-glycolyl (G)-MDP polymer, forming a lattice surrounding the entire cell 12. Controversially, mycobacterial infections have been proposed to be linked to CD 13. Moreover, studies in rodents have suggested NOD2 to be a more specific sensor of G-MDP 14, and thus a sensor of mycobacterial infections. In the present study, we aimed to investigate if A-MDP and G-MDP are sensed differently in human peripheral blood mononuclear cells (PBMCs) and if these differences are translated into distinct responses to bacteria carrying either G-MDP or the same bacteria mutant in the enzyme A-MDP hydroxylase (namH), which converts A-MDP to G-MDP 15. Further, our aim was to investigate how the A-MDP and G-MDP responses, including responses to A-MDP- and G-MDP-producing bacteria, are affected by CD-associated NOD2 gene variants in order to determine whether NOD2 gene variants might cause bacteria species-specific changes in bacterial handling among CD patients. Identification of CD associated changes in species-specific bacterial sensing would clarify some of the mechanisms behind host-determined changes in the microbiota of CD patients.

Materials and methods

Study participants

Patients with CD were all attending the out-patient clinic of Department of Gastroenterology, Medical Section, Herlev Hospital, Copenhagen. All patients were in complete clinical remission, as judged by the physician's overall impression and with a Harvey and Bradshaw 16 score <5 for at least 4 weeks, and did not receive glucocorticoids or biologicals for at least 3 months. Long-term treatment with thiopurines was allowed if the dosing had been stable for more than 2 months. This study included healthy human volunteers wt in both NOD2 and ATG16L1 (n = 8), wt CD patients (n = 9), NOD2-variant/wt ATG16L1 CD patients (n = 7) and wtNOD2/ATG16L1-variant CD patients (n = 6).

Genotyping of NOD2 and ATG16L1

Genomic DNA was isolated from whole-blood samples collected from patients and healthy controls using standard procedures. Screening for the common NOD2 polymorphisms [SNP8 (Arg702Trp), SNP12 (Gly908Arg) and SNP13 (Leu1007fsinsC)] was performed as described earlier by Yazdanyar et al. 17. Screening for the ATG16L1 rs2241880 (T300A) polymorphism was performed using the TaqMan single nucleotide polymorphism (SNP) genotyping (Applied Biosystems, Foster City, CA, USA).

PBMCs isolation and stimulation and cytokine measurements

Collected whole blood was diluted 1 : 2 with phosphate-buffered saline (PBS; Gibco Invitrogen Ltd, Paisley, UK) containing ethylenediamine tetraacetic acid (EDTA). Finally, PBMCs were separated from whole blood by Ficoll-Paque density gradient centrifugation according to the manufacturer's instructions (GE Healthcare, Uppsala, Sweden). After PBMC isolation, 1 × 106 cells were plated in 24-well plates (TPP, Trasadingen, Switzerland) in 450 μl growing medium (RPMI-1640 medium containing 10% fetal calf serum, 50 IU/ml penicillin, 50 μg/ml streptomycin and 0·5 mg/ml gentamycin) at 37°C in an atmosphere of 5% CO2 and a relative humidity of 90%. The cells were rested overnight and were subsequently stimulated by adding either 1 μg/ml of A-MDP or G-MDP, Mycobacterium segmatis, M. segmatisΔnamH, mutant in namH 15, Listeria monocytogenes (LM) or M. avium paratuberculosis (MAP) for 4 h. A-MDP and G-MDP was purchased from (Sigma-Aldrich, St Louis, MO, USA) and (InvivoGen, San Diego, CA, USA), respectively. M. segmatis and M. segmatisΔnamH were kindly provided by Dr Marcel Behr, McGill University Health Centre, Montreal, Canada. LM and MAP bacteria were generously provided from the Danish Technical University, Copenhagen, Denmark. The bacteria were grown in standard conditions to 2 × 108 colony-forming units (CFU)/ml and heat-inactivated for 30 min at 95°C. The immunological response of TNF-α was measured in cell culture supernatants using a commercially available enzyme-linked immunosorbent assay (ELISA) kit (Diaclone Research, Besançon, France). Interleukin (IL)-1β, IL-6, IL-10 and IL-18 levels were determined by multiplex bead array (Luminex) using specific kits (Bio-Rad, Hercules, CA, USA). ELISAs and bead arrays were performed as specified by the manufacturers.

