Skip to main content
Parasites & Vectors logoLink to Parasites & Vectors
. 2015 Feb 15;8:100. doi: 10.1186/s13071-015-0697-5

The complete mitochondrial genome of the gullet worm Gongylonema pulchrum: gene content, arrangement, composition and phylogenetic implications

Guo-Hua Liu 1,#, Yan-Qing Jia 2,#, Ya-Nan Wang 2, Guang-Hui Zhao 2,, Xing-Quan Zhu 1,
PMCID: PMC4340675  PMID: 25884563

Abstract

Background

Gongylonema pulchrum (Nematoda: Gongylonematidae), a thread-like spirurid gullet worm, infects a range of mammalian definitive hosts, including cattle, pigs, equines, goats, primates and humans, and can cause gongylonemiasis.

Methods

In the present study, the complete mitochondrial (mt) genome of G. pulchrum was obtained using Long-range PCR and subsequent primer walking. The phylogenetic position of G. pulchrum within the Spiruromorpha was established using Bayesian analyses of the protein-coding genes at the amino acid level.

Results

The length of this AT-rich (75.94%) mt genome is 13,798 bp. It contains 12 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes and one non-coding region. The gene arrangement is the same as those of Thelazia callipaeda (Thelaziidae) and Setaria digitata (Onchocercidae), but distinct from that of Heliconema longissimum (Physalopteridae). Phylogenetic analyses, based on the concatenated amino acid sequence data for all 12 protein-coding genes using Bayesian inference (BI) method, showed that G. pulchrum (Gongylonematidae) was more closely related to Spirocerca lupi (Spiruroidea) than other members of the infraorder Spiruromorpha.

Conclusions

The present study represents the first mt genome sequence for the family Gongylonematidae, which provides the opportunity to develop novel genetic markers for studies of epidemiology, population genetics and systematics of this nematode of human and animal health significance.

Electronic supplementary material

The online version of this article (doi:10.1186/s13071-015-0697-5) contains supplementary material, which is available to authorized users.

Keywords: Gongylonema pulchrum, Gongylonemiasis, Mitochondrial genome, Phylogenetic analyses

Background

Gongylonema pulchrum Molin, 1857, known as the ‘gullet worm’ because of its location in the upper digestive system of its definitive hosts, has a worldwide distribution and is responsible for gongylonemiasis of humans, sometimes causing serious complaints, e.g., expectoration of blood, numbness of tongue, vomiting, pharyngitis and stomatitis [1]. G. pulchrum also infects domestic and wild animal hosts, including bears, camels, cattle, cervids, donkeys, equines, goats, non-human primates, pigs, and sheep, causing major economic losses [2]. Fortunately, gongylonemiasis can be treated effectively using anthelmintics, such as levamisole, mebendazole and ivermectin [3].

Human gongylonemiasis, a neglected parasitic disease, has been reported from many countries (e.g., Australia, Bulgaria, Ceylon, China, France, Germany, Hungary, Iran, Japan, Laos, Morocco, New Zealand, Soviet Union, Spain, Sri Lanka, Turkey and USA). Recently, human gongylonemiasis has frequently been reported from China [4], France [5,6] and USA [7]. Clearly, the increased frequency and more widespread occurrence of clinical cases of human gongylonemiasis mean that knowledge on enhanced diagnosis, treatment and control is needed. Although molecular markers in portion of mitochondrial (mt) DNA and the internal transcribed spacer (ITS) regions of nuclear ribosomal DNA (rDNA), have found utility for taxonomic and epidemiological studies of G. pulchrum [8], there is still a paucity of information on G. pulchrum in different hosts and countries around the world.

Due to its maternal inheritance, fast rate of evolutionary change, lack of recombination and relatively conserved genome structures [9], mt genomes have been widely used as genetic markers for population genetic structure and the study of phylogenetic relationships among nematodes and trematodes [10]. In particular, concatenated amino acid sequences, derived from the protein-coding genes, lend themselves for assessing systematic relationships of parasitic nematodes [11-19]. The objectives of the present study were to characterize the mt genome of G. pulchrum, the first representative of the family Gongylonematidae, and to assess the phylogenetic position of this zoonotic nematode in relation to other nematodes of the infraorder Spiruromorpha.

Methods

Ethics statement

The performance of this study was strictly according to the recommendations of the Guide for the Care and Use of Laboratory Animals of the Ministry of Health, China, and our protocol was reviewed and approved by the Research Ethics Committee of Northwest A&F University.

Parasite collection

Adult specimens of G. pulchrum were collected from the oesophagus of a naturally infected goat in Shenmu, Shaanxi province, China, with no specific permits being required by the authority for the sample collection.

