Expanding CEP290 mutational spectrum in ciliopathies

Abstract

Ciliopathies are an expanding group of rare conditions characterised by multiorgan involvement, that are caused by mutations in genes encoding for proteins of the primary cilium or its apparatus. Among these genes, CEP290 bears an intriguing allelic spectrum, being commonly mutated in Joubert syndrome and related disorders (JSRD), Meckel syndrome (MKS), Senior-Loken syndrome and isolated Leber congenital amaurosis (LCA). Although these conditions are recessively inherited, in a subset of patients only one CEP290 mutation could be detected.

To assess whether genomic rearrangements involving the CEP290 gene could represent a possible mutational mechanism in these cases, exon dosage analysis on genomic DNA was performed in two groups of CEP290 heterozygous patients, including five JSRD/MKS cases and four LCA, respectively. In one JSRD patient, we identified a large heterozygous deletion encompassing CEP290 C-terminus, that resulted in marked reduction of mRNA expression. No copy number alterations were identified in the remaining probands.

The present work expands the CEP290 genotypic spectrum to include multiexon deletions. Although this mechanism does not appear to be frequent, screening for genomic rearrangements should be considered in patients in whom a single CEP290 mutated allele was identified.

INTRODUCTION

Primary cilia are sensory “antenna-like” organelles found at the cell surface of several tissue types, such as the epithelium of renal tubules and bile ducts, retinal photoreceptors and neuronal cells in fetal and adult brain. These sophisticated microtubule-based organelles have been shown to sense multiple mechanical and chemical signals from the environment and to elicit specific cellular responses, which play crucial roles in embryonic development and homeostatic processes in adulthood [Singla and Reiter, 2006; Vogel, 2005; Eggenschwiler and Anderson, 2007]. Mutations in ciliary genes give rise to a multitude of human disorders that are collectively known as “ciliopathies”. This class of rare diseases can either involve a single organ or occur as multisystemic disorders, with variable and partly overlapping clinical features mainly involving the central nervous system, kidneys, eyes and liver. Typical ciliopathies include polycystic kidney diseases, isolated nephronophthisis, Bardet-Biedl (BBS), Alstrom, Meckel (MKS), Senior-Loken (SLS) and oro-facio-dygital type 1 (OFD1) syndromes [Badano et al., 2006].

In recent years, ciliopathies have been expanded to include Joubert syndrome and related disorders (JSRD), a group of autosomal recessive conditions characterized by a distinctive midbrain-hindbrain malformation (the “molar tooth sign” - MTS). In fact, protein products of all known JSRD genes (AHI1, NPHP1, CEP290, TMEM67, RPGRIP1L, ARL13B and CC2D2A) have been found to localize and function in the primary cilium/basal body organelle [Valente et al., 2008; Cantagrel et al., 2008; Gorden et al., 2008]. Recent data indicate that JSRD and MKS are allelic at several of these loci (CEP290, TMEM67, RPGRIP1L and CC2D2A), and the MKS phenotype is now recognized as the most severe manifestation of the JSRD clinical spectrum [Baala et al., 2007;Baala et al., 2007; Delous et al., 2007; Gorden et al., 2008].

Mutation screenings of large cohorts of JSRD patients have allowed establishing solid correlates between these genes and specific clinical subgroups defined on the basis of multiorgan involvement [Valente et al., 2008; Zaki et al., 2008; Brancati et al., 2009]. In particular, we have recently demonstrated that mutations of the CEP290 gene are responsible for about 50% of the Cerebello-Oculo-Renal (COR) subgroup, characterized by neurological involvement, MTS, nephronophthisis and retinal dystrophy, while they are rarely detected in other JSRD phenotypes [Brancati et al., 2007].

The CEP290 gene has 54 exons and presents a wide allelic spectrum. Indeed, besides JSRD-COR and MKS, mutations in this gene can also cause SLS [Helou et al., 2007], and a recurrent intronic mutation leading to abnormal splicing has been found in a conspicuous proportion of cases with isolated Leber congenital amaurosis (LCA) [den Hollander et al., 2006; Perrault et al., 2007].