Real-time quantitative polymerase chain reaction (qPCR)

Total RNA from PBMC was isolated and qPCR was performed as described previously 18. Gene expression of TNF-α was calculated by its ratio to the housekeeping gene human Ribosomal Protein Large P0 (RPLP0), which was amplified in parallel reactions. The primer sequences were: RPLP0 forward GCTTCCTGGAGGGTGTCC, RPLP0 reverse GGACTCGTTTGTACCCGTTG; TNF-α forward ATGAGCACTGAAAGCATGATCC, TNF-α reverse GAGGGCTGATTAGAGAGGTC.

Immunofluorescence

To stain intracellular bacteria, 20-μl samples of infected or uninfected PBMC cultures were fixed with paraformaldehyde 4% in PBS, spotted onto glass slides and dried at ambient temperature. MAP was stained with the auramine fluorochrome kit (no. 05151; Sigma-Aldrich, Buchs, Switzerland) and LM were detected using fluorescein isothiocyanate (FITC)-labelled rabbit polyclonal immunoglobulin (Ig)G (no. 5688-1995; ABD Serotec, Oxford, UK), according to the manufacturer's directions. The slides were washed and stained with the DNA-specific fluorochrome 4′,6-diamidino-2-phenylindole (DAPI). Cells were examined by phase-contrast and fluorescent microscopy with a Zeiss CLSM 770 microscope.

Western blot

PBMCs were lysed with RP1 buffer (Macherey-Nagel, Düren, Germany) and treated according to the RNA-protein purification protocol. The protein flow-through was resolved in protein solution buffer with 2% sodium dodecyl sulphate (SDS). The samples were then heated at 70°C for 15 min and run on a 4–12% gradient SDS acrylamide gel under reducing conditions. Proteins were transferred to a polyvinylidene difluoride membranes (Expedeon Inc., San Diego, CA, USA), the membranes were blocked with Bløk (Millipore, Billerica, MA, USA), incubated with the primary antibody (1 : 1000) overnight at 4°C and the horseradish peroxidase-conjugated secondary antibody was added (DakoCytomation, Copenhagen, Denmark) and detected by enhanced chemiluminescence (ProteinSimple, Santa Clara, CA, USA). The primary antibodies were: IL-1 receptor-associated kinase 4 (pIRAK-4), receptor-interacting protein 2 (pRIP2) (Cell Signaling Technology, Danvers, MA, USA) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Fitzgerald, Acton, MA, USA) for the loading control.

Statistics

Data were expressed as medians with interquartile ranges. Comparisons between groups were performed using the Mann–Whitney U-test. A two-sided P-value < 0·05 was considered significant.

Ethics statement

The study has been approved by the Scientific Ethics Committee of the Copenhagen Capital Region. Written informed consent from all included patients was obtained prior to participation and the project fulfilled the Helsinki V Declaration.

Results

NOD2 pathway has higher responses towards A-MDP than G-MDP

To address the effect of different MDP types in human cells, we assessed mRNA expression and protein secretion of TNF-α in PBMCs derived from controls with wtNOD2/wtATG16L1, CD patients with wtNOD2/wtATG16L1, CD patients with NOD2 variants/wtATG16L1 and CD patients with wtNOD2/ATG16L1 variant. Initially, we aimed to identify ATG16L1-dependent variations in NOD2 responses to ensure that our experiments on NOD2 were not flawed by the ATG16L1 genotype. The ATG16L1 T300A polymorphism modulates the MDP-induced TNF-α response in which the mRNA expression and production of TNF-α in ATG16L1 variant was diminished significantly after stimulation with MDP types (Fig. 1a,b). Therefore, we decided to include only ATG16L1 wt in subsequent experiments. The mRNA expression of NOD2 was similar in all three groups before and after A-MDP stimulation (data not shown). Conversely, mRNA expression levels and secretion of TNF-α was increased in all groups in response to A-MDP or G-MDP compared to unstimulated PBMCs (Fig. 1a,b). A-MDP stimulation of wt control PBMCs led to significantly higher TNF-α production compared to G-MDP (P = 0·02). A similarly increased response towards A-MDP compared to G-MDP was also seen in wt CD, but without reaching significance (P > 0·05). Stimulation of TNF-α secretion was largely absent in NOD2 variants in comparison to wt control subjects (P = 0·02) and wt CD patients (P = 0·01), confirming previous findings that variants in NOD2 impair immune responses to MDP 19,20.