Genomic DNA extraction

The gullet worms were washed extensively in physiological saline, identified morphologically to species according to existing keys and descriptions [20], fixed in ethanol and then stored at −20°C until use. The mid-body section of each worm was used for the isolation of total genomic DNA using proteinase K digestion and mini-column purification (TIANamp Genomic DNA Purification System, TIANGEN). The identity of the specimen was verified by sequencing regions of the ITS-1 and ITS-2 rDNA using an established method [8]; the two regions were 99.7% and 100% identical to previously published sequences for G. pulchrum from Bos taurus in Iran (GenBank accession nos. AB495392 and AB513721, respectively).

Long-PCR and sequencing

Using three pairs of specific primers (Table 1) designed according to relatively conserved regions within the cox1, cox2 and cox3 regions of nematodes within order Spirurata (Figure 1), three overlapping amplicons of the complete mt genome were amplified by Long-PCR [21]. PCRs were conducted in 25 μl reaction volumes containing 2 mM MgCl2, 0.2 mM each of dNTPs, 2.5 μl 10× Taq buffer, 2.5 μM of each primer and 0.5 μl LA Taq DNA polymerase (5 U/μl, TaKaRa). PCR cycling conditions were as follows: 92°C for 2 min (initial denaturation), then 92°C for 10 s (denaturation), 45°C for 30 s (annealing), and 60°C for 8 min (extension) for 9 cycles, followed by 92°C for 10 s, 45°C for 30 s (annealing), and 60°C for 9 min (extension) for 25 cycles, with a cycle elongation of 10 s for each cycle and a final extension at 60°C for 10 min. No-template and known-positive controls were included in each run. Amplicons were column-purified using TIANgel Midi Purification Kit (TIANGEN, Beijing, China). Following an electrophoretic analysis of quality, purified amplicons were sequenced using a primer walking strategy [21] with primers listed in Additional file 1 by Invitrogen Company (Shanghai, China).

Table 1.

Primers used to amplify the mitochondrial genome of Gongylonema pulchrum in three overlapping long PCR fragments

Name of primer Sequence (5′ to 3′) Extension positions Product lengths
cox3—cox2
GPcox3u TATGATATATCTATTGATTATTG 4162 3954 bp
GPcox2d GCATCCATCTTAATAAAACACTTAGG
cox2—cox1
GPcox2u GAGGTCGATAATCGTTGTATTATCCCTGTGG 8013 7155 bp
GPcox1d AAGAATGAATAACATCCGAAGAAGT
cox1 —cox3
GPcox1u TTTGGGGCTCCTGAGGTTTATA 770 3953 bp
GPcox3d CAGAAATCTCTTCCATCACCTCGAT

Figure 1.

Figure 1

Organization of the mitochondrial genome of Gongylonema pulchrum . Scale is approximate. All genes have standard nomenclature except for the 22 tRNA genes, which are designated by the one-letter code for the corresponding amino acid, with numerals differentiating each of the two leucine- and serine-specifying tRNAs (L1 and L2 for codon families CUN and UUR, respectively; S1 and S2 for codon families UCN and AGN, respectively). All genes are transcribed in the clockwise direction. ‘AT’ indicates the non-coding region.

Sequence analyses

Sequences were assembled manually and aligned against the complete mt genome sequences of Spirocerca lupi [22] using the computer program MAFFT 7.122 [23] to identify gene boundaries. Each gene was translated into its amino acid sequence using the invertebrate mitochondrial genetic code in MEGA 5 [24]. The translation initiation and termination codons were identified to avoid gene overlap and to optimize the similarity between the gene lengths of closely related species of the infraorder Spiruromorpha. The program tRNAscan-SE [25] was used to find tRNA and infer their secondary structure, putative secondary structures of 19 tRNA genes were identified, and the remaining three tRNA genes (tRNA-Arg, tRNA-Ser AGN and tRNA-Ser UCN) were inferred by recognizing potential secondary structures and anticodon sequences by eye [26]. Two rRNA genes were predicted by comparison with those of closely related nematodes of the infraorder Spiruromorpha [15,22].