So far, nearly 100 distinct CEP290 mutations have been described, most of which were either nonsense, frameshift or splice-site mutations predicted to exert a loss-of-function effect on the resulting protein. In our screening of JSRD patients, we identified two CEP290 mutations in 16 probands, while in other five patients only a single mutated allele could be detected [Brancati et al., 2007]. Similarly, other studies have reported the occurrence of single heterozygous CEP290 mutations in patients with JSRD/MKS, SLS and isolated LCA [Helou et al., 2007; Baala et al., 2007; Perrault et al., 2007].

Here, we report on the identification of a large heterozygous genomic rearrangement leading to CEP290 partial deletion in one of these patients. This result broadens the genotypic spectrum of CEP290, with relevant implications in terms of its molecular analysis.

PATIENTS AND METHODS

Patients

Two groups of patients who carried a single CEP290 mutated allele were selected (Table I). The first group consisted of four JSRD probands with COR phenotype and one fetus with MKS, while the second group included four probands with isolated LCA [Brancati et al., 2007; Baala et al., 2007; Perrault et al., 2007]. Proband and parental DNA samples were available from all families, that had previously given written informed consent for CEP290 mutation screening. Family COR001 was re-consented in order to take fresh blood samples for mRNA analysis.

Table I.

Patients with a single CEP290 mutated allele who were included in the study.

Patient	Allele 1		Reference
	DNA Alteration	Effect
JSRD/MKS*
COR001	c.5489_5493delA	p.A1832PfsX1	[Brancati et al., 2007]
COR002a	c.6870delT	p.Q2291KfsX	[Brancati et al., 2007]
MTI125	c.4393C>T	p.R1465X	[Brancati et al., 2007]
MTI286	c.4393C>T	p.R1465X	[Brancati et al., 2007]
05/158*	c.1984C>T	p.Q662X	[Baala et al., 2007]
Isolated LCA
848,4	c.4723A>T	p.L1575X	cousin of 848 [Perrault et al., 2007]
196	c.2991+1655A>G	p.C998X	[Perrault et al., 2007]
317	c.2991+1655A>G	p.C998X	[Perrault et al., 2007]
446	c.3934A>T	p.R1312X	unpublished

Dosage analysis on genomic DNA

Genomic DNA was purified from peripheral blood leucocytes in patients and parents or frozen tissue in the fetal case, following standard methods. Dosage analysis of all exons of CEP290 and, subsequently, of the C12orf29 and C12orf50 genes (for family COR001) was performed by Quantitative Real-Time PCR (QRT-PCR), using Power SYBR Green I dye chemistry and an ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, California, USA). Primer pairs for each exon of tested genes were designed by Primer Express 2.0 software (Applied Biosystems), and polymorphisms in the primer binding sites were excluded. CEP290 primers are listed in Table II (primers for C12orf29 and C12orf50 exons are available on request).

Table II.