Fig 1.

Fig 1

Open in a new tab

Acetylated form of muramyl-dipeptide (A-MDP) induces stronger human nucleotide oligomerization domain 2 (NOD2)-mediated response than N-glycolyl MDP (G-MDP). Peripheral blood mononuclear cells (PBMC) from controls with wild-type (wt)NOD2/wtATG16L1, Crohn's disease (CD) with wtNOD2/wtATG16L1, CD with NOD2-variants/wtATG16L1 and CD with wtNOD2/ATG16L1-variants were added to heat-treated medium (unstimulated), or stimulated with 1 μg/ml A-MDP or G-MDP for 4 h. (a) The gene expression of tumour necrosis factor (TNF)-α [quantitative polymerase chain reaction (qPCR)], (b) The production of TNF-α in cell supernatants were measured [enzyme-linked immunosorbent assay (ELISA)] and (c) TNF-α production in cell supernatants from PBMCs isolated from controls with wtNOD2/wtATG16L1 and stimulated with either Mycobacterium segmatis or M. segmatisΔnamH for 4 h (ELISA). Data were given as medians (interquartile range). Comparisons between groups were performed using the Mann–Whitney U-test. Due to lack of differences in the unstimulated cells, data from all groups were pooled together. *Presents a significant TNF-α change compared with the unstimulated cells. A two-sided P-value < 0·05 was considered significant.

To confirm the increased A-MDP-stimulating activity, we treated PBMCs from healthy controls with M. segmatis or M. segmatisΔnamH (Fig. 1c). The TNF-α level produced was found to be significantly higher (P = 0·03) after treatment with the A-MDP expressing bacteria, M. segmatisΔnamH, than the G-MDP expressing bacteria, M. segmatis, which is in agreement with previous data (Fig. 1b).

NOD2 is not essential for optimal recognition of MAP

In order to examine the role of NOD2 in recognition of intracellular bacteria associated with infections of the gastrointestinal tract, PBMCs were stimulated with LM (an A-MDP containing bacterium) 21 or MAP (a G-MDP containing bacterium). Immunofluorescence staining was applied to confirm the intracellular localization. The rod length of MAP and LM ranges between 1·5–4·0 μm 22 and 0·5–1·5 μm 23, respectively. PBMCs were able to internalize these bacteria (Fig. 2). TNF-α levels were elevated significantly in all four groups compared to unstimulated PBMCs (Fig. 3). No differences were seen for the response to LM and MAP between wt controls or wt CD. In contrast, the protein level of TNF-α was decreased significantly in NOD2-variant PBMCs compared with wt controls (P = 0·04) after treatment with LM.

Fig 2.

Fig 2

Open in a new tab

Peripheral blood mononuclear cells (PBMC) could internalize Listeria monocytogenes (LM) and M. avium paratuberculosis (MAP). The PBMC's ability to internalize LM or MAP was determined by immunofluorescence staining (a) with fluorescence auramine staining for MAP (green), and (b) with a fluorescently labelled antibody against LM (green). Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) (blue). Fluorescence was observed using a ×100 objective (1·4 numerical aperture).

Fig 3.

Fig 3

Open in a new tab

Peripheral blood mononuclear cells (PBMC) response towards infection with Listeria monocytogenes (LM) or Mycobacterium avium paratuberculosis (MAP). Tumour necrosis factor (TNF)-α levels were measured in cell culture supernatants using enzyme-linked immunosorbent assay (ELISA). Data are given as medians (interquartile range). Comparisons between groups were performed using the Mann–Whitney U-test. *Presents a significant TNF-α change compared with the unstimulated cells. A two-sided P-value < 0·05 was considered significant. wt, wild type.