Phylogenetic analyses

Amino acid sequences inferred from published mt genomes representing 12 species of the infraorder Spiruromorpha (Brugia malayi: GenBank accession no. NC_004298; Wuchereria bancrofti: JN367461; Chandlerella quiscali: NC_014486; Loa loa: NC_016199; Acanthocheilonema viteae: NC_016197; Onchocerca flexuosa: NC_016172; Onchocerca volvulus: AF015193; Dirofilaria immitis: NC_005305; Setaria digitata: NC_014282; S. lupi: KC305876; Thelazia callipaeda: JX069968; Heliconema longissimum: NC_016127) were included in the present analysis, using Toxascaris leonina (NC_023504) as the outgroup [27]. 12 amino acid sequences were separately aligned using MAFFT 7.122 and then concatenated, with ambiguously aligned regions excluded using Gblocks 0.91b (doc) [28] with the default parameters using the options for a less stringent selection. Phylogenetic analyses were conducted using Bayesian inference (BI) method. The JTT+G+F model of amino acid evolution was selected as the most suitable model of evolution by ProtTest 2.4 [29] based on the Akaike information criterion (AIC). As the JTT model is not implemented in the current version of MrBayes, an alternative model, CpREV, was used in BI and four chains (three heated and one cold) were run simultaneously for the Monte Carlo Markov Chain. Two independent runs for 1,000,000 metropolis-coupled MCMC generations were used, sampling a tree every 100 generation in MrBayes 3.1.1 [30]. At the end of each run, the average standard deviation of split frequencies was less than 0.01. In addition, the potential scale reduction factor (~1) was examined to ensure that the convergence had been achieved. A 50% majority rule consensus tree was obtained from BI. Of 10,000 trees, the first 2,500 trees represented burn-in and the remaining trees were used to calculate Bayesian posterior probabilities (Bpp). Phylograms were drawn using the program FigTree v.1.4 [31].

Results and discussion

The complete mt genomic sequence of G. pulchrum (GenBank accession no. KM264298) was 13,798 bp in size (Figure 1). It contains 12 protein-coding genes (cox1-3, nad1-6, nad4L, atp6 and cytb), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes and one non-coding (control or AT-rich) region, but lacks the atp8 gene (Table 2). The gene content and arrangement are the same as those of T. callipaeda (Thelaziidae) [15] and S. digitata (Onchocercidae) [32], but distinct from those of D. medinensis (Dracunculidae) and H. longissimum (Physalopteridae) [12]. All genes are transcribed in the same direction. In addition, the mt genome of G. pulchrum has 24 intergenic regions, ranging from 1 to 78 bp in length. The longest region (78 bp) is between tRNA-Pro and tRNA-Asp genes (Table 2). The nucleotide content of the entire mt genome sequence of G. pulchrum is biased toward A+T (75.94%), in accordance with mt genomes of other spirurid nematodes (Table 3). AT- and GC-skews of the whole mt genome were calculated for G. pulchrum and other spirurid nematodes studied to date (Table 4). The composition of the mt genome sequence of G. pulchrum was strongly skewed towards T (AT skew = −0.413), and G (GC skew was 0.448) (Table 3).

Table 2.

Mitochondrial genome organization of Gongylonema pulchrum

Gene/Region Positions Size (bp) Number of aa a Ini/Ter codons In
cox1 1-1653 1653 550 ATG/TAA +1
tRNA-Trp (W) 1659-1717 59 +5
nad6 1744-2175 432 143 ATT/TAA +26
tRNA-Arg (R) 2194-2245 52 +18
tRNA-Gln (Q) 2246-2299 54 0
cytb 2323-3386 1064 354 ATT/TA +23
tRNA-LeuCUN (L1) 3387-3442 56 0
cox3 3449-4222 774 257 TTG/TAA +6
Non-coding region 4223-4656 434 0
tRNA-Ala (A) 4657-4713 57 0
tRNA-LeuUUR (L2) 4715-4768 54 +1
tRNA-Asn (N) 4770-4828 59 +1
tRNA-Met (M) 4839-4895 57 +10
tRNA-Lys (K) 4902-4959 58 +6
nad4L 4968-5195 228 75 TTG/TAA +8
rrnS 5196-5876 681 0
tRNA-Tyr (Y) 5877-5933 57 0
nad1 5940-6804 865 288 TTG/T +6
tRNA-Phe (F) 6807-6863 57 +2
atp6 6866-7442 577 192 GTT/T +2
tRNA-Ile (I) 7443-7498 56 0
tRNA-Gly (G) 7506-7561 56 +7
cox2 7565-8255 691 230 ATG/T +3
tRNA-His (H) 8256-8315 60 0
rrnL 8316-9280 965 0
nad3 9281-9620 340 113 GTG/T 0
tRNA-Cys (C) 9622-9676 55 +1
tRNA-SerUCN (S2) 9677-9730 54 0
tRNA-Pro (P) 9731-9784 54 0
tRNA-Asp (D) 9863-9917 55 +78
tRNA-Val (V) 9921-9973 53 +3
nad5 9979-11560 1582 527 TTG/T +5
tRNA-Glu (E) 11562-11618 57 +1
tRNA-SerAGN (S1) 11620-11671 52 +1
nad2 11684-12513 830 276 ATG/TA +12
tRNA-Thr (T) 12514-12568 55 0
nad4 12574-13797 1224 407 GTT/TAG +5

aThe inferred length of amino acid sequence of 12 protein-coding genes; Ini/Ter codons: initiation and termination codons; In: Intergenic nucleotides.

Table 3.