CEP290 primers for genomic QRT-PCR

Exons	Forward primer (5′ to 3′)	Reverse primer (5′ to 3′)
5′-UTR	CGGTCGTGAACTGTAGGCTCT	GCTGCTAGGCGACACCATC
2	GGTGGAGCACAGTGAAAGAATTC	TCTGCCAGTTCTTCTTGACGG
3	GTTGCTTTTCTGTTTACTTAGGTGGA	AATTCTGAAAAGGTGTATCACATTTT
4	CTCAAGAAGTGGAGCTGGCTTT	TTTTTCCAAGGTGCTTACCAAATT
5	TTGTATTCCCTAGGATGTAATTGTCATT	TACAATCATCCTTATAATTTTTCCAGC
6	TTACGTAATGAAATTTGCCAACTTG	CTCCAACTCCTTTTCCATGTCC
7	GAGGAGGCAGAAAATGAAAACAG	AAGTACCTTTGTTGAACCACCACA
8	ACCGTTTTCCTGTCCTTTTCTG	AAATTCCCAAGATTTCACCACACT
9	AAGACAGTGACTACCGATCACAGTTG	GCCATTTTACCTGAATTTCATCAAG
10	TGAAAGCTATTGTGCATCAGACAG	TTCTTACTTGAAGTTGATAATGATCG
11	GTCTTTTAGGTGCAGGAGCTTACAG	TGCATTGACAGCTACCATAATTGG
12	AAAGATGATGAAATTATTGAGTATCAG	ATCAGCATCAAGCTGAGCATTC
13	TGCTCACCGAACAAGTAGAACAA	GGAGCTCATTTTTCAAATCTTCAATA
14	GCTTCAACCCTTTCTCAACAGAC	CTGTTCTCTCAGCCTCTTTAGTTTTC
15	TCGAGAGATTGAAATATTAACAAAGG	AGTGCCTCATTTTCATCAAGGAA
16	GCTTTCTATTGTAGGCCTTGAACC	TGCTGCTGTTTTAAGTGTTTGCTA
17	AAGAAGTGCAACTTCAGGTATACTCAG	TTTCATATCCAGACAACTCACTTATC
18	CACTGAGGACCTGAACCTAACTGA	TTGAGGCTCAATAAATCCAATTTTC
19	GAAAGGAGTAGGACAGTGATAGCCA	AAACAGAGAATGTGTTAACGCCCT
20	GCAACTTGAAGAAGGTATGAAAGAAAT	GATGTTTCTCCTCCTTTAACATCAGG
21	GCTAGGCTATAGAATCAAAGAATGCA	CGGTAAGCTGATCAACTTGGG
22	TCTGTCAATTTGTCTTTCTTTGGG	TTTCAAGATGGTCTATCTGGAAAAAA
23	TTTGCTGTAATTCGTCATCAACAA	ACTTTCACAATTAACAAGAATATACT
24	TAAAAGAGGAAAAGAGAAAACTTGAGG	TTATAGCATCTTGTTGGACTTGATCC
25	CAACCTTAGTAGAATTGGAGCGACA	CTTCAGCCTCCATTGACAACAA
26	ATGGCCATTTTCAAGATTGCA	TTTATTAGCCAGTTCTAGTTCAGACA
27	CCTTTATTCAGTGTGAAAACATCTCC	GTTTTTCCTTGGTAATCTCCAGTTCT
28	AATTAAATGAAAGGCAGCGGG	GTTCCTCCATTTGCTTTAACGAA
29	TCAATTTGGATGCACAGAAGGT	CAGCATCACTTACTGCCTTGCT
30	CACAACAACAATCTAGGGACAAGG	GAGCCAATACTGCACATACCTGAT
31	ATGGAGGCCTACAACTTGCG	TCTTCCCTCCAAACGAGCAT
32	ATCGGGAATTAGTCAAGGATAAAGAA	GACTGCTGATTGTACGTTCATATTCA
33	GAAGTTGACCTGGAACGCCA	CATTCATACCTTTTGTGCCGC
34	CACGGGCAACTTGCAAATC	GCCCCCCAAACATACCAAAT
35	ATGAACTGAGGCTTCGATTGC	TTGGTTCCATCTCTTTTCTGCC
36	TGTGAAGAAACATGAGGAAGACCTT	CCGTTTGTTTGAATTTATTTAGTGAA
37	AACAAGCATTTTATTCGTCTGGC	TTTGACCAAGAGTGAGGAAAGAGAG
38	AGAGGATTTAAAGTATCTTCTGGACCA	GCTTCTTTTTGAGCCTGAAGTTCA
39	CGGGCACTTTTAGAACTCCG	GGCCTCTTTTTGAGAAGTTGCA
40	TGCAAAAGAAACAAAAAGCCTATAATA	GCCTTTTCAGTTCATCATTCTCTTG
41	TAAACAAAGTCTAATTGAAGAACTCCA	TCTACTTCCTCCACCTTTCCCTCT
42	CTGGTAATTTTCCTACCTCCTTCG	CCACTTTTTACCTTCTTCCCACC
43	AAGAGAAACTTACTTTGCAGAGGAAAC	ACTCCAAAGCTCGTATTCCCAA
44	CAAGCTCTTCCTCGAGATTCTGTT	TTCTAAAGCATGAAGTTTTTCTTGGA
45	TGAAGATTTCAGGAATAGAGTCAGATG	CAGATGACAACTTCAAGTTTTCCTTC
46	TCAGAGATTTGAAGGAAATGTGTGA	CCCCTCTAACATGGCCAAGTT
47	GTGGAAAGACAATCCCAGAACTG	GTTCATTTTCTCTCTGGACTTTTTCA
48	ATCTTGGGCATCAGTTGAGCAT	GAAGCCTTTCATTTTCAGCAATAAT
49	TGAGAAGATGACAGTTCAACTAGAAG	GCACCTTCAAGCTGTGGACC
50	ACAATGAAGACCTTGAACAACAGG	GAACATCTTGCGATATTATGCATTAT
51	ATTTCCATGGCAAACCTTATCTTC	TCAGCACCTTCAGGAACATGTT
52	TCAGCTGGATAAAGAGAAAGCAGAA	GGTATGGTGCTTTCAGCTCCAC
53	ACCTTGAACTCATTCGTAGTGGG	TTTCCTTTAGTTGATCAGCATCTGTT
54	TCCCCATTTACTAAAGGTCACCTATAA	GTACAAGGTAGTGAGAAGGAAATAC