MAP activates TLRs whereas LM activates NOD receptors

To investigate whether the infection with LM and MAP might induce differences in pattern recognition receptor (PRR)-activated pathways such as NOD2 and TLRs, Western blot was used to detect the active form (phosphorylated) of central downstream proteins in these pathways. RIP2 constitutes a critical step in the NOD2-signalling pathway 24, whereas the TLR activation cascade leads to induction of p-IRAK4 25,26. Stimulation with A-MDP, G-MDP, LM or MAP led to detectable activation of RIP2 under all conditions (Fig. 4a–c). However, the level of pRIP2 was markedly lower in NOD2-variant PBMCs (Fig. 4c). Additionally, stimulation with A-MDP, G-MDP or LM failed to activate IRAK4, whereas stimulation with MAP was able to activate IRAK4 (Fig. 4a–c).

Fig 4.

Fig 4

Open in a new tab

Only Mycobacterium avium paratuberculosis (MAP) could activate interleukin-1 receptor-associated kinase-4 (IRAK-4). Peripheral blood mononuclear cells (PBMC) were added to heat-treated medium (unstimulated) or stimulated with either the acetylated form of MDP (A-MDP), N-glycolyl MDP (G-MDP), heat-killed Listeria monocytogenes (LM) or MAPfor 4 h. Cells were lysed and protein fractions were collected and analysed by Western blotting with antibodies against pIRAK-4, phospholipase C-related but catalytically inactive protein (pRIP2) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (a) Control with wild-type (wt)NOD2/wtATG16L1, (b) CD with wtNOD2/wtATG16L1 and (c) CD with variant-NOD2/wtATG16L1.

Cytokine production after bacterial stimulation

IL-1β, IL-6 and IL-18, as well as the anti-inflammatory cytokine, IL-10, were quantified to assess the cellular response to MDP stimulation (Fig. 5). Whereas the release of IL-18 was generally unchanged, IL-1β, IL-6 and IL-10 were up-regulated significantly upon LM or MAP stimulation. Release of IL-1β and IL-10 were significantly higher after MAP stimulation compared with LM. In addition, the secretion of both IL-1β and IL-10 was unaffected by the genetic variation in NOD2.

Fig 5.

Fig 5

Open in a new tab

Secretion of interleukin (IL)-1β, IL-6, IL-10 and IL-18. Peripheral blood mononuclear cells (PBMC) from controls with wild-type (wt)NOD2/wtATG16L1, CD with wtNOD2/wtATG16L1 and Crohn's disease (CD) with nucleotide oligomerization domain 2 (NOD2)-variants/wtATG16L1 were added to heat-treated medium (unstimulated) or stimulated with either heat-killed Listeria monocytogenes (LM) or Mycobacterium avium paratuberculosis (MAP) for 4 h. The release of (a) IL-1β, (b) IL-6, (c) IL-10 and (d) IL-18 were then measured in cell culture supernatants using multiplex bead array (Luminex). Data were given as medians (interquartile range). Due to no difference in the release of ILs in the unstimulated cells, data from all groups were pooled together. Comparisons between groups were done using the Mann–Whitney U-test. *Presents a significant change of the ILs compared with the unstimulated cells. A two-sided P-value < 0·05 was considered significant.

Discussion

The present study showed that humans and mice have an opposing NOD2-mediated innate MDP response 14: our experiments revealed that NOD2-mediated responses are induced more effectively by A-MDP than G-MDP, and suggest that A-MDP expressing bacteria are recognized more efficiently by NOD2 in human PBMCs. Thus, NOD2 gene variants might participate in the microbiota changes seen in CD and influence the bacterial clearance in this disease.

Initially, the NOD2-mediated response in the presence of the loss-of-function mutation of ATG16L1 was investigated, because the prevalence of ATG16L1 polymorphisms is high in the healthy European population and because of the close functional connection between NOD2 and ATG16L1 4,7. Our findings show that the ATG16L1 T300A variant is associated with a decreased MDP-induced TNF-α response (Fig. 1a,b). These results are in line with earlier data showing a decreased TNF-α production upon autophagy inhibition in human monocytes 27. Thus, this alternation of ATG16L1-mediated autophagy might lead to a negative regulation of NOD2-dependent responses.