Comparison of A+T content (%) of gene and region of the mt genomes of spirurid nematodes sequenced to date (alphabetical order), including Gongylonema pulchrum (in bold)

Gene/region AV BM CQ DI DM GP HL LL OF OV SD SL TC WB
atp6 75.21 75.09 80.14 71.88 72.40 78.73 77.89 76.46 73.71 72.99 74.23 74.87 74.23 76.63
cox1 67.36 68.98 70.28 67.88 68.21 68.6 71.69 69.48 69.70 67.03 69.10 66.97 67.88 67.70
cox2 66.81 68.96 73.25 69.15 68.25 71.64 74.71 71.53 68.10 69.24 69.38 68.51 67.38 70.57
cox3 71.54 72.69 76.92 71.79 71.54 73.0 75.93 76.20 72.18 71.79 72.56 71.39 72.41 74.33
cytb 72.32 73.97 76.13 72.25 72.14 74.72 79.30 75.35 73.65 72.11 72.34 72.85 73.68 72.70
nad1 73.43 73.55 75.85 72.94 72.29 72.95 75.69 72.85 71.60 69.78 72.78 72.50 73.22 72.52
nad2 74.68 77.61 82.39 74.39 76.93 77.86 82.92 77.26 75.56 74.30 76.49 70.91 77.35 75.71
nad3 79.82 79.35 81.71 77.15 75.89 82.94 83.18 79.82 76.56 76.11 77.06 80.65 80.24 84.27
nad4 73.98 76.31 78.05 74.55 72.32 76.23 80.36 75.75 74.05 73.15 76.91 74.47 75.59 73.88
nad4L 76.89 82.08 83.33 77.37 74.39 77.63 82.05 81.09 77.73 78.60 76.76 76.75 80.17 80.66
nad5 71.93 74.81 78.17 73.75 73.64 74.97 78.93 74.03 73.62 72.87 74.81 72.88 73.82 74.69
nad6 77.19 81.46 82.89 80.57 76.26 81.02 81.74 81.98 81.11 79.11 82.44 77.56 80.17 80.04
rrnS 75.48 76.04 76.85 75.84 73.59 78.56 80.50 76.56 75.84 74.71 74.55 76.09 75.68 75.30
rrnL 77.78 80.78 80.25 79.55 76.70 81.14 81.81 78.65 77.71 76.95 79.40 79.05 77.43 79.01
AT-loop 83.37 85.11 86.49 85.91 74.75 81.11 96.75 83.68 79.93 85.32 86.36 88.50 79.57 83.71
Entire 73.54 75.46 77.67 74.16 72.72 76.0 79.11 75.54 74.17 73.30 75.14 73.73 74.57 74.59

Nematodes: AV: Acanthocheilonema viteae, BM: Brugia malayi, CQ: Chandlerella quiscali, DI: Dirofilaria immitis, DM: Dracunculus medinensis, GP: Gongylonema pulchrum, HL: Heliconema longissimum, LL: Loa loa, OF: Onchocerca flexuosa, OV: Onchocerca volvulus, SD: Setaria digitata, SL: Spirocerca lupi, TC: Thelazia callipaeda, WB: Wuchereria bancrofti, Entire: entire mt genome.

Table 4.

Nucleotide composition of the mt genomes of spirurid nematodes, including that of Gongylonema pulchrum (in bold)

Species Nucleotide frequency (%) Whole genome sequence
A T G C A+T% AT skew GC skew
Acanthocheilonema viteae 19.56 53.98 19.26 7.20 73.54 −0.468 0.456
Brugia malayi 21.60 53.86 16.82 7.72 75.46 −0.428 0.371
Chandlerella quiscali 23.02 54.65 15.92 6.41 77.67 −0.407 0.426
Dirofilaria immitis 19.26 54.90 19.28 6.56 74.16 −0.481 0.492
Dracunculus medinensis 20.12 52.60 20.75 6.53 72.72 −0.447 0.521
Gongylonema pulchrum 22.27 53.67 17.42 6.64 75.94 0.413 0.448
Heliconema longissimum 26.22 .89 14.14 6.75 79.11 −0.337 0.354
Loa loa 20.78 54.76 17.73 6.73 75.54 −0.450 0.450
Onchocerca flexuosa 20.30 53.88 18.60 7.23 74.17 −0.430 0.440
Onchocerca volvulus 19.26 54.04 19.84 6.86 73.30 −0.474 0.486
Setaria digitata 19.42 55.71 18.14 6.72 75.14 −0.483 0.459
Spirocerca lupi 21.9 51.83 19.4 6.87 73.73 −0.406 0.477
Thelazia callipaeda 22.39 52.18 18.42 7.01 74.57 −0.40 0.449
Wuchereria bancrofti 20.14 54.45 18.20 7.21 74.59 −0.460 0.433

The most common initiation codon for G. pulchrum is TGG, followed by ATG, ATT, GTT and GTG (4, 3, 2, 2, 1 genes, respectively; Table 2). The most frequent complete termination codon is TAA (4 genes); nad4 is terminated with the codon TAG. Of the remaining genes, nad1, nad3, nad5, atp6 and cox2 are terminated with the abbreviated stop codon T, whereas cytb and nad2 are terminated with the abbreviated stop codon TA. This is consistent with the arrangement in the mt genomes of other nematodes [27,33-35].