To account for possible variations related to DNA input amounts or to the presence of PCR inhibitors, one exon of the reference gene TERT (telomerase reverse transcriptase) on chromosome 5 was simultaneously quantified. All experiments were performed in duplicate, and DNA samples of three healthy individuals were always included as normal controls. SYBR Green amplification mixture (25 μl) contained SYBR Green master mix 2x, 150 nM of each forward and reverse primer, and 20 ng of template DNA. After PCR amplification, a melting curve was generated for each PCR product to check the specificity of the reaction. Data analysis was performed using the ΔΔCt method [Marongiu et al., 2007]. A ratio of target exon/TERT exon between 0.8 and 1.2 was considered normal; ratios higher than 1.2 or lower than 0.6 were considered indicative of a heterozygous duplication or deletion of the target exon, respectively. Each result, outside the normal range, was subsequently confirmed with independent reaction.

CEP290 mRNA analysis

Total RNA from proband COR001 and her father was extracted from peripheral blood according to standard protocols and cDNA synthesis was performed using SuperScript II Reverse Transcriptase, RNase OUT Ribonuclease and random hexamers as primers (Invitrogen, Milan, Italy). The following primers were designed on CEP290 exon 12 to quantify mRNA expression: fw: 5′-GGGAGAAACTTAAGAATGCTCAGC-3′; rev: 5′-TGTCTCGTTCCTGTATACCCTGC-3′. After reverse transcription of mRNA, cDNAs from the patient, father and a control subject were tested by QRT-PCR using Glyceraldehyde phosphate deydrogenase (GAPDH) for normalization (GAPDH primers: fw: 5′-TCAATGGAAATCCCATCACCA-3′; rev: 5′-TGATTTTGGAGGGATCTCGCT-3′).

Characterization of the deletion breakpoints

In family COR001, the fragment containing the deletion breakpoints was amplified by PCR for direct sequencing. PCR primers adjacent to the presumably deleted region were generated within intron 3 of the C12orf50 gene and intron 41 of CEP290 gene, as follows: Intron3: 5′-CTTAAGCATCAGATCTGTCTC-3′; Intron41: 5′-CATCCAGTCTTCTTCCCTC-3′. PCR was cycled once at 94°C for 1 min, 35 times at 94°C for 45 sec, at 56°C for 30 sec, at 68°C for 45 sec, and once at 72°C for 10 min in 30 μl mixture using Platinum Taq DNA Polymerase High Fidelity (Invitrogen). After visualization on a 1.5% agarose gel, the purified PCR product was directly sequenced using BigDye™ terminator chemistry and an ABI 3100 Capillary Array Sequencer (Applied Biosystems).