The MDP types have been studied in experimental murine models where the G-MDP variant has shown a greater NOD2-stimulating activity than A-MDP 14. However, our observations in human PBMCs were opposing these results; in fact, the present study demonstrates a weaker response with respect to TNF-α secretion upon G-MDP- or G-MDP-expressing bacteria, M. segmatisΔnamH stimulation, compared to A-MDP- or A-MDP-expressing bacteria, M. segmatis, in PBMCs, whereas no differences were observed in the mRNA expression of TNF-α (Fig. 1). NOD2 polymorphisms and the infection of MAP have been suggested as contributors to CD pathogenesis 8,28,29. We therefore investigated the immune response towards different MDP types in two intracellular bacteria associated with gastrointestinal infections: A-MDP-containing bacteria (LM) and G-MDP-containing bacteria (MAP). Recognition of these bacteria by NOD2 requires prior internalization by PBMCs. Both bacteria were internalized by PBMCs (Fig. 2), and an elevated TNF-α production was also observed (Fig. 3). The secreted TNF-α levels were significantly lower in NOD2 variants after stimulation with LM compared to MAP (Fig. 3). This finding should be interpreted with caution, as many factors, apart from the differences in A-MDP and G-MDP expression, might influence the response, but the result does not contradict that NOD2 is a more specific receptor for LM than MAP. However, the subsequent finding that TLR-dependent IRAK4 was activated by MAP and not LM, combined with an increased activation of NOD2-dependent RIP2 in LM-stimulated cells, further substantiates that NOD2 is not of importance for MAP recognition in human PBMCs (Fig. 4). IRAK-4 deficiency predisposes patients to life-threatening bacterial infections (e.g. invasive pneumococcal infections) in infancy and early childhood cases of MAP infections in these patients have been described, further emphasizing the importance of TLR/IRAK4 signalling for MAP recognition 30. In summary, these results reveal that LM stimulates TNF-α production in PBMCs via a NOD2-dependent pathway, whereas MAP is probably an inducer of both NOD2- and IRAK4-mediated signalling.

Finally, we investigated the impact of the loss-of-function NOD2 variants on synthesis of pro- and anti-inflammatory cytokines (Fig. 5). The released cytokines were unaffected by genetic variations of NOD2. However, the MAP infections seemed to induce elevated levels of both IL-1β and IL-10 compared with LM. The increased production of IL-1β could be dependent upon TLR induction, as it is observed only after stimulation with MAP. These findings are in accordance with an earlier study suggesting that the release of IL-1β, but not of IL-18, depends upon TLR stimulation 31. Conversely, our observations are in contrast to earlier experimental studies in murine dendritic cells which suggested a prerequisite role of NOD2 for the production IL-6 and IL-10 in response to MAP 32,33. Such differences in cytokine responses might be cell-specific. However, humans and mice show markedly different sensitivities toward bacterial endotoxins, and expression patterns as well as transcriptional regulation of TLRs (e.g. TLR-4 in particular) differ markedly between rodents and humans, indicating different physiological functions and different roles for innate immunity 34.

Our study has several strengths, but also some limitations. We examined the immune response and signalling pathways activated against two different pathogenic bacteria in human PBMCs obtained from a tightly controlled cohort. We included both healthy controls and CD patients, and used highly sensitive analytical instruments and assays. In this manner we were able to make substantial observations in the human response that differ from those obtained in experimental murine models. However, one of the considerable limitations of this study was the restricted number of subjects in the patient cohort, as it was a requirement that all healthy controls and patients included should be wtATG16L1 (a frequent variation in this gene, approximately 48–52%, exists in the European population) 35–38.