Twenty-two tRNA genes were predicted from the mt genome of G. pulchrum and varied from 52 to 59 bp in length. Twenty of the 22 tRNA genes (excluding two tRNA-Ser) have a predicted secondary structure with a 3–5 bp DHU arm and a DHU loop of 7–9 bases, in which the variable TψC arm and loop are replaced by a “TV-replacement loop” of 8–10 bases. As seen in almost all other nematode mtDNAs [36], the tRNA-Ser gene of G. pulchrum mt genome is equipped with a TψC arm and loop but lacks the DHU arm and loop, consisting of a 6–8 bp TψC arm, TψC loop of 4–6 bases and a variable loop of 4 bases. The majority of nematode mtDNA sequences usually contain two non-coding regions with significant size difference [37], but there is only one non-coding region (AT-rich region) in the mt genome of G. pulchrum which is located between cox3 and tRNA-Ala (Figure 1 and Table 2), with 81.11% of A+T content (Table 3). Furthermore, this region is devoid of consecutive sequences of [A] and [T], and there are no AT dinucleotide repeat sequences; these repeat regions have been reported in the mt genome of A. simplex s.l. and S. digitata [32,34].

Identification and differentiation of G. pulchrum has traditionally been based on morphological features. However, these criteria are often insufficient for specific identification and differentiation, particularly at the larval and/or egg stages. Molecular tools, using genetic markers in mt cox1 and ITS-1 region of nuclear rDNA, have been used to support clinical diagnosis and to assist in undertaking molecular identification and epidemiological investigations of G. pulchrum [8]. Because sequence polymorphism (heterogeneity) in ITS rDNA sequences occurs within individual spirurid specimens [38], mt genome sequences appear to be better solutions for such studies. Additionally, the cox1 sequences of G. pulchrum were further divided into multiple haplotypes and two groups of haplotypes (i.e. those from a majority of sika deer, wild boars and Japanese macaques and those from cattle and zoo animals, were clearly differentiated) [8]. Nonetheless, the cox1 is a relatively conserved mt gene in nematodes [13,16,39], and, to date, there is no genetic information for G. pulchrum from other mt genes.

Phylogenetic analyses of G. pulchrum with related nematodes of the infraorder Spiruromorpha were performed by BI based on concatenated mitochondrial amino acid sequences of 12 protein-coding genes (Figure 2). Gongylonema pulchrum (Gongylonematidae) formed the sister group to Spirocerca lupi. Together they formed the sister group to a clade composed of Setariidae and Onchocercidae. Thelazia callipaeda (Thelaziidae) took an early diverging position to the above mentioned taxa, whereas Heliconema longissimum (Physalopteridae) and Toxascaris leonina took an unresolved position at the root of the tree (Figure 2).

Figure 2.

Figure 2

Phylogenetic relationships of Gongylonema pulchrum with representative members of the infraorder Spiruromorpha based on mitochondrial sequence data. The concatenated amino acid sequences of 12 protein-coding genes were analyzed using Bayesian inference (BI) using Toxascaris leonina as the outgroup. Bayesian posterior probability (Bpp) values are indicated.

Many studies have indicated that the mtDNA sequence is a valuable genetic marker for phylogenetic studies [11,12,14,17]. The mt genome sequence of G. pulchrum could promote to reassess the systematic relationships within the spirurid nematodes using mt genomic datasets. Over the last decades, there have been considerable debate concerning the systematics of members of the spirurid nematodes (including superfamilies Filarioidea, Physalopteroidea, Spiruroidea and Thelazoidea) [40]. Some studies using nuclear small subunit (SSU) rDNA and mtDNA sequences have indicated that S. lupi (Spirocercidae) is the sister taxon of T. callipaeda (Thelaziidae), suggesting that S. lupi belongs to the superfamily Thelazioidea [41,42], but this finding was contradicted by other studies that used the same markers [43,44]. The results of the present study support that the Spirocercidae (represented by S. lupi) was more closely related to the family Gongylonematidae (represented by G. pulchrum) than to other families within Spiruromorpha, indicating that both families Spirocercidae and Gongylonematidae belong to superfamily Spiruroidea, consistent with conclusions of a previous study [40]. Given this utility of mt genomic datasets, further work should include sequencing of mt genomes of other spirurid nematodes in order to reconstruct the phylogenetic relationships of spirurid nematodes.