Bioinformatic analysis

Sequences surrounding the identified breakpoints were analysed using the UCSC genome browser (http://genome.ucsc.edu/) and Repeat Masker (http://www.repeatmasker.org/cgi-bin/WEBRepeatMasker) for screening of interspersed repeats and low complexity DNA sequences. Their level of homology was then analyzed with BLAST (http://www.ncbi.nlm.nih.gov/BLAST).

RESULTS

Identification of CEP290 multiexon deletion in one patient

DNA samples from four JSRD-COR probands heterozygous for CEP290 mutations were available from a previous mutation screening. We further obtained DNA from one fetus with MKS and four patients with isolated LCA, also heterozygous for CEP290 point mutations (Table I). These samples were tested using QRT-PCR assay for dosage analysis of CEP290 54 exons and 5′-UTR. In one JSRD-COR proband (COR001), we obtained ratios consistently lower than 0.6 for exons 42 to 54 and normal values for all other exons (Fig. 1a). In the other probands, all exons generated normal ratios.

Fig. 1.

Characterization of the CEP290 gene deletion in COR001 family. a: CEP290 exon dosage in the proband showing the heterozygous deletion of exons 42 to 54. b: Measurement of CEP290 mRNA expression levels showing a reduction of about 50% in the father and 80% in the proband compared with those of normal control. [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com].

Proband COR001 was known to have inherited the heterozygous mutation c.5493delA from her mother. In line with this finding, QRT-PCR in the father also showed ratios < 0.6 for exons 42 to 54, consistent with a paternally inherited heterozygous deletion of the C-terminal exons of CEP290. To analyze whether this heterozygous deletion could interfere with CEP290 expression, we performed cDNA QRT-PCR with primers designed outside the deleted region. In the proband’s father, we were able to show a reduction of CEP290 mRNA expression levels of about 50% compared with those of normal control, demonstrating a complete degradation of CEP290 mRNA transcribed from the deleted allele. Interestingly, the proband’s mRNA expression levels were reduced to about 20% of normal control (Fig. 1b). Because there is no evidence of preferential allele expression for CEP290, these data suggested that also an amount of mRNA produced by the c.5493delA mutant allele (resulting in the truncated protein p.A1832PfsX19) was being degraded.

Characterization of the deletion breakpoints in proband COR001

To define the deletion size, we extended dosage analysis of patient COR001 to all exons of genes C12ofr29 and C12orf50, that are located at 3′ of CEP290. The analysis showed a deletion of all exons of C12orf29 and of exons 1 to 3 of C12orf50, refining the deleted region to ~77kb interval between CEP290 intron 41 and C12orf50 intron 3 (Fig. 2a, b). Using a set of primers located adjacent to the supposed deletion breakpoints, we were able to amplify a ~700bp fragment in both the proband and her father, while no amplified fragment was obtained in a normal control (Fig. 2c). Direct sequencing of this fragment showed that the deleted region encompassed 76,844bp (CEP290:c.5709+2352_54_C12orf50:c.290-1375_77del). Since the newly generated junction fell within a stretch of six adenines, the two breakpoints cannot be exactly determined (Fig. 2d).

Fig. 2.