In conclusion, our data indicate that NOD2 may play a minor role in recognition of MAP by the fact that G-MDP promotes a weaker NOD2-mediated response compared to A-MDP. MAP mainly induced TLR-mediated signalling in our experimental setting. These findings are contrary to previous findings in mice. Our experiments do not provide a molecular explanation for this difference between human and mouse NOD2, but we suggest that the difference could be explained by the gene differences in NOD2 between the species. Consequently, genetically determined changes in the innate handling of bacteria in CD (e.g. by NOD2 variants) might, rather, affect the immunological responses towards A-MDP expressing bacteria. This would lead to a deficiency in the handling of a wider array of bacteria and could explain the increased risk of infections among these patients 39.

Acknowledgments

This work was supported by grants from the Axel Muusfeldts Foundation, Holger og Ruth Hesses Mindefond, Else og Mogens Wedell-Wedellsborgs Foundation, Direktør Kurt Bønnelycke og hustru fru Grethe Bønnelyckes Foundation, P. A. Messerchmidt og Hustrus Foundation, Kong Christian den Tiendes Fond and the Foundation of Aase and Ejnar Danielsen. The funders had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript. We thank Anni Petersen, Birgit Deibjerg Kristensen, Hanne Fuglsang, Nine Scherling, Noor Irmam, Tine Helene Soendergaard and Vibeke Voxen Hansen for excellent technical assistance. We also thank Professor Søren Riis Paludan for cytokine measurement by Luminex and Associate Professor Thomas Bjarnsholt for his contribution to the immunofluorescence analysis.

Disclosure

The authors do not have commercial or other associations that might pose a conflict of interest.