Conclusions

The present study determined the complete mt genome sequence of G. pulchrum, and ascertained its phylogenetic position within the infraorder Spiruromorpha. The complete mt genome represents the first sequenced mt genome of any member of the family Gongylonematidae. It will provide an important resource for the design of novel primers for the study of epidemiology, population genetics and systematics of Gongylonematidae.

Acknowledgements

This work was supported, in part, by grants from Funds of Basic Research Key Program (ZD2012010) to GHZ, the International Science & Technology Cooperation Program of China (Grant No. 2013DFA31840) and the Science Fund for Creative Research Groups of Gansu Province (Grant No. 1210RJIA006) to XQZ.

Additional file

Additional file 1: (35KB, doc)

Sequences of partial primer-walking primers used to amplify PCR fragments from Gongylonema pulchrum.

Footnotes

Guo-Hua Liu and Yan-Qing Jia contributed equally to this work.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

GHZ, GHL and XQZ conceived and designed the study, and critically revised the manuscript. YQJ, and YNW performed the experiments, analyzed the data and drafted the manuscript. All authors read and approved the final manuscript.

Contributor Information

Guo-Hua Liu, Email: liuguohua5202008@163.com.

Yan-Qing Jia, Email: yqjia1987@163.com.

Ya-Nan Wang, Email: 422765109@qq.com.

Guang-Hui Zhao, Email: zgh083@nwsuaf.edu.cn.

Xing-Quan Zhu, Email: xingquanzhu1@hotmail.com.

References

  • 1.Cappucci DT, Jr, Augsburg JK, Klinck PC. Gongylonemiasis. In: Steele JH, editor. Handbook Series in Zoonoses, Section C: Parasitic Zoonoses. Boca Raton, Florida: CRC Press; 1982. pp. 181–192. [Google Scholar]
  • 2.Anderson RC: Nematode parasites of vertebrates; their development and transmission. C.A.B. International, Oxon, 1992.
  • 3.Kudo N, Kubota H, Gotoh H, Ishida H, Ikadai H, Oyamada T. Efficacy of thiabendazole, mebendazole, levamisole and ivermectin against gullet worm, Gongylonema pulchrum: In vitro and in vivo studies. Vet Parasitol. 2008;151:46–52. doi: 10.1016/j.vetpar.2007.10.005. [DOI] [PubMed] [Google Scholar]
  • 4.Zhang ZW, Zhang HF, Gao CY. The endoscopic diagnosis and treatment of esophageal gongylonemiasis. Chin Foreign Med Treat. 2011;6:31. [Google Scholar]
  • 5.Battistelli-Lux C. Buccal infection with Gongylonema pulchrum: an indigenous case in France. Ann. Dermatol. Venereol. 2013;140:623–627. doi: 10.1016/j.annder.2013.07.007. [DOI] [PubMed] [Google Scholar]
  • 6.Pesson B, Hersant C, Biehler JF, Abou-Bacar A, Brunet J, Pfaff AW, Ferté H, Candolfi E. First case of human gongylonemosis in France. Parasite. 2013;20:5. doi: 10.1051/parasite/2013007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Allen JD, Esquela-Kerscher A. Gongylonema pulchrum Infection in a Resident of Williamsburg, Virginia, Verified by Genetic Analysis. Am J Trop Med Hyg. 2013;89:755–757. doi: 10.4269/ajtmh.13-0355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Makouloutou P, Setsuda A, Yokoyama M, Tsuji T, Saita E, Torii H, Kaneshiro Y, Sasaki M, Maeda K, Une Y, Hasegawa H, Sato H. Genetic variation of Gongylonema pulchrum from wild animals and cattle in Japan based on ribosomal RNA and mitochondrial cytochrome c oxidase subunit I genes. J Helminthol. 2013;87:326–335. doi: 10.1017/S0022149X12000442. [DOI] [PubMed] [Google Scholar]
  • 9.Wolstenholme DR. Animal mitochondrial DNA, structure and evolution. Int Rev Cytol. 1992;141:173–216. doi: 10.1016/S0074-7696(08)62066-5. [DOI] [PubMed] [Google Scholar]
  • 10.Boore JL. Animal mitochondrial genomes. Nucleic Acids Res. 1999;27:1767–1780. doi: 10.1093/nar/27.8.1767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kang S, Sultana T, Eom KS, Park YC, Soonthornpong N, Nadler SA, Park JK. The mitochondrial genome sequence of Enterobius vermicularis (Nematoda: Oxyurida)–an idiosyncratic gene order and phylogenetic information for chromadorean nematodes. Gene. 2009;429:87–97. doi: 10.1016/j.gene.2008.09.011. [DOI] [PubMed] [Google Scholar]
  • 12.Park JK, Sultana T, Lee SH, Kang S, Kim HK, Min GS, Eom KS, Nadler SA. Monophyly of clade III nematodes is not supported by phylogenetic analysis of complete mitochondrial genome sequences. BMC Genomics. 2011;12:392. doi: 10.1186/1471-2164-12-392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Liu GH, Gasser RB, Su A, Nejsum P, Peng L, Lin RQ, Li MW, Xu MJ, Zhu XQ. Clear genetic distinctiveness between human- and pig-derived Trichuris based on analyses of mitochondrial datasets. PLoS Negl Trop Dis. 2012;6:e1539. doi: 10.1371/journal.pntd.0001539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Liu GH, Shao R, Li JY, Zhou DH, Li H, Zhu XQ. The complete mitochondrial genomes of three parasitic nematodes of birds: a unique gene order and insights into nematode phylogeny. BMC Genomics. 2013;14:414. doi: 10.1186/1471-2164-14-414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Liu GH, Gasser RB, Otranto D, Xu MJ, Shen JL, Mohandas N, Zhou DH, Wang Y, Zhu XQ. Mitochondrial genome of the eyeworm, Thelazia callipaeda (nematoda: spirurida), as the first representative from the family Thelaziidae. PLoS Negl Trop Dis. 2013;7:e2029. doi: 10.1371/journal.pntd.0002029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Liu GH, Zhao L, Song HQ, Zhao GH, Cai JZ, Zhao Q, Zhu XQ. Chabertia erschowi (Nematoda) is a distinct species based on nuclear ribosomal DNA sequences and mitochondrial DNA sequences. Parasit Vectors. 2014;7:44. doi: 10.1186/1756-3305-7-44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Sultana T, Kim J, Lee SH, Han H, Kim S, Min GS, Nadler SA, Park JK. Comparative analysis of complete mitochondrial genome sequences confirms independent origins of plant-parasitic nematodes. BMC Evol Biol. 2013;13:12. doi: 10.1186/1471-2148-13-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zhao GH, Hu B, Cheng WY, Jia YQ, Li HM, Yu SK, Liu GH. The complete mitochondrial genomes of Oesophagostomum asperum and Oesophagostomum columbianum in small ruminants. Infect Genet Evol. 2013;19:205–211. doi: 10.1016/j.meegid.2013.07.018. [DOI] [PubMed] [Google Scholar]
  • 19.Gao JF, Zhao Q, Liu GH, Zhang Y, Zhang Y, Wang WT, Chang QC, Wang CR, Zhu XQ. Comparative analyses of the complete mitochondrial genomes of the two ruminant hookworms Bunostomum trigonocephalum and Bunostomum phlebotomum. Gene. 2014;541:92–100. doi: 10.1016/j.gene.2014.03.017. [DOI] [PubMed] [Google Scholar]
  • 20.Sato H, Une Y, Takada M. High incidence of the gullet worm, Gongylonema pulchrum, in a squirrel monkey colony in a zoological garden in Japan. Vet Parasitol. 2005;127:131–137. doi: 10.1016/j.vetpar.2004.10.005. [DOI] [PubMed] [Google Scholar]
  • 21.Hu M, Jex AR, Campbell BE, Gasser RB. Long PCR amplification of the entire mitochondrial genome from individual helminths for direct sequencing. Nature Protoc. 2007;2:2339–2344. doi: 10.1038/nprot.2007.358. [DOI] [PubMed] [Google Scholar]
  • 22.Liu GH, Wang Y, Song HQ, Li MW, Ai L, Yu XL, Zhu XQ. Characterization of the complete mitochondrial genome of Spirocerca lupi: sequence, gene organization and phylogenetic implications. Parasit Vectors. 2013;6:45. doi: 10.1186/1756-3305-6-45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30:772–780. doi: 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA 5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28:2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lowe TM, Eddy SR. tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997;25:955–964. doi: 10.1093/nar/25.5.0955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hu M, Chilton NB, Gasser RB. The mitochondrial genomes of the human hookworms, Ancylostoma duodenale and Necator americanus (Nematoda: Secernentea) Int J Parasitol. 2002;32:145–158. doi: 10.1016/S0020-7519(01)00316-2. [DOI] [PubMed] [Google Scholar]
  • 27.Liu GH, Zhou DH, Zhao L, Xiong RC, Liang JY, Zhu XQ. The complete mitochondrial genome of Toxascaris leonina: comparison with other closely related species and phylogenetic implications. Infect Genet Evol. 2014;21:329–333. doi: 10.1016/j.meegid.2013.11.022. [DOI] [PubMed] [Google Scholar]
  • 28.Talavera G, Castresana J. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst Biol. 2007;56:564–577. doi: 10.1080/10635150701472164. [DOI] [PubMed] [Google Scholar]
  • 29.Abascal F, Zardoya R, Posada D. ProtTest: selection of best-fit models of protein evolution. Bioinformatics. 2005;21:2104–2105. doi: 10.1093/bioinformatics/bti263. [DOI] [PubMed] [Google Scholar]
  • 30.Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19:1572–1574. doi: 10.1093/bioinformatics/btg180. [DOI] [PubMed] [Google Scholar]
  • 31.Rambaut A: FigTree, a graphical viewer of phylogenetic trees. 2012. Available from http://tree.bio.ed.ac.uk/software/figtree.
  • 32.Yatawara L, Wickramasinghe S, Rajapakse RP, Agatsuma T. The complete mitochondrial genome of Setaria digitata (Nematoda: Filarioidea): Mitochondrial gene content, arrangement and composition compared with other nematodes. Mol Biochem Parasitol. 2010;173:32–38. doi: 10.1016/j.molbiopara.2010.05.004. [DOI] [PubMed] [Google Scholar]
  • 33.Li MW, Lin RQ, Song HQ, Wu XY, Zhu XQ. The complete mitochondrial genomes for three Toxocara species of human and animal health significance. BMC Genomics. 2008;9:224. doi: 10.1186/1471-2164-9-224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kim KH, Eom KS, Park JK. The complete mitochondrial genome of Anisakis simplex (Ascaridida: Nematoda) and phylogenetic implications. Int J Parasitol. 2006;36:319–328. doi: 10.1016/j.ijpara.2005.10.004. [DOI] [PubMed] [Google Scholar]
  • 35.Okimoto R, Macfarlane JL, Clary DO, Wolstenholme DR. The mitochondrial genomes of two nematodes, Caenorhabditis elegans and Ascaris suum. Genetics. 1992;130:471–498. doi: 10.1093/genetics/130.3.471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Jex AR, Hall RS, Littlewood DT, Gasser RB. An integrated pipeline for next-generation sequencing and annotation of mitochondrial genomes. Nucleic Acids Res. 2010;38:522–533. doi: 10.1093/nar/gkp883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hu M, Gasser RB. Mitochondrial genomes of parasitic nematodes–progress and perspectives. Trends Parasitol. 2006;22:78–84. doi: 10.1016/j.pt.2005.12.003. [DOI] [PubMed] [Google Scholar]
  • 38.Gasser RB, LeGoff L, Petit G, Bain O. Rapid delineation of closely-related filarial parasites using genetic markers in spacer rDNA. Acta Trop. 1996;62:143–150. doi: 10.1016/S0001-706X(96)00035-6. [DOI] [PubMed] [Google Scholar]
  • 39.Liu GH, Gasser RB, Nejsum P, Wang Y, Chen Q, Song HQ, Zhu XQ. Mitochondrial and nuclear ribosomal DNA evidence supports the existence of a new Trichuris species in the endangered françois’ leaf-monkey. PLoS One. 2013;8:e66249. doi: 10.1371/journal.pone.0066249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.De Ley P, Blaxter M. Systematic position and phylogeny. In: Lee DL, editor. The Biology of Nematodes. London and New York.: Taylor & Francis; 2002. pp. 1–30. [Google Scholar]
  • 41.Iorio R, Slapeta J, Otranto D, Paoletti B, Giangaspero A, Traversa D. Phylogenetic relationships of Habronema microstoma and Habronema muscae (Spirurida: Habronematidae) within the order Spirurida inferred using mitochondrial cytochrome c oxidase subunit 1 (cox1) gene analysis. Parasitol Res. 2009;104:979–984. doi: 10.1007/s00436-008-1276-x. [DOI] [PubMed] [Google Scholar]
  • 42.Černotíková E, Horák A, Moravec F. Phylogenetic relationships of some spirurine nematodes (Nematoda: Chromadorea: Rhabditida: Spirurina) parasitic in fishes inferred from SSU rRNA gene sequences. Folia Parasitol. 2011;58:135–148. doi: 10.14411/fp.2011.013. [DOI] [PubMed] [Google Scholar]
  • 43.Traversa D, Costanzo F, Iorio R, Aroch I, Lavy E. Mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequence of Spirocerca lupi (Nematoda, Spirurida): avenues for potential implications. Vet Parasitol. 2007;146:263–270. doi: 10.1016/j.vetpar.2007.03.015. [DOI] [PubMed] [Google Scholar]
  • 44.Nadler SA, Carreno RA, Mejía-Madrid H, Ullberg J, Pagan C, Houston R, Hugot JP. Molecular phylogeny of clade III nematodes reveals multiple origins of tissue parasitism. Parasitology. 2007;134:1421–1442. doi: 10.1017/S0031182007002880. [DOI] [PubMed] [Google Scholar]

Articles from Parasites & Vectors are provided here courtesy of BMC

RESOURCES