Characterization of the deletion breakpoints in COR001 family. a: Dosage analysis of CEP290 neighbouring genes showing the heterozygous deletion of all C12orf29 exons and of C12orf50 exons 1 to 3. b: schematic representation of the genomic region enclosing CEP290, C12orf29 and C12orf50 genes: open and solid triangles represent exons with ratio < 0.6 and between 0.8 and 1.2, respectively. c: agarose gel electrophoresis showing the ~700 bp fragment obtained with genomic primers located adjacent to the supposed deletion breakpoints. d: top schematic representation of the breakpoints. Bottom electropherogram of the fragment across the breakpoints, showing the newly generated junction between C12orf50 intron 3 and CEP290 intron 41 sequences. [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com]

In silico analysis of the extended DNA sequences flanking the deletion indicated that the 5′ breakpoint within CEP290 intron 41 is located within a Long Terminal Repeat belonging to the ERV1 family, while the 3′ breakpoint within C12orf50 intron 3 does not contain any recognizable repeat motif.

DISCUSSION

JSRD, as well as many other ciliopathies, are known to be inherited in an autosomal recessive manner, yet mutation screenings of causative genes (including CEP290, MKS3, RPGRIP1L and CC2D2A) have failed to identify a second pathogenetic mutation in a subset of patients [Gorden et al., 2008; Brancati et al., 2007; Helou et al., 2007; Baala et al., 2007; den Hollander et al., 2006; Sayer et al., 2006; Baala et al., 2007; Wolf et al., 2007]. A first possibility to explain these findings is that these patients harbor mutation types that are undetectable with conventional screening techniques, such as heterozygous multiexon deletions or multiplications, or intronic mutations affecting exon splicing. In order to test for rearrangements involving one or more exons, we searched for genomic imbalances in two groups of probands with either JSRD/MKS or LCA phenotypes, heterozygous for CEP290 mutations, and identified a large multiexon deletion in one of five patients (20%) with the JSRD/MKS phenotype. As expected, no exon dosage imbalances were found in the four patients with LCA, a condition mostly associated with hypomorphic CEP290 mutations [den Hollander et al., 2006; Perrault et al., 2007].

The patient who carried the CEP290 deletion presented a typical COR phenotype with neurological signs of Joubert syndrome (hypotonia, ataxia, psychomotor delay, mental retardation and oculomotor apraxia), LCA with congenital blindness and nephronophthisis that evolved in renal failure at age nine years and requested kidney transplant one year later. The deletion was paternally inherited and spanned about 77Kb genomic DNA, encompassing the last 13 coding exons of CEP290, the entire C12orf29 gene and part of the C12orf50 gene. These two genes encode for uncharacterized proteins of 325 and 414 amino acids respectively. The heterozygous deletions of all or part of these genes does not seem to be associated with any clinical manifestation, as the proband’s phenotype can be fully explained by CEP290 loss of function, while the father is apparently healthy.

The molecular mechanism underlying the detected deletion is still unclear. Three major models have been proposed for genomic rearrangements in the human genome, including Non-Allelic Homologous Recombination, Non-Homologous End-Joining (NHEJ), and Fork Stalling and Template Swiching (FoSTeS) models [Gu et al., 2008]. In our case, in silico analysis of the sequences flanking the breakpoints junction identified several LINEs and Alu repetitive elements, but no significant homology between these sequences could be revealed. However, specific analysis of the breakpoint sequences demonstrated 2 bp micro-homologies, suggesting that microhomology-mediated end-joining could be involved in the origin of the deletion [Chan et al., 2007; Lee K and Lee SE, 2007]. In fact, this NHEJ-based mechanism requires only very short stretches of sequence identity (few bp) between the two ends of the junction. FoSTeS has also been associated with microhomology [Lee JA et al., 2007], yet it is unlikely to have been responsible for the deletion reported here, since so far it has only been implicated in the formation of duplications.

Although the overall number of tested patients is low, the identification of CEP290 exon dosage imbalances in one of five JSRD/MKS probands represents a potentially high yield, suggesting that this mutational mechanism may make a significant contribution to the burden of disease. In the four negative cases, other mutation types may have been missed. Of note, the most frequent CEP290 mutation identified in patients with isolated LCA is a substitution falling within intron 26 of the gene, that leads to the inclusion of a cryptic exon in CEP290 mRNA, with frameshift and premature introduction of a stop codon (p.C998X) [den Hollander et al., 2006; Perrault et al., 2007]. This mutation has been excluded by direct sequencing (or found only in the heterozygous state) in our patients, however similar mutations affecting cryptic splice sites would not have been detected by the employed screening techniques on genomic DNA. A second, intriguing possibility is that heterozygous mutations could represent “modifier” alleles, as already suggested for other ciliopathies. An obvious example is represented by BBS, a pleiotropic condition due to mutations in at least 12 genes. Some BBS patients have been found to harbour three mutations at two distinct loci, suggesting that single heterozygous mutations may contribute to the overall penetrance and expressivity of the disease [Katsanis, 2004; Badano et al., 2006]. A similar mechanism has been demonstrated also for NPHP genes in patients with isolated nephronophthisis [Hoefele et al., 2007]. Recently, heterozygous CEP290 and AHI1 mutations/rare variants have been identified in some JSRD probands homozygous for the NPHP1 deletion, possibly contributing to the phenotypic variability observed in these patients [Tory et al., 2007]. In our cohort of CEP290 heterozygotes, previous screenings have failed to identify mutations in several JBTS/MKS and LCA genes, however the possibility that additional mutations reside in still untested genes cannot be excluded at present. In this complex scenario, implicating several large genes, different mutational types and unconventional modes of inheritance variably contributing to the pathogenesis of these disorders, it appears that mRNA analysis would represent an optimal first-step strategy to perform comprehensive screenings of ciliary genes, allowing to detect not only mutations within exons and canonical splice junctions, but also exon dosage alterations and cryptic mutations affecting splicing. However, in our experience, mRNA from affected children is often difficult to obtain, since many patients live in remote locations or are unavailable for sampling, and some of them are no longer alive. In these cases, the genomic QRT-PCR-based strategy employed here, although time-consuming and labor-intensive, could be considered an alternative approach to search for exon dosage imbalances in patients found to carry single heterozygous mutations by conventional screening. In the near future, the mutation analysis of ciliary genes is expected to be greatly eased by large-scale adoption of innovative techniques such as SNP-arrays, capable of assessing copy number variations in the whole genome at high resolution, and high throughput re-sequencing, allowing rapid and simultaneous testing for point mutations in several large genes.

Appendix

Members of the International JSRD Study Group are: A. Zankl (Brisbane, Australia); R. Leventer (Parkville, Australia); P. Grattan-Smith (Sydney, Australia); A. Janecke (Innsbruck, Austria); M. D’Hooghe (Brugge, Belgium); Y. Sznajer (Bruxelles, Belgium); R. Van Coster (Ghent, Belgium); L. Demerleir (Brussels, Belgium); K. Dias, C. Moco, A. Moreira (Porto Alegre, Brazil); C. Ae Kim (Sao Paulo, Brazil); G. Maegawa (Toronto, Canada); D. Petkovic (Zagreb, Croatia); G.M.H. Abdel-Salam, A. Abdel-Aleem, M.S. Zaki (Cairo, Egypt); I. Marti, S. Quijano-Roy (Garches, France); S. Sigaudy (Marseille, France); P. de Lonlay, S. Romano (Paris, France); R. Touraine (St. Etienne, France); M. Koenig, C. Lagier-Tourenne, J. Messer (Strasbourg, France); P. Collignon (Toulon, France); N. Wolf (Heidelberg, Germany); H. Philippi (Mainz, Germany); S. Kitsiou Tzeli (Athens, Greece); S. Halldorsson, J. Johannsdottir, P. Ludvigsson (Reykjavik, Iceland); S. R. Phadke (Lucknow, India); V. Udani (Mumbay, India); B. Stuart (Dublin, Ireland); A. Magee (Belfast, Northern Ireland); D. Lev, M. Michelson (Holon, Israel); B. Ben-Zeev (Ramat-Gan, Israel); R. Fischetto, (Bari, Italy); F. Benedicenti, F. Stanzial (Bolzano, Italy); R. Borgatti (Bosisio Parini, Italy); P. Accorsi, S. Battaglia, E. Fazzi, L. Giordano, L. Pinelli (Brescia, Italy); L. Boccone (Cagliari, Italy); S. Bigoni, A. Ferlini (Ferrara, Italy); M.A. Donati (Florence, Italy); G. Caridi, M.T. Divizia, F. Faravelli, G. Ghiggeri, A. Pessagno (Genoa, Italy); M. Briguglio, S. Briuglia, C.D. Salpietro, G. Tortorella (Messina, Italy); A. Adami, P. Castorina, F. Lalatta, G. Marra, D. Riva, B. Scelsa, L. Spaccini, G. Uziel (Milan, Italy); E. Del Giudice (Napoli, Italy); A.M. Laverda, K. Ludwig, A. Permunian, A. Suppiej (Padova, Italy); S. Signorini, C. Uggetti (Pavia, Italy); R. Battini (Pisa, Italy); M. Di Giacomo (Potenza, Italy); M.R. Cilio, M.L. Di Sabato, V. Leuzzi, P. Parisi (Rome, Italy); M. Pollazzon (Siena, Italy); M. Silengo (Torino, Italy); R. De Vescovi (Trieste, Italy); D. Greco, C. Romano (Troina, Italy); M. Cazzagon (Udine, Italy); A. Simonati (Verona, Italy); A.A. Al-Tawari, L. Bastaki, (Kuwait City, Kuwait); A. Mégarbané (Beirut, Lebanon); V. Sabolic Avramovska (Skopje, Macedonia); M.M. de Jong (Groningen, The Netherlands); P. Stromme (Oslo, Norway); R. Koul, A. Rajab (Muscat, Oman); M. Azam (Islamabad, Pakistan); C. Barbot (Oporto, Portugal); L. Martorell Sampol (Barcelona, Spain); B. Rodriguez (La Coruna, Spain); I. Pascual-Castroviejo (Madrid, Spain); S. Teber (Ankara, Turkey); B. Anlar, S. Comu, E. Karaca, H. Kayserili, A. Yüksel (Istanbul, Turkey); M. Akcakus (Kayseri, Turkey); L. Al Gazali, L. Sztriha (Al Ain, UAE); D. Nicholl (Birmingham, UK); C.G. Woods (Cambridge, UK); C. Bennett, J. Hurst, E. Sheridan (Leeds, UK); A. Barnicoat, R. Hennekam, M. Lees (London, UK); E. Blair (Oxford, UK); S. Bernes (Mesa, Arizona, US); H. Sanchez (Fremont, California, US); A.E. Clark (Laguna Niguel, California, US); E. DeMarco, C. Donahue, E. Sherr (San Francisco, California, US); J. Hahn, T.D. Sanger (Stanford California, US); T.E. Gallager (Manoa, Hawaii, US); W.B. Dobyns (Chicago, Illinois, US); C. Daugherty (Bangor, Maine, US); K.S. Krishnamoorthy, D. Sarco, C.A. Walsh (Boston, Massachusetts, US); T. McKanna (Grand Rapids, Michigan, US); J. Milisa (Albuquerque, New Mexico, US); W.K. Chung, D.C. De Vivo, H. Raynes, R. Schubert (New York, New York, US); A. Seward (Columbus, Ohio, US); D.G. Brooks (Philadephia, Pennsylvania, US); A. Goldstein (Pittsburg, Pennsylvania, US); J. Caldwell, E. Finsecke (Tulsa, Oklahoma, US); B.L. Maria (Charleston, South Carolina, US), K. Holden (Mt. Pleasant, South Carolina, US); R.P. Cruse (Houston, Texas, US); K.J. Swoboda, D. Viskochil (Salt Lake City, Utah, US).