References

  1. Geremia A, Biancheri P, Allan P, Corazza GR, Di SA. Innate and adaptive immunity in inflammatory bowel disease. Autoimmun Rev. 2014;13:3–10. doi: 10.1016/j.autrev.2013.06.004. [DOI] [PubMed] [Google Scholar]
  2. Mo J, Boyle JP, Howard CB, Monie TP, Davis BK, Duncan JA. Pathogen sensing by nucleotide-binding oligomerization domain-containing protein 2 (NOD2) is mediated by direct binding to muramyl dipeptide and ATP. J Biol Chem. 2012;287:23057–23067. doi: 10.1074/jbc.M112.344283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Sutterwala FS, Haasken S, Cassel SL. Mechanism of NLRP3 inflammasome activation. Ann NY Acad Sci. 2014;1319:82–95. doi: 10.1111/nyas.12458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Salem M, Seidelin JB, Rogler G, Nielsen OH. Muramyl dipeptide responsive pathways in Crohn's disease: from NOD2 and beyond. Cell Mol Life Sci. 2013;70:3391–3404. doi: 10.1007/s00018-012-1246-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Hasegawa M, Fujimoto Y, Lucas PC, et al. A critical role of RICK/RIP2 polyubiquitination in Nod-induced NF-kappaB activation. EMBO J. 2008;27:373–383. doi: 10.1038/sj.emboj.7601962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Philpott DJ, Sorbara MT, Robertson SJ, Croitoru K, Girardin SE. NOD proteins: regulators of inflammation in health and disease. Nat Rev Immunol. 2014;14:9–23. doi: 10.1038/nri3565. [DOI] [PubMed] [Google Scholar]
  7. Travassos LH, Carneiro LA, Ramjeet M, et al. Nod1 and Nod2 direct autophagy by recruiting ATG16L1 to the plasma membrane at the site of bacterial entry. Nat Immunol. 2010;11:55–62. doi: 10.1038/ni.1823. [DOI] [PubMed] [Google Scholar]
  8. Hugot JP, Chamaillard M, Zouali H, et al. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn's disease. Nature. 2001;411:599–603. doi: 10.1038/35079107. [DOI] [PubMed] [Google Scholar]
  9. Hampe J, Franke A, Rosenstiel P, et al. A genome-wide association scan of nonsynonymous SNPs identifies a susceptibility variant for Crohn disease in ATG16L1. Nat Genet. 2007;39:207–211. doi: 10.1038/ng1954. [DOI] [PubMed] [Google Scholar]
  10. Ahmad T, Tamboli CP, Jewell D, Colombel JF. Clinical relevance of advances in genetics and pharmacogenetics of IBD. Gastroenterology. 2004;126:1533–1549. doi: 10.1053/j.gastro.2004.01.061. [DOI] [PubMed] [Google Scholar]
  11. Ogawa C, Liu YJ, Kobayashi KS. Muramyl dipeptide and its derivatives: peptide adjuvant in immunological disorders and cancer therapy. Curr Bioact Compd. 2011;7:180–197. doi: 10.2174/157340711796817913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Azuma I, Thomas DW, Adam A, et al. Occurrence of N-glycolylmuramic acid in bacterial cell walls. A preliminary survey. Biochim Biophys Acta. 1970;208:444–451. doi: 10.1016/0304-4165(70)90217-5. [DOI] [PubMed] [Google Scholar]
  13. Lalande JD, Behr MA. Mycobacteria in Crohn's disease: how innate immune deficiency may result in chronic inflammation. Expert Rev Clin Immunol. 2010;6:633–641. doi: 10.1586/eci.10.29. [DOI] [PubMed] [Google Scholar]
  14. Coulombe F, Divangahi M, Veyrier F, et al. Increased NOD2-mediated recognition of N-glycolyl muramyl dipeptide. J Exp Med. 2009;206:1709–1716. doi: 10.1084/jem.20081779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Raymond JB, Mahapatra S, Crick DC, Pavelka MS., Jr Identification of the namH gene, encoding the hydroxylase responsible for the N-glycolylation of the mycobacterial peptidoglycan. J Biol Chem. 2005;280:326–333. doi: 10.1074/jbc.M411006200. [DOI] [PubMed] [Google Scholar]
  16. Harvey RF, Bradshaw JM. A simple index of Crohn's-disease activity. Lancet. 1980;1:514. doi: 10.1016/s0140-6736(80)92767-1. [DOI] [PubMed] [Google Scholar]
  17. Yazdanyar S, Nordestgaard BG. NOD2/CARD15 genotype and common gastrointestinal diseases in 43 600 individuals. J Intern Med. 2010;267:228–236. doi: 10.1111/j.1365-2796.2009.02137.x. [DOI] [PubMed] [Google Scholar]
  18. Seidelin JB, Broom OJ, Olsen J, Nielsen OH. Evidence for impaired CARD15 signalling in Crohn's disease without disease linked variants. PLOS ONE. 2009;4:e7794. doi: 10.1371/journal.pone.0007794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Bonen DK, Ogura Y, Nicolae DL, et al. Crohn's disease-associated NOD2 variants share a signaling defect in response to lipopolysaccharide and peptidoglycan. Gastroenterology. 2003;124:140–146. doi: 10.1053/gast.2003.50019. [DOI] [PubMed] [Google Scholar]
  20. Wehkamp J, Harder J, Weichenthal M, et al. NOD2 (CARD15) mutations in Crohn's disease are associated with diminished mucosal alpha-defensin expression. Gut. 2004;53:1658–1664. doi: 10.1136/gut.2003.032805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kamisango K, Saiki I, Tanio Y, et al. Structures and biological activities of peptidoglycans of Listeria monocytogenes and Propionibacterium acnes. J Biochem. 1982;92:23–33. doi: 10.1093/oxfordjournals.jbchem.a133918. [DOI] [PubMed] [Google Scholar]
  22. Cook GM, Berney M, Gebhard S, et al. Physiology of mycobacteria. Adv Microb Physiol. 2009;55:81–89. doi: 10.1016/S0065-2911(09)05502-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Rocourt J, Boerlin P, Grimont F, Jacquet C, Piffaretti JC. Assignment of Listeria grayi and Listeria murrayi to a single species, Listeria grayi, with a revised description of Listeria grayi. Int J Syst Bacteriol. 1992;42:171–174. doi: 10.1099/00207713-42-1-171. [DOI] [PubMed] [Google Scholar]
  24. Tigno-Aranjuez JT, Abbott DW. Ubiquitination and phosphorylation in the regulation of NOD2 signaling and NOD2-mediated disease. Biochim Biophys Acta. 2012;1823:2022–2028. doi: 10.1016/j.bbamcr.2012.03.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kawagoe T, Sato S, Jung A, et al. Essential role of IRAK-4 protein and its kinase activity in Toll-like receptor-mediated immune responses but not in TCR signaling. J Exp Med. 2007;204:1013–1024. doi: 10.1084/jem.20061523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kim TW, Staschke K, Bulek K, et al. A critical role for IRAK4 kinase activity in Toll-like receptor-mediated innate immunity. J Exp Med. 2007;204:1025–1036. doi: 10.1084/jem.20061825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Crisan TO, Plantinga TS, van de Veerdonk FL, et al. Inflammasome-independent modulation of cytokine response by autophagy in human cells. PLOS ONE. 2011;6:e18666. doi: 10.1371/journal.pone.0018666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mendoza JL, Lana R, Diaz-Rubio M. Mycobacterium avium subspecies paratuberculosis and its relationship with Crohn's disease. World J Gastroenterol. 2009;15:417–422. doi: 10.3748/wjg.15.417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Hisamatsu T, Suzuki M, Reinecker HC, Nadeau WJ, McCormick BA, Podolsky DK. CARD15/NOD2 functions as an antibacterial factor in human intestinal epithelial cells. Gastroenterology. 2003;124:993–1000. doi: 10.1053/gast.2003.50153. [DOI] [PubMed] [Google Scholar]
  30. Picard C, von Bernuth H, Ghandil P, et al. Clinical features and outcome of patients with IRAK-4 and MyD88 deficiency. Medicine (Balt) 2010;89:403–425. doi: 10.1097/MD.0b013e3181fd8ec3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kupz A, Guarda G, Gebhardt T, et al. NLRC4 inflammasomes in dendritic cells regulate noncognate effector function by memory CD8(+) T cells. Nat Immunol. 2012;13:162–169. doi: 10.1038/ni.2195. [DOI] [PubMed] [Google Scholar]
  32. Gandotra S, Jang S, Murray PJ, Salgame P, Ehrt S. Nucleotide-binding oligomerization domain protein 2-deficient mice control infection with Mycobacterium tuberculosis. Infect Immun. 2007;75:5127–5134. doi: 10.1128/IAI.00458-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Ferwerda G, Girardin SE, Kullberg BJ, et al. NOD2 and toll-like receptors are nonredundant recognition systems of Mycobacterium tuberculosis. PLOS Pathog. 2005;1:279–285. doi: 10.1371/journal.ppat.0010034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lichtinger M, Ingram R, Hornef M, Bonifer C, Rehli M. Transcription factor PU.1 controls transcription start site positioning and alternative TLR4 promoter usage. J Biol Chem. 2007;282:26874–26883. doi: 10.1074/jbc.M703856200. [DOI] [PubMed] [Google Scholar]
  35. Glas J, Konrad A, Schmechel S, et al. The ATG16L1 gene variants rs2241879 and rs2241880 (T300A) are strongly associated with susceptibility to Crohn's disease in the German population. Am J Gastroenterol. 2008;103:682–691. doi: 10.1111/j.1572-0241.2007.01694.x. [DOI] [PubMed] [Google Scholar]
  36. Prescott NJ, Fisher SA, Franke A, et al. A nonsynonymous SNP in ATG16L1 predisposes to ileal Crohn's disease and is independent of CARD15 and IBD5. Gastroenterology. 2007;132:1665–1671. doi: 10.1053/j.gastro.2007.03.034. [DOI] [PubMed] [Google Scholar]
  37. Lakatos PL, Szamosi T, Szilvasi A, et al. ATG16L1 and IL23 receptor (IL23R) genes are associated with disease susceptibility in Hungarian CD patients. Dig Liver Dis. 2008;40:867–873. doi: 10.1016/j.dld.2008.03.022. [DOI] [PubMed] [Google Scholar]
  38. Sventoraityte J, Zvirbliene A, Franke A, et al. NOD2, IL23R and ATG16L1 polymorphisms in Lithuanian patients with inflammatory bowel disease. World J Gastroenterol. 2010;16:359–364. doi: 10.3748/wjg.v16.i3.359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Marks DJ, Harbord MW, MacAllister R, et al. Defective acute inflammation in Crohn's disease: a clinical investigation. Lancet. 2006;367:668–678. doi: 10.1016/S0140-6736(06)68265-2. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES