Skip to main content
Drug Design, Development and Therapy logoLink to Drug Design, Development and Therapy
. 2015 Feb 18;9:1103–1175. doi: 10.2147/DDDT.S73551

Hsa-microRNA-181a is a regulator of a number of cancer genes and a biomarker for endometrial carcinoma in patients: a bioinformatic and clinical study and the therapeutic implication

Shuming He 1,, Shumei Zeng 1, Zhi-Wei Zhou 2,3, Zhi-Xu He 3, Shu-Feng Zhou 2,3,
PMCID: PMC4342183  PMID: 25733820

Abstract

The aberrant expression of human microRNA-181a-1 (hsa-miR-181a) has been implicated in the pathogenesis of various cancers, serving as an oncogene or a tumor suppressor. However, the role of hsa-miR-181a in the pathogenesis of endometrial carcinoma (EC) and its clinical significance are unclear. This study aimed to search for the molecular targets of hsa-miR-181a using bioinformatic tools and then determine the expression levels of hsa-miR-181a in normal, hyperplasia, and EC samples from humans. To predict the targets of hsa-miR-181a, ten different algorithms were used, including miRanda-mirSVR, DIANA microT v5.0, miRDB, RNA22 v2, TargetMiner, TargetScan 6.2, PicTar, MicroCosm Targets v5, and miRWALK. Two algorithms, TarBase 6.0 and miRTarBase, were used to identify the validated targets of hsa-miR-181a-5p (a mature product of hsa-miR-181a), and the web-based Database for Annotation, Visualization and Integrated Discovery (DAVID) 6.7 was used to provide biological functional interpretation of the validated targets of hsa-miR-181a-5p. A total of 78 formalin-fixed, paraffin-embedded tissue specimens from 65 patients and 13 healthy subjects were collected and examined, including normal endometrium (n=13), endometrial hyperplasia (n=18), and EC (37 type I and 10 type II EC cases). Our bioinformatic studies have showed that hsa-miR-181a might regulate a large number of target genes that are important in the regulation of critical cell processes, such as cell fate, cell survival, metabolism, and cell death. To date, 313 targets of hsa-miR-181a have been validated, and 22 of these targets are cancer genes. The precision of predictions by all the algorithms for hsa-miR-181a-1’s targets was low. Many of these genes are involved in tumorigenesis of various cancers, including EC, based on the DAVID and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. In comparison with normal endometrial tissue, the expression level of hsa-miR-181a was significantly increased in type I and type II EC (P<0.05), and type II EC exhibited a significant higher expression level of hsa-miR-181a than that in type I EC (P<0.05). In addition, there was a significant increase in the expression level of hsa-miR-181a in type II EC compared with endometrial hyperplasia (P<0.05). Taken together, these results suggest that hsa-miR-181a may serve as an oncogene in endometrial tumorigenesis and that hsa-miR-181a might be used as a new biomarker in the prediction of prognosis of EC in clinical practice. More functional and mechanistic studies are needed to validate the role of hsa-miR-181a in the development, progression, and metastasis of EC.

Keywords: RT-PCR, endometrial cancer, development, progression

Introduction

microRNAs (miRNAs) are a large group of noncoding small RNAs with 20–25 nucleotides that have a capability of regulating gene expression at posttranscriptional levels by antisense complementarily to specific target messenger (m)RNAs.1,2 Based on miRBase version 21 released in June 2014 (http://www.mirbase.org/), there are 1,881 miRNA precursors and 2,588 mature miRNAs in humans. miRNAs are transcribed as ~70 nucleotide stem-loop precursors and subsequently processed by the cytoplasmic RNase III-type enzyme Dicer to generate ~22 nucleotide mature products that can target and modulate protein expression by inhibiting translation and/or inducing degradation of target mRNAs. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA. miRNAs act as adaptors that employ a silencing complex to target mRNAs by selective base-pairing, primarily in the 3′-untranslated region (3′-UTR). Target interaction does not require perfect complementarity between microRNA and mRNA sequences, although near-perfect base-pairing in a small region in the 5′-end (positions 2–8) of the microRNA (sometimes termed “seed”) appears to be one of the key determinants of target recognition. miRNAs regulate almost every signaling pathway and play crucial roles in diverse biological processes, such as development, differentiation, apoptosis, and proliferation.13 It has been shown that aberrant expression of miRNAs is involved in the development and progression of many types of cancer through regulation of functional proteins and the network of signaling pathways related to cell proliferation, cell migration and invasion, programmed cell death, and cell survival.37 It has been proposed that miRNAs can function as tumor suppressors or oncogenes, targeting other oncogenes and/or tumor-suppressors to modulate cancer development, progression, and metastasis.1,58

An extremely large number of potential target sites exist for any given miRNA, and the process of validating a potential miRNA target in the laboratory is time consuming and costly. A computational approach to prediction of miRNA targets facilitates the process of narrowing down potential target sites for experimental validation, which is a critical initial step in identifying miRNA–target interactions. Several useful algorithms/tools provide microRNA target predictions based on sequence complementarity to target sites, with emphasis on perfect or near-perfect base-pairing in the seed region and sequence conservation.9,10 These tools for miRNA target prediction, encompassing a range of different computational approaches, from the modeling of physical interactions to the incorporation of machine learning, are mostly based on seed match, conservation, free energy, and site accessibility.10

Endometrial cancer (EC) is the sixth most common cancer in women worldwide, with at least 320,000 new cases being diagnosed and 74,000 women who die from this disease every year.11 In the United States, there was an estimation of 52,630 new cases and 8,590 deaths due to EC in 2014.12 In the United Kingdom, there were 8,474 women diagnosed with EC and 1,914 deaths from EC in 2011.11 In the People’s Republic of China, the incidence of EC is much lower than Western countries. It contributes about 1% of the world’s new EC cases.11

There are two types of EC, type I and type II, with different molecular expression profiles and histopathological and clinical behaviors.13,14 Type I EC, accounting for 75% of EC, is estrogen-dependent with endometrioid morphology, and the 5-year survival rate is 80%−85%.15 Type II EC exhibits poorly differentiated endometrioid and serous histological alterations with myometrial invasion and extra-uterine spread, and the 5-year survival rate is about 35%. Type I EC is related to hyperestrogenism, associated with endometrial hyperplasia, frequent expression of estrogen and progesterone receptors (ER and PR), and younger age, whereas type II EC is unrelated to estrogen and is associated with atrophic endometrium, frequent lack of ER and PR, and older age. The morphologic differences in type I and type II EC are mirrored in their molecular genetic profile, with type I showing defects in DNA-mismatch repair and mutations in phosphatase and tensin homolog (PTEN), phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit α (PIK3CA), V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS), and β-catenin/CTNNB1, and type II showing chromosomal instability and aneuploidy, p53 mutations, and human epidermal growth factor receptor 2 (HER2)/neu (erbB-2) amplification.16,17 Type I EC is associated with chronic exposure to unopposed estrogen and is often preceded by complex atypical hyperplasia. Current therapies for EC include surgery, chemotherapy, radiation therapy, immunotherapy, and biological therapy.18 Most cases of EC are diagnosed at an early stage, which has a 5-year survival rate of over 91%.11 However, the prognosis of EC does not meet the long-term survival expectation due to tumor metastasis, lack of effective treatment, and rarity of valid biomarkers to precisely predict therapeutic outcome.19 There are lines of evidence that a number of genetic and epigenetic factors have been implicated in the pathogenesis of EC, including abnormality in oncogenes, tumor suppressors, and miRNAs and related signaling pathways.13 Alterations in the expression profiles of oncogenes and tumor suppressor genes are the major contributing factors to the initiation, development, progression, and metastasis of EC. However, the association between such alterations and the clinical phenotypes of EC has not been conclusively established yet, and the underlying mechanism for EC etiology remains elusive.

There is an increased interest in the discovery and identification of miRNAs as novel epigenetic biomarkers for early detection and prediction of therapeutic outcomes in cancer therapy.2024 So far, there are a number of human miRNAs that have been identified to have a potential role in the development and progression of EC, including hsa-miR-181a, hsa-miR-185, hsa-miR-106a, hsa-miR-210, hsa-miR-423, hsa-miR-107, hsa-miR-let7c, and hsa-miR-221.3,4 hsa-miR-181a is one of the many miRNAs conserved among the vertebrates that is preferentially expressed in B lymphocytes of bone marrow, and its ectopic expression in hematopoietic stem/progenitor cells modulates blood cell development.25 hsa-miR-181a has been reported to be a key modulatory factor in the regulation of cell proliferation and differentiation at transcriptional and posttranscriptional levels in gastric cancer, acute myeloid leukemia, and other types of cancer,26,27 and hsa-miR-181a overexpression resulted in promotion of cell proliferation and migration but inhibition of apoptosis in colorectal cancer.28 RalA, one of the Ral family small G proteins, is directly regulated by hsa-miR-181a and plays an important role in the development chronic myelogenous leukemia.29 hsa-miR-181a and hsa-miR-181b act as tumor suppressors by inducing cell growth inhibition, apoptosis, and repression of invasion in glioma cells.30 So far, there have been only scattered reports about the role of a form of miR-181a in EC.4 Panda et al31 showed that the expression level of miR-181a-1 was higher in EC than in normal endometrial tissues. However, there is limited information on the association between the expression profile of miR-181a and the development and progression of EC. In this regard, we conducted a comprehensive bioinformatic study to predict the targets of miR-181a-1 and then validate these targets based on published experimental evidence. Finally, we examined the expression levels of miR-181a-1 in different types of EC and the association with the clinical progression of EC.

Material and methods

Gene nomenclature

The miR-181 family includes four members, namely miR-181a, miR-181b, miR-181c, and miR-181d. They are expressed in at least 70 species and various human cancers and are highly conserved in the seed-region sequence and RNA secondary structure. hsa-miR-181a-1 was retrieved from miRBase 21 (http://www.mirbase.org/). The hsa-miR-181a-1 gene (MIR181A1) has been mapped to 1q32.1. miRBase was established in 2002 as the public and central online repository for all published miRNA sequences and associated annotations, and the latest miRBase release of v21 (released in June 2014) contains 28,645 miRNA loci from 223 species (of which 1,881 precursors and 2,588 mature miRNAs are for humans), processed to produce 35,828 mature miRNAs. As compared with miRBase v20, a total of 4,196 new hairpin sequences and 5,441 novel mature products, mainly for bat, horse, goat, cobra, and salmon, have been added, with 72 dubious and misannotated entries removed from version 21. miRBase provides a user-friendly web interface for miRNA data, allowing the user to search using key words or sequences, trace links to the primary literature referencing the miRNA discoveries, analyze genomic coordinates and context, and mine relationships between miRNA sequences.3234 Clusters of miRNA sequences in the genome are highlighted and can be defined and retrieved with any inter-miRNA distance. The mature forms of hsa-miR-181a include hsa-miR-181a-3p and hsa-miR-181a-5p (Table 1).

Table 1.

Basic information on hsa-miR-181a-1 gene (MIR181A1) retrieved from miRBase 21

Gene Accession number Previous IDs Sequence Number of nucleotides Predicted targets Validated targets
hsa-miR-181a-1 MI0000289 hsa-miR-213 UGAGUUUUGAGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAUUAAAAUCAAAACCAUCGACCGUUGAUUGUACCCUAUGGCUAACCAUCAUC UACUCCA 109
hsa-miR-181a-5p MIMAT0000256 hsa-miR-181a 24-AACAUUCAACGCUGUCGGUGAGU-46 23 DIANA microT v3.0, miRanda-mirSVR (microRNA.org), miRDB, RNA22 v2, TargetMiner, TargetScan6.2, PicTar, MicroCosm, and miRWALK miRTarBase and TarBase
hsa-miR-181a-3p MIMAT0000270 hsa-miR-213 and hsa-miR-181a* 64-ACCAUCGACCGUUGAUUGUACC-85 22 DIANA microT v3.0, miRanda- mirSVR (microRNA.org), miRDB, RNA22 v2, TargetMiner, MicroCosm, and miRWALK

Prediction of the targets of hsa-miR-181a using various computational algorithms

Before starting the bench and clinical work, we conducted a bioinformatic study to predict the target genes regulated by hsa-miR-181a-3p and hsa-miR-181a-5p, using ten different algorithms, including miRanda-mirSVR (http://www.microrna.org/), DIANA microT v5.0 (http://diana.cslab.ece.ntua.gr/microT/), miRDB (http://mirdb.org/miRDB/), RNA22 v2 (https://cm.jefferson.edu/rna22v2.0/), Target-Miner (http://www.isical.ac.in/~bioinfo_miu/targetminer20.htm), TargetScan 6.2 (http://www.targetscan.org/), PicTar (http://pictar.mdc-berlin.de/), MicroCosm Targets v5 (http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/), and miRWALK (http://www.umm.uni-heidelberg.de/apps/zmf/mirwalk/index.html).

miRanda-mirSVR (http://www.microrna.org/) is an online tool that can be used to predict targets and score them.35 Unlike most miRNA target predictors, miRanda considers matching along the entire miRNA sequence, and it takes the seed region into account by weighting matches in the seed region more heavily; free energy is calculated by predicting the folding of the miRNA:mRNA hybrid, using the Vienna package. DIANA microT v5.0 currently hosts miRNA target predictions for Homo sapiens, Mus musculus, Drosophila melanogaster, and Caenorhabditis elegans, based on data from Ensembl release 69 and miRBase version 18.36,37 miRDB, a web-based database and tool, can predict miRNAs and their targets.38 All the targets are predicted by the bioinformatic tool MirTarget2, which has been developed by analyzing thousands of genes impacted by miRNAs, using a support vector machine (SVM) learning machine. RNA22 v2 can be used to predict the targets of miRNAs in human, mouse, roundworm, and fruit fly.39 It allows users to visualize the predictions within a complementary (c)DNA map and also find transcripts where multiple miRNAs of interest target.

TargetMiner is a robust tool for microRNA target prediction with systematic identification of negative examples.40 In this algorithm, ~300 tissue-specific negative examples have been identified, using a novel approach that involves expression profiling of miRNAs and mRNAs, miRNA–mRNA structural interactions, and seed-site conservation. TargetScan 6.2 can predict biological targets of miRNAs by searching for the presence of conserved 8-mer and 7-mer sites matching the seed region of each miRNA,41 with non-conserved sites being predicted as well. TargetScan is the first computational method used for human miRNA target prediction, that uses mouse, rat, and fish genomes for conservation analysis. In mammals, the prediction is ranked based on the predicted efficacy of targeting as calculated using the context+ scores of the sites.42 The context score for a specific site is the sum of the contribution of four features: site-type contribution, 3′-pairing contribution, local nucleobases adenine and uracil contribution, and position contribution. In the current work, the sum of the context scores for each miRNA was calculated, and the most favorable (lowest) was shown. PicTar is an algorithm for the identification of miRNA targets.43 In addition, MicroCosm Targets v5 was used to predict the targets that might be regulated by hsa-miR-181a. In this tool, there are 851 miRNAs (711 native) with 34,788 targets for humans.

miRWALK is a comprehensive database that provides information on miRNAs from the human, mouse, and rat, on their predicted as well as validated binding sites on their target genes (http://www.umm.uni-heidelberg.de/apps/zmf/mirwalk/index.html).44 miRWALK predicts miRNA binding sites on the complete sequence of all known genes, including all transcripts and mitochondrial genes of the human, mouse, and rat, based on a comparison of identified miRNA binding sites with ten established miRNA-target prediction programs: miRWALK, DIANA-microT v3.0, miRanda, miRDB, PicTar 4 and PicTar 5, PITA (http://genie.weizmann.ac.il/pubs/mir07/mir07_prediction.html), RNA22, RNAhybrid (http://bibiserv.techfak.uni-bielefeld. de/rnahybrid/submission.html), and TargetScan. In addition, it provides predicted miRNA binding sites on genes associated with 449 human biological pathways and 2,356 Online Mendelian Inheritance in Man (OMIM) disorders.44 This algorithm also presents information on experimentally validated miRNA interaction information associated with genes, pathways, diseases, organs, OMIM disorders, cell lines, and literature on miRNAs.

Validated targets of hsa-miR-181a based on TarBase 6.0 and miRTarBase 4.0

Two algorithms were used to identify the validated targets of miR-181a-5p: TarBase 6.0 and miRTarBase 4.0. TarBase 6.0 is a database that houses a manually curated collection of experimentally supported miRNA targets in 21 species, including human, rat, mouse, virus, Caenorhabditis elegans, Danio rerio (zebrafish), Drosophila, and plant (http://diana.imis.athena-innovation.gr/DianaTools/index.php?r=tarbase/index).45 TarBase 6.0 is the largest available manually curated target database, indexing more than 65,000 miRNA-gene interactions, 16.5- to 175-fold more than any other available implementation. The database includes targets derived from specific as well as high-throughput experiments, such as microarrays and proteomics. Specific attention was paid in the inclusion of targets derived from sequencing experiments, such as high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation (HITS-CLIP) and photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP). TarBase 6.0 hosts data derived from three CLIP-Seq and 12 Degradome-Seq studies, significantly more than any other available database. DIANA TarBase 6.0 offers a significant amount of crucial information to the user, including detailed description of the involved genes and miRNAs, a list of publications supporting each interaction, and the experimental methods used for validations, along with their outcomes. The database also provides links to related Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, as well as to other external databases, such as Ensembl, Uniprot, and RefSeq. It is also equipped with powerful searching and filtering capabilities.

miRTarBase 4.0 has collected 51,460 miRNA–target interactions from 18 species having experimental evidence (http://mirtarbase.mbc.nctu.edu.tw/).46 Generally, the collected miRNA–target interactions are validated experimentally by reporter assay, Western blotting, microarray, and next-generation sequencing experiments. There are 4,572 miRNA–target interactions validated by reporter assays or Western blotting experiments.

Cancer genes are defined as “mutated genes that are causally implicated in oncogenesis” based on the criteria by Futreal et al47 (Table S1 gives the full list of cancer genes). The proteins that are encoded by cancer genes normally regulate cell proliferation, cell differentiation, and cell death. Mutations underlying oncogenesis also occur in genes that mediate DNA-repair processes. Currently, more than 1% of all human genes have been implicated, via mutation, in cancer. Of these, approximately 90% have been implicated in somatic mutations in cancer, 20% bear germline mutations that predispose to cancer, and 10% show both somatic and germline mutations.48

Pathway analysis by the Database for Annotation, Visualization and Integrated Discovery (DAVID)

The web-based DAVID 6.7 (http://david.abcc.ncifcrf.gov/)49,50 was used to provide biological functional interpretation of the validated targets of hsa-miR-181a-5p, based on TarBase 6.0 and miRTarBase 4.0. DAVID 6.7 systematically maps a large number of interesting genes in a list to associated Gene Ontology (GO) terms, and then statistically highlights the most overrepresented (enriched) GO terms out of a list of hundreds or thousands of terms.47,48 The DAVID Knowledgebase has comprehensively integrated more than 20 types of major gene/protein identifiers and more than 40 well-known functional annotation categories from dozens of public databases, to address the enriched and redundant relationships among many genes to many terms. The protein IDs of the validated targets of hsa-miR-181a-5p from the National Center for Biotechnology Information (NCBI), Protein Information Resource (PIR), and UniProtKB were converted into gene lists, using the Gene ID Conversion Tool in DAVID. By doing so, interesting genes derived from one identifier system can be quickly translated to other gene identifier types preferred by a given annotation resource. The DAVID database adds biological function annotation including GO terms, protein–protein interactions, protein functional domains, disease associations, gene clustering, biopathways, sequence general features, homologies, gene functional summaries, and gene tissue expressions in a network context.47,48 The genes of interest were visualized using BioCarta and KEGG pathway maps. The highest classification stringency was selected for functional annotation clustering. Enrichment scores and Fisher’s exact test P-values (and corresponding false discovery rate [FDR]) were then calculated to identify which functionally related gene groups are significantly enriched in the target list.

Reagents and antibodies

The RNA inhibitor and Moloney murine leukemia virus reverse transcriptase were obtained from Promega Inc. (Madison, WI, USA). The antigen retrieval solution (ethyl-enediaminetetraacetic acid [EDTA] method) and Dolichos biflorus agglutinin kit were purchased from Maixin Biological Co. Ltd., Fuzhou, Fujian, People’s Republic of China. Human monoclonal primary antibodies against (ER, PR), and horseradish peroxidase-conjugated secondary antibodies were bought from Linked-Biotech Pathology Co. Ltd. (Guangzhou, Guangdong, People’s Republic of China). MiR-easy FFPE Kit and Syber® Green PCR mix were purchased from QIAGEN Inc. (Venlo, the Netherlands).

Sample collection

Fresh tissue samples were obtained from 65 patients who received uterusectomy and 13 healthy subjects at Xiaolan People’s Hospital or Zhongshan People’s Hospital, Zhongshan, Guangdong, or at Nanfang Hospital of Southern Medical University, Guangzhou, Guangdong, People’s Republic of China, with a mean age of 48 years (range 24–69). We collected the endometrial samples from 47 patients with EC, 18 patients with endometrial hyperplasia, and 13 healthy subjects. There was no preoperative radiotherapy, chemotherapy, or endocrine therapy performed in any of the recruited participants. All samples were fixed with formalin and embedded with paraffin. International Federation of Gynecology and Obstetrics (FIGO) staging was performed according to the FIGO classification.15,51 Histological classification of tissue samples was performed according to the World Health Organization (WHO) criteria (www.iarc.fr/en/.../BB2.pdf), and samples were classified as G1 (well differentiated), G2 (moderately differentiated), or G3 (poorly differentiated). The study design was approved by the Ethics Committees of Xiaolan People’s Hospital, Zhongshan People’s Hospital, and Nanfang Hospital. Written informed consent was obtained from each participant.

Immunohistochemistry

Dewaxed and dehydrated sections were first washed with phosphate-buffered saline (PBS) and then incubated with 3% peroxyl in methanol for 15 minutes to terminate the activity of endogenous peroxidases. The sections were washed with PBS, and antigen retrieval was performed. The sections were immersed into boiled citrate-buffered solution for 10 minutes and blocked with 5% bovine serum albumin in PBS for 20 minutes at room temperature. Thereafter, the sections were probed with primary antibody against ER or PR overnight in a humidified chamber at 4°C. On the following day, sections were incubated with biotinylated anti-Rabbit antibody (Boster Biotechnology Ltd., Wuhan, Hubei, People’s Republic of China) for 30 minutes at room temperature and then coupled with diaminobenzidine to visualize the expression of the targeted proteins. After all sections were counterstained with hematoxylin, they were dehydrated in ascending ethanol and then mounted using neutral resins. Samples with both ER-positive and PR-positive were classified as type I EC, while samples with both ER-negative and PR-negative were classified as type II EC.4,25

Primer design

The sequences of target gene were retrieved from GenBank (http://www.ncbi.nlm.nih.gov/genbank/) and miRBase (http://www.mirbase.org/). The primers were designed using Primer Designer 2.0, and the sequences are shown in Table 2. All primers were synthesized by Beijing Liu He Synthetic Genomics Ltd., Beijing, People’s Republic of China. U6 was used as the internal control.

Table 2.

Sequences of the primers for the determination of hsa-miR-181a and U6

Gene Forward primer Reverse primer
hsa-miR-181a GTCGTATCCAGTGCGTGTCGTGGAGTCG GCAATTGCACTGGATACGACACTCAC
U6 GTCGTATCCAGTGCGTGTCGTGGAGTCGG CAATTGCACTGGATACGACAAAATATG

Total RNA extraction

A series of sections of thickness 10 μm was obtained, and the paraffin was dissolved by xylene treatment. Ten slides were prepared for each sample. Sections with cell content more than 50% of the area were selected for total RNA extraction. Briefly, sections were washed twice with ethanol in a 1.5 mL centrifuge tube to remove residual xylene. Total RNA was extracted, and the purity and integrity of the total RNA were examined using a miRNeasy FFPE kit according to the manufacturer’s instruction. The purity of the total RNA was tested using an ultraviolet (UV) spectrophotometer. The ratio of A260/A280 between 1.8 and 2.1 was considered as high purity. Electrophoresis was performed to detect the RNA integrity in 1.0% agarose denaturing gel.

Quantitative real-time polymerase chain reaction (qRT-PCR) analysis

RNA was reversely transcribed into cDNA, using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer’s instruction. The resultant cDNA was subject to qRT-PCR analysis using a Bio-Rad Real-time PCR System (Bio-Rad Laboratories Inc., Hercules, CA, USA) and Syber green PCR mix. The conditions for RT-PCR were 95°C for 6 minutes and then 50 cycles of 95°C for 10 seconds, 55°C for 10 seconds, and 72°C for 30 seconds. The dissolution curve was analyzed to determine the specificity of the real-time PCR amplification. The relative expression level of hsa-miR-181a was calculated by the comparative cycle threshold method, with U6 as the internal reference and expressed as the percentage change relative to untreated controls. Quantification of the relative expression levels of hsa-miR-181a was achieved by the following formula: 2−ΔΔCt, where ΔΔCt equals (Ct of hsa-miR-181a- Ct of U6)experiment minus (Ct of hsa-miR-181a- Ct of U6)control. 2−ΔΔCt was presented as the relative change of hsa-miR-181a expression.

Statistical analysis

Data are expressed as the mean ± standard deviation (SD). Statistical analysis was performed using one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison to determine statistical significance among multiple groups. Student’s t-test was used to compare the difference between two groups when appropriate. P<0.05 was considered as statistically significant.

Results

Predicted targets of hsa-miR-181a-5p and hsa-miR-181a-3p using various algorithms

Predicted targets of hsa-miR-181a-5p

Using DIANA microT v3.0, hsa-miR-181a-5p was predicted to regulate 522 targets when the threshold was set to 0.7, including ATP1B1, BHLHE40, CLASP1, CRE-BRF, FBXO33, GLS, KLHL5, LRBA, MAP1B, MTF2, NMT2, PAPD5, REPS2, RLF, SESN3, SLC2A3, SLITRK1, TMEM131, TRIM2, ZFP90, ZNF268, ZNF441, ZNF527, ZNF570, ZNF704, ZNF717, ZNF781, ZNF788, ZNF799, ZNF846, etc (Table 3 and Table S2). Many of these targets regulate a number of important cellular processes, such as cell proliferation, cell death, cell division, mitosis, metabolism of glucose, lipids, nuclear acids, and amino acids, and transport. Among the predicted targets, 30 of the predicted targets (5.74%) were cancer genes, including ABI1, ARID2, ATM, BCL11B, BCL6, CARD11, CCDC6, CHN1, CREB1, GNAQ, HMGA2, LCP1, MAF, MAP2K1, MLLT10, MSI2, NOTCH2, NR4A3, PAX5, PBX1, PHOX2B, PMS1, PRDM1, PTEN, SS18L1, STAG2, TRIM33, WHSC1, WIF1, and XPO1 (Table 3 and Table S2).

Table 3.

Predicted targets of hsa-miR-181a-5p by various predicting tools

Tool Website (URL) Number of predicted targets/transcripts Examples of predicted targets Cancer genes
DIANA microT v5.0 http://diana.cslab.ece.ntua.gr/microT/ 522 (threshold set at 0.7) ATP1B1, BHLHE40, CLASP1, CREBRF, FBXO33, GLS, KLHL5, LRBA, MAP1B, MTF2, NMT2, PAPD5, REPS2, RLF, SESN3, SLC2A3, SLITRK1, TMEM131, TRIM2, ZFP90, ZNF268, ZNF441, ZNF527, ZNF570, ZNF704, ZNF717, ZNF781, ZNF788, ZNF799, ZNF846, etc ABI1, ARID2, ATM, BCL11B, BCL6, CARD11, CCDC6, CHN1, CREB1, GNAQ, HMGA2, LCP1, MAF, MAP2K1, MLLT10, MSI2, NOTCH2, NR4A3, PAX5, PBX1, PHOX2B, PMS1, PRDM1, PTEN, SS18L1, STAG2, TRIM33, WHSC1, WIF1, and XPO1 (n=30)
miRanda-mirSVR http://www.microrna.org/ 7,847 ZNF527, ZNF439, ZNF781, ZNF559, ZNF204P, BAZ2B, ZNF844, C15orf29, FBXO34, C5orf41, KIAA0528, ZNF594, EIF4A2, ZNF833, GATM, ZNF440, MARK1, OSBPL3, AP1G1, GABRA1, DDX3X, HCN1, CPOX, TMEM87B, RPE65, BIRC6, NOVA1, LOC442421, ZNF780A, etc ABI1, ABL1, ABL2, AKAP9, AKT2, APC, ARHGEF12, ARID2, ARNT, ATF1, ATM, ATP2B3, ATRX, BAP1, BCL2, BCL6, BCL7A, BCL9, BCOR, BCR, BRCA1, BTG1, C16orf75, CALR, CAMTA1, CANT1, CARD11, CASP8, CBFA2T3, CBL, CBLB, CCDC6, CCNE1, CD274, CDC73, CDH1, CDK6, CDX2, CEBPA, CHCHD7, CHN1, CLTC, CREB1, CREB3L2, CREBBP, CRTC3, CTNNB1, CYLD, DAXX, DDX10, DDX5, DEK, DICER1, DNM2, ECT2L, EGFR, EIF4A2, EML4, EPS15, ERG, ETV1, ETV6, EXT2, EZH2, FAM46C, FANCA, FANCD2, FANCF, FANCG, FAS, FBXO11, FGFR1, FGFR1OP, FGFR2, FGFR3, FLT3, FNBP1, FOXP1, FSTL3, FUS, GAS7, GATA2, GNAS, GOPC, H3F3B, HERPUD1, HEY1, HLF, HMGA2, HNRNPA2B1, HOOK3, HOXA11, HOXC11, HOXC13, IDH1, IGL@, IL2, IL21R, IL6ST, IL7R, IRF4, JAK2, JAZF1, JUN, KCNJ5, KDM5A, KDM5C, KDM6A, KDR, KIAA1549, KLK2, KRAS, LASP1, LCP1, LIFR, LMO1, LPP, MAF, MAFB, MALAT1, MALT1, MAP2K1, MAP2K4, MDM2, MDM4, MDS2, MET, MITF, MKL1, MLF1, MLH1, MLL, MLL3, MLLT10, MLLT3, MLLT4, MLLT6, MN1, MPL, MSH2, MSI2, MYB, MYCN, MYH11, NCOA1, NCOA2, NF1, NF2, NFE2L2, NFIB, NIN, NOTCH2, NPM1, NR4A3, NRAS, NSD1, NT5C2, NUP98, PAFAH1B2, PAX3, PAX5, PAX7, PBRM1, PBX1, PDE4DIP, PDGFRA, PDGFRB, PHF6, PHOX2B, PICALM, PIK3R1, PLAG1, PML, PMS1, PPARG, PRDM1, PTEN, PTPRC, RAC1, RAD21, RALGDS, RANBP17, RAP1GDS1, RB1, RNF43, RPL5, RUNX1, SDC4, SETBP1, SF3B1, SH2B3, SLC34A2, SMARCA4, SMARCE1, SRGAP3, SS18L1, STAT3, SUFU, SUZ12, SYK, TAF15, TAL2, TBL1XR1, TCF7L2, TCL6, TET2, TFRC, TMPRSS2, TOP1, TPM3, TRA@, TRIM27, TRIM33, TRRAP, TSC1, TSHR, U2AF1, UBR5, VTI1A, WHSC1, WIF1, YWHAE, and ZNF521
miRDB http://mirdb.org/miRDB/ 1,065 PDE5A, ZNF439, PRTG, BRWD1, ZNF549, NFAT5, SH3TC2, OSBPL3, GFPT1, ZNF781, TNPO1, PAPD5, FIGN, S1PR1, TMEM87B, DDX3X, ZNF559, ZNF844, CLMN, GPR26, CTDSPL, ANKRD13C, FUT9, RAB3IP, DLGAP2, BIRC6, ZNF268, C5orf41, PAM, KIAA0528, ARHGEF3, etc ABI1, ATF1, ATM, BCL11A, CBLB, CREB1, EIF4A2, ETV6, FAS, FOXP1, GAS7, HLF, HOOK3, HOXA11, IL2, JAZF1, KDM5A, LIFR, LPP, MAP2K1, MAP2K4, MDM4, MET, MLL, MLL3, MLLT10, NCOA2, NFIB, NOTCH2, NR4A3, NRAS, PBX1, PDGFRA, PLAG1, RAD21, SH2B3, TCF7L2, TET2, TFRC, TMPRSS2, VHL, VTI1A, and WIF1
RNA22 v2 https://cm.jefferson.edu/rna22v2.0/ 7,042 NIPAL3, PAX7, METTL13, FMO1, CLCN6, CLCA1, CLCA1, ATP1A2, KPNA6, SLAMF7, ZZZ3, USH2A, TRIT1, TPR, VPS13D, PER3, COL9A2, HHAT, TNFRSF9, KIF1B, ATP2B4, ZC3H11A, ZC3H11A, TMEM48, TARBP1, DDX20, GNAI3, SPEN, TIE1, IARS2, KCNAB2, TGFBR3, etc AKAP9, ARHGEF12, ARID2, ARNT, ASXL1, ATM, ATP1A1, ATRX, AXIN1, BAP1, BCL11A, BCL11B, BCL3, BCL6, BCOR, BCR, BLM, BMPR1A, BRAF, BRCA1, BRD4, BTG1, BUB1B, C15orf55, C2orf44, CAMTA1, CARD11, CARS, CBLB, CCND1, CD74, CDH1, CDK4, CHCHD7, CHEK2, CHN1, CIITA, CLTC, COL1A1, CREB1, CREB3L2, CRTC3, CTNNB1, CYLD, DDX5, DICER1, DNM2, DNMT3A, ECT2L, EGFR, ELF4, ELL, ERBB2, ERCC2, ETV5, EXT1, EZH2, FANCA, FANCD2, FBXO11, FBXW7, FGFR1, FGFR1OP, FGFR2, FHIT, FNBP1, FOXP1, GAS7, GATA2, GATA3, GNAQ, GNAS, GOLGA5, GPHN, HERPUD1, HIP1, HMGA1, HMGA2, HRAS, IDH1, IDH2, IL6ST, IL7R, ITK, JAK3, JAZF1, JUN, KCNJ5, KDM5A, KIAA1549, KIT, KRAS, LASP1, LCP1, LIFR, LPP, MAF, MALT1, MAML2, MAP2K1, MAX, MDM2, MDM4, MED12, MITF, MKL1, MLF1, MLH1, MLL, MLL3, MLLT10, MLLT3, MLLT4, MLLT6, MN1, MSH6, MSI2, MSN, MYD88, MYH11, MYST4, NACA, NCOA1, NDRG1, NF1, NF2, NIN, NONO, NOTCH1, NOTCH2, NT5C2, NTRK3, NUP214, NUP98, OLIG2, P2RY8, PAFAH1B2, PALB2, PAX5, PAX7, PBRM1, PBX1, PDE4DIP, PDGFRA, PDGFRB, PER1, PHF6, PHOX2B, PIK3CA, PIK3R1, PLAG1, PML, POU2AF1, PPARG, PRDM16, PTEN, PTPN11, PTPRC, RAD21, RAF1, RALGDS, RANBP17, RET, ROS1, RPN1, SBDS, SDC4, SDHD, SETBP1, SETD2, SFPQ, SLC45A3, SMO, SOX2, SRGAP3, SS18, SS18L1, SSX1, SSX2, SSX4, STAG2, STAT3, SUZ12, TAF15, TAL1, TBL1XR1, TCL1A, TERT, TET2, TFRC, THRAP3, TMPRSS2, TNFAIP3, TNFRSF14, TOP1, TRAF7, TRIM33, TRIP11, TRRAP, TSC1, TSC2, TSHR, UBR5, VHL, WHSC1, WHSC1L1, WRN, WWTR1, ZNF331, ZNF384, and ZNF521
TargetMiner http://www.isical.ac.in/~bioinfo_miu/targetminer20.htm 108 GPD2, THRB, DIO2, GABRA4, KITLG, PGR, SMAD5, LDLRAD4, MFAP3L, MTX3, CREB5, KCNMA1, RAB3IP, AP1G1, FOXK1, GK5, CREBZF, CHIC1, PAPD5, CYLD, KDM5A, ACVR2B, LOC124389, CALCR, AFF2, ITGA2, etc CYLD, KDM5A, KRAS, LIFR, and TET2
TargetScan 6.2 http://www.targetscan.org/ 1,194 transcripts (626 genes) ZNF780A, PPIP5K2, NUDT12, HOXC8, MARK1, TOM1L1, CLVS1, ZNF563, S1PR1, ZNF568, FLT1, BTBD3, TCERG1, CTDSPL, SLC25A37, DDX3Y, RPS6KB1, METAP1, FGD4, PBMUCL1, CDON, DDX3X, ZFP62, CLMN, TMEM165, PAPD5, ZFP82, CLIP1, SLC7A2, etc ABL2, ARID2, ATP2B3, ATXN1, BCL2, BCL9, BCR, CALR, CBFA2T3, CBLB, CCDC6, CDC73, CEBPA, CREBL2, CYLD, EIF4A2, ERG, FGFR3, H3F3B, HLF, HOXA11, KDM5A, KIAA1549, LMO1, LPP, MAP2K1, NCOA2, NFIB, NOTCH2, PAFAH1B2, PBX1, PRDM1, SH2B3, SS18L1, TCF7L2, and WHSC1
PicTar http://pictar.mdc-berlin.de/ 510 transcripts (399 genes) KIAA0195, OSBPL3, CTDSPL, HIC2, GRIK2, ATXN1, ADAM11, ZBTB4, KIAA0802, FBXO33, PIP3AP, EYA3, CBX7, TARSH, CPEB4, LRRC5, MMP14, RLF, AKAP7, ZIC2, CLASP1, ATP2B2, SEMA4G, YTHDF3, FLJ23548, ALS2CR3, HOXC8, RSN, SOX6, TCERG1, COPEB, etc ATXN1, CARD11, CBFA2T3, CBLB, CHN1, COPEB, CREB1, EIF4A2, ETV6, FOXP1, HLF, HOXA11, JAZF1, KIT, LMO1, MYCN, NCOA2, NR4A3, PDGFRA, PHOX2B, PLAG1, RUNX1, and SS18L1
MicroCosm Targets v5 http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/ 1,104 NR6A1, TMEM64, TMED8, TMED4, TADA1L, ZNF17, ZNF487, SLC3A1, CARD11, DOCK7, SLC10A7, THBS4, E2F5, PRDX3, PLCL2, RGMA, DHX29, FAM58A, DMRT3, MAB21L1, C19orf59, TGFBRAP1, DEPDC6, CARM1, WDR45L, MDH1B, etc AKAP9, BCL11A, C16orf75, CAGE1, CARD11, CSF3R, EIF4A2, EXT2, FANCE, FAS, FGFR2, FOS, FOXP1, FVT1, HOOK3, IDH1, IL2, LMO1, MLF1, MRAS, MYBL1, PALB2, PHOX2B, RAB38, RALA, RASGRP4, RASIP1, RASSF1, RASSF6, SSX1, SSX2, STAG2, TAF15, TSG101, TUSC3, WIF1, and ZNF521

miRanda-mirSVR predicted that hsa-miR-181a-5p could regulate 7,847 transcripts/targets (Table 3 and Table S3). These included ZNF527, ZNF439, ZNF781, ZNF559, ZNF204P, BAZ2B, ZNF844, C15orf29, FBXO34, C5orf41, KIAA0528, ZNF594, EIF4A2, ZNF833, GATM, ZNF440, MARK1, OSBPL3, AP1G1, GABRA1, DDX3X, etc. Most of these genes regulate a number of important cellular processes, such as cell proliferation, cell death, division, mitosis, metabolism of glucose, lipids, nuclear acids, and amino acids, and transport. Notably, 223 genes from these predicted targets were cancer genes (2.84%) (Table S4). These included ABI1, ABL1, ABL2, AKAP9, AKT2, APC, ARHGEF12, ARID2, ARNT, ATF1, ATM, ATP2B3, ATRX, BAP1, BCL2, BCL6, BCL7A, BCL9, BCOR, BCR, BRCA1, BTG1, C16orf75, CALR, CAMTA1, CANT1, CARD11, CASP8, CBFA2T3, CBL, CBLB, CCDC6, CCNE1, CD274, CDC73, CDH1, CDK6, CDX2, CEBPA, CHCHD7, CHN1, CLTC, CREB1, CREB3L2, CREBBP, CRTC3, CTNNB1, CYLD, DAXX, DDX10, DDX5, DEK, DICER1, DNM2, ECT2L, EGFR, EIF4A2, EML4, EPS15, ERG, ETV1, ETV6, EXT2, EZH2, FAM46C, FANCA, FANCD2, FANCF, FANCG, FAS, FBXO11, FGFR1, FGFR1OP, FGFR2, FGFR3, FLT3, FNBP1, FOXP1, FSTL3, FUS, GAS7, GATA2, GNAS, GOPC, H3F3B, HERPUD1, HEY1, HLF, HMGA2, HNRNPA2B1, HOOK3, HOXA11, HOXC11, HOXC13, IDH1, IGL@, IL2, IL21R, IL6ST, IL7R, IRF4, JAK2, JAZF1, JUN, KCNJ5, KDM5A, KDM5C, KDM6A, KDR, KIAA1549, KLK2, KRAS, LASP1, LCP1, LIFR, LMO1, LPP, MAF, MAFB, MALAT1, MALT1, MAP2K1, MAP2K4, MDM2, MDM4, MDS2, MET, MITF, MKL1, MLF1, MLH1, MLL, MLL3, MLLT10, MLLT3, MLLT4, MLLT6, MN1, MPL, MSH2, MSI2, MYB, MYCN, MYH11, NCOA1, NCOA2, NF1, NF2, NFE2L2, NFIB, NIN, NOTCH2, NPM1, NR4A3, NRAS, NSD1, NT5C2, NUP98, PAFAH1B2, PAX3, PAX5, PAX7, PBRM1, PBX1, PDE4DIP, PDGFRA, PDGFRB, PHF6, PHOX2B, PICALM, PIK3R1, PLAG1, PML, PMS1, PPARG, PRDM1, PTEN, PTPRC, RAC1, RAD21, RALGDS, RANBP17, RAP1GDS1, RB1, RNF43, RPL5, RUNX1, SDC4, SETBP1, SF3B1, SH2B3, SLC34A2, SMARCA4, SMARCE1, SRGAP3, SS18L1, STAT3, SUFU, SUZ12, SYK, TAF15, TAL2, TBL1XR1, TCF7L2, TCL6, TET2, TFRC, TMPRSS2, TOP1, TPM3, TRA@, TRIM27, TRIM33, TRRAP, TSC1, TSHR, U2AF1, UBR5, VTI1A, WHSC1, WIF1, YWHAE, and ZNF521 (Table S4).

miRDB predicted that 1,065 targets/transcripts were possibly regulated by hsa-miR-181a-5p (Table 3 and Table S5). These included PDE5A, ZNF439, PRTG, BRWD1, ZNF549, NFAT5, SH3TC2, OSBPL3, GFPT1, ZNF781, TNPO1, PAPD5, FIGN, S1PR1, TMEM87B, DDX3X, ZNF559, ZNF844, CLMN, GPR26, CTDSPL, ANKRD13C, FUT9, RAB3IP, DLGAP2, BIRC6, ZNF268, C5orf41, PAM, KIAA0528, ARHGEF3, etc. Many of the predicted targets play a role in the regulation of cell proliferation, cell cycle, apoptosis, energy, nuclear acid, and protein metabolism, signaling transduction, and transport. Among these targets, 43 targets were cancer genes (4.04%). These included ABI1, ATF1, ATM, BCL11A, CBLB, CREB1, EIF4A2, ETV6, FAS, FOXP1, GAS7, HLF, HOOK3, HOXA11, IL2, JAZF1, KDM5A, LIFR, LPP, MAP2K1, MAP2K4, MDM4, MET, MLL, MLL3, MLLT10, NCOA2, NFIB, NOTCH2, NR4A3, NRAS, PBX1, PDGFRA, PLAG1, RAD21, SH2B3, TCF7L2, TET2, TFRC, TMPRSS2, VHL, VTI1A, and WIF1 (Table 3 and Table S5).

Using RNA22 v2, 7,028 targets were predicted to be regulated by hsa-miR-181a-5p (Table 3 and Table S6). These included NIPAL3, PAX7, METTL13, FMO1, CLCN6, CLCA1, CLCA1, ATP1A2, KPNA6, SLAMF7, ZZZ3, USH2A, TRIT1, TPR, VPS13D, PER3, COL9A2, HHAT, TNFRSF9, KIF1B, ATP2B4, ZC3H11A, ZC3H11A, TMEM48, TARBP1, DDX20, GNAI3, SPEN, TIE1, IARS2, KCNAB2, TGFBR3, etc. Many of the predicted targets play a role in the regulation of cell proliferation, cell cycle, apoptosis, energy, nuclear acid and protein metabolism, signaling transduction, and transport. Among the predicted targets, 211 genes were cancer genes (3.00%) (Table S7). These included AKAP9, ARHGEF12, ARID2, ARNT, ASXL1, ATM, ATP1A1, ATRX, AXIN1, BAP1, BCL11A, BCL11B, BCL3, BCL6, BCOR, BCR, BLM, BMPR1A, BRAF, BRCA1, BRD4, BTG1, BUB1B, C15orf55, C2orf44, CAMTA1, CARD11, CARS, CBLB, CCND1, CD74, CDH1, CDK4, CHCHD7, CHEK2, CHN1, CIITA, CLTC, COL1A1, CREB1, CREB3L2, CRTC3, CTNNB1, CYLD, DDX5, DICER1, DNM2, DNMT3A, ECT2L, EGFR, ELF4, ELL, ERBB2, ERCC2, ETV5, EXT1, EZH2, FANCA, FANCD2, FBXO11, FBXW7, FGFR1, FGFR1OP, FGFR2, FHIT, FNBP1, FOXP1, GAS7, GATA2, GATA3, GNAQ, GNAS, GOLGA5, GPHN, HERPUD1, HIP1, HMGA1, HMGA2, HRAS, IDH1, IDH2, IL6ST, IL7R, ITK, JAK3, JAZF1, JUN, KCNJ5, KDM5A, KIAA1549, KIT, KRAS, LASP1, LCP1, LIFR, LPP, MAF, MALT1, MAML2, MAP2K1, MAX, MDM2, MDM4, MED12, MITF, MKL1, MLF1, MLH1, MLL, MLL3, MLLT10, MLLT3, MLLT4, MLLT6, MN1, MSH6, MSI2, MSN, MYD88, MYH11, MYST4, NACA, NCOA1, NDRG1, NF1, NF2, NIN, NONO, NOTCH1, NOTCH2, NT5C2, NTRK3, NUP214, NUP98, OLIG2, P2RY8, PAFAH1B2, PALB2, PAX5, PAX7, PBRM1, PBX1, PDE4DIP, PDGFRA, PDGFRB, PER1, PHF6, PHOX2B, PIK3CA, PIK3R1, PLAG1, PML, POU2AF1, PPARG, PRDM16, PTEN, PTPN11, PTPRC, RAD21, RAF1, RALGDS, RANBP17, RET, ROS1, RPN1, SBDS, SDC4, SDHD, SETBP1, SETD2, SFPQ, SLC45A3, SMO, SOX2, SRGAP3, SS18, SS18L1, SSX1, SSX2, SSX4, STAG2, STAT3, SUZ12, TAF15, TAL1, TBL1XR1, TCL1A, TERT, TET2, TFRC, THRAP3, TMPRSS2, TNFAIP3, TNFRSF14, TOP1, TRAF7, TRIM33, TRIP11, TRRAP, TSC1, TSC2, TSHR, UBR5, VHL, WHSC1, WHSC1L1, WRN, WWTR1, ZNF331, ZNF384, and ZNF521 (Table S7).

TargetMiner predicted that 108 targets were regulated by hsa-miR-181a-5p, including GPD2, THRB, DIO2, GABRA4, KITLG, PGR, SMAD5, LDLRAD4, MFAP3L, MTX3, CREB5, KCNMA1, RAB3IP, AP1G1, FOXK1, GK5, CREBZF, CHIC1, PAPD5, CYLD, KDM5A, ACVR2B, LOC124389, CALCR, AFF2, ITGA2, etc (Table 3 and Table S8). Among these predicted targets, five were cancer genes, including CYLD, KDM5A, KRAS, LIFR, and TET2 (4.63%) (Table 3 and Table S8).

TargetScan 6.2 only provided the predicted targets for the precursor hsa-miR-181a. It predicted that hsa-miR-181a could regulate 1,194 transcripts with conserved sites, with a total of 1,412 conserved sites and 626 poorly conserved sites (Table 3 and Table S9). Among these transcripts, 626 were functional genes. These included ZNF780A, PPIP5K2, NUDT12, HOXC8, MARK1, TOM1L1, CLVS1, ZNF563, S1PR1, ZNF568, FLT1, BTBD3, TCERG1, CTD-SPL, SLC25A37, DDX3Y, RPS6KB1, METAP1, FGD4, PBMUCL1, CDON, DDX3X, ZFP62, CLMN, TMEM165, PAPD5, ZFP82, CLIP1, SLC7A2, etc. Many of the targets were involved in the regulation of cell proliferation, cell cycle, apoptosis, energy, nuclear acid, and protein metabolism, signaling transduction, and transport. Among the predicted targets, 36 were cancer genes (5.75%). These included ABL2, ARID2, ATP2B3, ATXN1, BCL2, BCL9, BCR, CALR, CBFA2T3, CBLB, CCDC6, CDC73, CEBPA, CREBL2, CYLD, EIF4A2, ERG, FGFR3, H3F3B, HLF, HOXA11, KDM5A, KIAA1549, LMO1, LPP, MAP2K1, NCOA2, NFIB, NOTCH2, PAFAH1B2, PBX1, PRDM1, SH2B3, SS18L1, TCF7L2, and WHSC1 (Table 3 and Table S9).

PicTar only provided predicted targets for the precursor hsa-miR-181a. It predicted that hsa-miR-181a could regulate 510 transcripts with 399 genes, including KIAA0195, OSBPL3, CTDSPL, HIC2, GRIK2, ATXN1, ADAM11, ZBTB4, KIAA0802, FBXO33, PIP3AP, EYA3, CBX7, TARSH, CPEB4, LRRC5, MMP14, RLF, AKAP7, ZIC2, CLASP1, ATP2B2, SEMA4G, YTHDF3, FLJ23548, ALS2CR3, HOXC8, RSN, SOX6, TCERG1, COPEB, etc (Table 3 and Table S10). Many of the predicted targets play a role in the regulation of cell proliferation, cell cycle, apoptosis, energy, nuclear acid, and protein metabolism, signaling transduction, and transport. Among the predicted targets, 23 (5.76%) were cancer genes involved in the initiation, growth, and development and metastasis of cancer, including ATXN1, CARD11, CBFA2T3, CBLB, CHN1, COPEB, CREB1, EIF4A2, ETV6, FOXP1, HLF, HOXA11, JAZF1, KIT, LMO1, MYCN, NCOA2, NR4A3, PDGFRA, PHOX2B, PLAG1, RUNX1, and SS18L1 (Table 3 and Table S10).

MicroCosm Targets v5 predicted that 1,104 targets/transcripts were likely regulated by hsa-miR-181a-5p (Table 3 and Table S11). These included NR6A1, TMEM64, TMED8, TMED4, TADA1L, ZNF17, ZNF487, SLC3A1, CARD11, DOCK7, SLC10A7, THBS4, E2F5, PRDX3, PLCL2, RGMA, DHX29, FAM58A, DMRT3, MAB21L1, C19orf59, TGFBRAP1, DEPDC6, CARM1, WDR45L, MDH1B, etc. Among the predicted targets, 37 (3.35%) were cancer genes, including AKAP9, BCL11A, C16orf75, CAGE1, CARD11, CSF3R, EIF4A2, EXT2, FANCE, FAS, FGFR2, FOS, FOXP1, FVT1, HOOK3, IDH1, IL2, LMO1, MLF1, MRAS, MYBL1, PALB2, PHOX2B, RAB38, RALA, RASGRP4, RASIP1, RASSF1, RASSF6, SSX1, SSX2, STAG2, TAF15, TSG101, TUSC3, WIF1, and ZNF521 (Table 3 and Table S11).

These results showed that the number of predicted targets of hsa-miR-181a-5p by the eight algorithms was very different, ranging from 108 to 7,847, with a mean of 2,424. Most of the predicted targets are involved in the regulation of cell proliferation, cell division, cell apoptosis, energy metabolism, amino acid, and nucleic acid metabolism, and transport, inflammation, redox homeostasis, and stress response. Many of the predicted targets are cancer genes, which participate in cancer initiation, development, growth, and metastasis. These cancer genes, including tumor suppressor genes and oncogenes, act as drivers or passengers in tumorigenesis. They are involved in various aspects of functions implicated in cancer initiation, development, and metastasis, including control of cell proliferation, apoptosis, signal transduction, transcription regulation, immunity, and defense.

Predicted targets of hsa-miR-181a-3p

Using DIANA microT v3.0, hsa-miR-181a-3p was predicted to regulate 249 transcripts/targets when the threshold was set at 0.45 (Table 4 and Table S12). These included ETV1, GGCT, ODZ1, NUB1, CPS1, AGPAT4, TRIO, LMO3, COL9A2, ELN, HEBP2, CYFIP2, MCOLN3, RC3H2, FLYWCH1, COL11A1, MRPS35, DGKA, LAPTM4A, IFT80, CLEC2D, AFF4, MARK2, SENP1, STX7, PDS5B, NKAIN1, PSMC5, SLC26A4, etc. Among these targets, 15 were cancer genes (6.12%), including ASPSCR1, BCL11A, CACNA1D, CCND2, ELN, ETV1, EZH2, GATA3, HIP1, HRAS, MSI2, PIM1, TSHR, USP6, and WIF1 (Table 4 and Table S12).

Table 4.

Predicted targets of hsa-miR-181a-3p by various predicting tools

Tool Website (URL) Number of predicted transcripts Examples of predicted targets Cancer genes
DIANA microT v5.0 http://diana.cslab.ece.ntua.gr/microT/ 249 (threshold set at 0.45) ETV1, GGCT, ODZ1, NUB1, CPS1, AGPAT4, TRIO, LMO3, COL9A2, ELN, HEBP2, CYFIP2, MCOLN3, RC3H2, FLYWCH1, COL11A1, MRPS35, DGKA, LAPTM4A, IFT80, CLEC2D, AFF4, MARK2, SENP1, STX7, PDS5B, NKAIN1, PSMC5, SLC26A4, etc ASPSCR1, BCL11A, CACNA1D, CCND2, ELN, ETV1, EZH2, GATA3, HIP1, HRAS, MSI2, PIM1, TSHR, USP6, and WIF1
miRanda- mirSVR http://www.microrna.org/ 1,873 PMS2L2, COL27A1, SAE1, CNTNAP3B, FAM153B, GRIP2, NR4A1, RXRA, AES, POM121C, AFG3L1, XDH, XPA, MID1, AIRE, CTSK, HSD17B1, LOR, LTBP2, NEU1, AMPD3, AMT, APP, FUT2, etc ABI2, ATM, AXIN1, BCL11A, BCL2, BTG1, CACNA1D, CASP8, CDH1, CDK12, CEBPA, CHCHD7, CREB1, CRTC3, DDB2, DDX10, DNM2, DUX4, EBF1, EIF4A2, ELL, ETV6, EZH2, FOXP1, GAS7, GATA3, GNA11, GNAS, HIP1, LMO1, LPP, MALAT1, MAX, MKL1, MLL3, MLLT1, MN1, MSI2, NF1, PAFAH1B2, PAX5, PAX7, PDE4DIP, PER1, PIM1, PML, PTEN, RANBP17, RPL10, SEPT6, SET, SETBP1, SMARCE1, SS18L1, TAL1, TBL1XR1, TCL6, TET2, TP53, TSHR, and TTL
miRDB http://mirdb.org/miRDB/ 22 ALDH18A1, ATP13A4, ALDH6A1, C16orf57, NIPA2, RIBC1, SLC20A2, C14orf28, CFL2, ZNF3, RHOBTB1, H1F0, AP1S3, ARL4A, RBM22, MIER1, ACTR3, CLEC2D, AFF2, ACAP2, RABGEF1, and KCTD12 None
RNA22 v2 https://cm.jefferson.edu/rna22v2.0/ 5,142 (2,718 genes) CFH, TTC22, FMO1, ATP1A2, VPS13D, COL9A2, UTS2, LAMC2, PIGV, PTPRU, COL11A1, DDX20, WDR3, YBX1, ASPM, LRRC40, EPHA8, ARHGEF10L, RASAL2, PLXNA2, RAP1GAP, PPP1R12B, SDF4, TP73, NKAIN1, WDR47, OVGP1, SLC25A24, EPS15, POMGNT1, etc ABL1, ABL2, AKAP9, AKT1, AKT2, ALDH2, ARID1A, ARID2, ASXL1, ATP1A1, AXIN1, BCL6, BCL7A, BCR, BRD3, CCNB1IP1, CCND2, CDK6, CHEK2, CREB1, CTNNB1, CYLD, DDB2, DNMT3A, ELK4, EPS15, FANCA, FANCC, FGFR2, FOXP1, FUS, GNAS, HIP1, HLF, HMGA2, HOXD11, IL7R, KCNJ5, KDR, KLF4, KTN1, LASP1, MAML2, MDM4, MED12, MET, MKL1, MLL3, MUTYH, MYB, MYH11, NACA, NCOA2, NFIB, NOTCH2, NSD1, NTRK3, PAX8, PBRM1, PDGFRB, POT1, POU2AF1, REL, RNF43, RPL10, RUNDC2A, RUNX1, SETBP1, SF3B1, SMARCA4, STAT3, SUFU, TAF15, TCEA1, TCF3, TFEB, TSC1, UBR5, USP6, VHL, WHSC1L1, and YWHAE
TargetMiner http://www.isical.ac.in/~bioinfo_miu/targetminer20.htm 13 CD47, CELF2, CPNE3, FECH, FGF5, IKZF2, MIER1, NLGN1, NR2C2, RBM12B, SMAD2, SRSF8, and TLR4 None
TargetScan 6.2 http://www.targetscan.org/ See Table 3
PicTar http://pictar.mdc-berlin.de/ See Table 3
MicroCosm Targets v5 http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/ 1,039 JAG2, Q6ZWB7, PCDH11Y, KLF1, MAN1B1, TMED5, ONECUT1, OCIAD1, FAM84B, WDR69, ARFIP1, LRRC45, SLC1A7, ATP8A2, SPACA5, TTN, IER3, PPIL1, C12orf45, IL27, KRT33B, HYI, TSPAN32, TCHP, KDELR2, FOXA3, CPXM2, etc AKT2, ALDH2, BCL2A1, BCL7C, CARS, CDK4, DAXX, DDB2, DLEU7, ERCC5, FUBP1, FUS, H3F3A, HOXA9, IRF4, JAK1, LCK, LMO1, MKL1, MSI2, NFIB, PAX3, RAC2, RAF1, RASIP1, SETBP1, SSX2, USP6, and WHSC1L1

miRanda-mirSVR predicted that hsa-miR-181-a-3p could regulate 1,873 targets (Table 4 and Table S13). These genes included PMS2L2, COL27A1, SAE1, CNTNAP3B, FAM153B, GRIP2, NR4A1, RXRA, AES, POM121C, AFG3L1, XDH, XPA, MID1, AIRE, CTSK, HSD17B1, LOR, LTBP2, NEU1, AMPD3, AMT, APP, FUT2, etc. Most of these genes regulate a number of important cellular processes, such as cell proliferation, cell death, division, mitosis, metabolism of glucose, lipids, nuclear acids, and amino acids, and transport. Among the predicted targets, 61 were cancer genes (3.26%). These included ABI2, ATM, AXIN1, BCL11A, BCL2, BTG1, CACNA1D, CASP8, CDH1, CDK12, CEBPA, CHCHD7, CREB1, CRTC3, DDB2, DDX10, DNM2, DUX4, EBF1, EIF4A2, ELL, ETV6, EZH2, FOXP1, GAS7, GATA3, GNA11, GNAS, HIP1, LMO1, LPP, MALAT1, MAX, MKL1, MLL3, MLLT1, MN1, MSI2, NF1, PAFAH1B2, PAX5, PAX7, PDE4DIP, PER1, PIM1, PML, PTEN, RANBP17, RPL10, SEPT6, SET, SETBP1, SMARCE1, SS18L1, TAL1, TBL1XR1, TCL6, TET2, TP53, TSHR, and TTL (Table 4 and Table S14).

miRDB predicted that 22 targets were possibly regulated by hsa-miR-181a-3p (Table 4 and Table S15). These included ALDH18A1, ATP13A4, ALDH6A1, C16orf57, NIPA2, RIBC1, SLC20A2, C14orf28, CFL2, ZNF3, RHOBTB1, H1F0, AP1S3, ARL4A, RBM22, MIER1, ACTR3, CLEC2D, AFF2, ACAP2, RABGEF1, and KCTD12. These targets play a role in the regulation of cell proliferation, cell cycle, apoptosis, energy, nuclear acid, and protein metabolism, signaling transduction, and transport. However, none of the predicted targets were cancer genes.

Using RNA22 v2, 5,142 transcripts/2,718 genes were predicted to be regulated by hsa-miR-181a-3p (Table 4 and Table S16). These included CFH, TTC22, FMO1, ATP1A2, VPS13D, COL9A2, UTS2, LAMC2, PIGV, PTPRU, COL11A1, DDX20, WDR3, YBX1, ASPM, LRRC40, EPHA8, ARHGEF10L, RASAL2, PLXNA2, RAP1GAP, PPP1R12B, SDF4, TP73, NKAIN1, WDR47, OVGP1, SLC25A24, EPS15, POMGNT1, etc. Many of the predicted targets play a role in the regulation of cell proliferation, cell cycle, apoptosis, energy, nuclear acid, and protein metabolism, signaling transduction, and transport. Among these targets, 82 were cancer genes (3.02%), including ABL1, ABL2, AKAP9, AKT1, AKT2, ALDH2, ARID1A, ARID2, ASXL1, ATP1A1, AXIN1, BCL6, BCL7A, BCR, BRD3, CCNB1IP1, CCND2, CDK6, CHEK2, CREB1, CTNNB1, CYLD, DDB2, DNMT3A, ELK4, EPS15, FANCA, FANCC, FGFR2, FOXP1, FUS, GNAS, HIP1, HLF, HMGA2, HOXD11, IL7R, KCNJ5, KDR, KLF4, KTN1, LASP1, MAML2, MDM4, MED12, MET, MKL1, MLL3, MUTYH, MYB, MYH11, NACA, NCOA2, NFIB, NOTCH2, NSD1, NTRK3, PAX8, PBRM1, PDGFRB, POT1, POU2AF1, REL, RNF43, RPL10, RUNDC2A, RUNX1, SETBP1, SF3B1, SMARCA4, STAT3, SUFU, TAF15, TCEA1, TCF3, TFEB, TSC1, UBR5, USP6, VHL, WHSC1L1, and YWHAE (Table 4 and Table S16).

TargetMiner predicted that 13 targets were regulated by hsa-miR-181a-3p, including CD47, CELF2, CPNE3, FECH, FGF5, IKZF2, MIER1, NLGN1, NR2C2, RBM12B, SMAD2, SRSF8, and TLR4 (Table 4 and Table S17). None of the predicted targets was a cancer gene.

TargetScan 6.2 predicted that hsa-miR-181a could regulate 626 targets (Tables 3 and 4). In PicTar, only hsa-miR-181a could be searched. It probably regulated 510 transcripts with 399 genes (Tables 3 and 4).

MicroCosm Targets v5 predicted that 1,039 targets were likely regulated by hsa-miR-181a-3p (Table 4 and Table S18). These included JAG2, Q6ZWB7, PCDH11Y, KLF1, MAN1B1, TMED5, ONECUT1, OCIAD1, FAM84B, WDR69, ARFIP1, LRRC45, SLC1A7, ATP8A2, SPACA5, TTN, IER3, PPIL1, C12orf45, IL27, KRT33B, HYI, TSPAN32, TCHP, KDELR2, FOXA3, CPXM2, etc. Among the predicted targets, 29 were cancer genes (2.79%), including AKT2, ALDH2, BCL2A1, BCL7C, CARS, CDK4, DAXX, DDB2, DLEU7, ERCC5, FUBP1, FUS, H3F3A, HOXA9, IRF4, JAK1, LCK, LMO1, MKL1, MSI2, NFIB, PAX3, RAC2, RAF1, RASIP1, SETBP1, SSX2, USP6, and WHSC1L1 (Table 4 and Table S18).

These results demonstrated that the number of predicted targets of hsa-miR-181a-3p by the eight tools was very different, ranging from 13 to 5,142, with a mean of 1,184. Most of the predicted targets are involved in the regulation of cell proliferation, cell division, cell apoptosis, energy metabolism, amino acid and nucleic acid metabolism, and transport, inflammation, redox homeostasis, and stress response. Many of the predicted targets are cancer genes which participate in cancer initiation, development, growth, and metastasis.

Predicted targets of hsa-miR-181a by miRWALK

miRWALK provides information on predicted targets from ten algorithms. When only miRWALK was chosen, where only one longest binding site was set per miRNA per mRNA, 3,762 transcripts were predicted to be regulated by hsa-miR-181a (Table S19). These included AASS, ABCB11, ACN9, ACTA2, ADAM28, BAG2, BCL11A, BCL6B, BTRC, CARD11, CCR3, CDK8, CDKN3, CIT, CNOT1, DAD1, DCN, DKC1, DR1, EHF, ESCO2, FBN2, FUT1, GALNT3, GCS1, GPC5, HK2, HSPB3, IL2, IL25, IVD, KCNG3, KIF2C, LACE1, MAEL, MAOA, MLL5, NCL, NOVA1, OCA2, PAG1, PROCR, RAD21, RFC3, RNF6, SELT, SIX2, TAF15, etc. Among these transcripts, 1,436 were functional genes (Table S20).

miRWALK also provided a summarized table that included all targets predicted to be regulated by hsa-miR-181a by the ten algorithms. In total, there were 17,395 transcripts that would be regulated by hsa-miR-181a (Table S21). Only 24 genes were predicted to be the targets of hsa-miR-181a by all the algorithms or at least nine algorithms. These included RNF145, TCERG1, SIRT1, SS18L1, NR6A1, FOXP1, GLS, HOXA11, SMAD7, MAP1B, INOC1, CDKN2AIP, LRRN1, TGFBI, YWHAG, C17orf39, CHD9, NAT13, C6orf62, ACVR2A, DCLK1, NMT2, NPEPPS, and KIAA0195. There were 102 targets that were predicted to be regulated by hsa-miR-181a by eight algorithms, including CDH13, PDIA6, IPO8, IGF2BP2, SLITRK1, SSX2IP, COL16A1, ADM, ZNF800, ADAMTS18, DPYSL2, E2F5, EIF4A2, EN2, ETV6, ACSL1, FBN2, C7orf41, FKBP1A, BTBD3, KIAA0423, HIC2, KANK1, HISPPD1, SYNE1, ZNF281, FOS, LEMD3, BRD1, OSBPL3, EPC2, GAPVD1, GATA6, NPTN, ATP11C, KLF15, LRP12, BAZ2B, HLF, HOXA1, ID4, JARID2, KPNA1, etc. There were 191, 778, 1,615, and 3,168 targets that were predicted to be regulated by hsa-miR-181a by seven, six, five, and four algorithms, respectively.

Validated targets of hsa-miR-181a-5p based on TarBase

Based on TarBase, 211 targets of hsa-miR-181a-5p have been validated with experimental evidence (Table 5). These included ACOT12, ALG10B, AMMECR1, ANKRD1, ANKRD13C, ARF6, ARHGAP11A, ARL6IP1, ARL6IP6, ATF7IP2, ATG10, ATM, ATP6V0E1, BAG2, BCL2, BDNF, BPGM, BRIX1, BRMS1L, BTBD3, C1orf109, C1orf43, C1QTNF9, C8A, CBX3, CCDC6, CCDC82, CCND1, CCNG1, etc. Among these validated targets, only eleven of them are cancer genes (5.21%), including ATM, BCL2, CCDC6, CCND1, CDX2, EP300, HOXA11, KRAS, PLAG1, TAF15, and TSHR.

Table 5.

Targets of hsa-miR-181a-5p with experimental evidence based on TarBase 6.0

Gene symbol Accession number Full name Alias Function Cancer gene
ACOT12 NM_130767 Acyl-CoA thioesterase 12 CACH-1, Cach, STARD15, THEAL Hydrolyzes acetyl-CoA to acetate and CoA
ALG10B NM_001013620 α-1,2-Glucosyltransferase ALG10, KCR1 Transfers glucose from dolichyl phosphate glucose onto the lipid-linked oligosaccharide Glc(2) Man(9)GlcNAc(2)-PP-Dol
AMMECR1 NM_001025580 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 RP13-360B22.1, AMMERC1
ANKRD1 NM_014391 Ankyrin repeat domain 1 (cardiac muscle) ALRP, C-193, CARP, CVARP, MCARP, bA320F15.2 Plays an important role in endothelial cell activation
ANKRD13C NM_030816 Ankyrin repeat domain 13C RP4-677H15.5, dJ677H15.3
ARF6 NM_001663 ADP-ribosylation factor 6 Involved in protein trafficking
ARHGAP11A NM_001286479 Rho GTPase activating protein 11A RP11-1000B6.5, GAP (1–12) GTPase activator activity
ARL6IP1 NM_015161 ADP-ribosylation factor-like 6 interacting protein 1 AIP1, ARL6IP, ARMER, SPG61 May be involved in protein transport, membrane trafficking, or cell signaling during hematopoietic maturation
ARL6IP6 NM_022989 ADP-ribosylation factor-like 6 interacting protein 6 RP23-265N10.1, 2310057C01Rik, 2610529A11Rik, Aip-6
ATF7IP2 NM_001256160 Activating transcription factor 7 interacting protein 2 MCAF2 Recruiter that couples transcriptional factors to general transcription apparatus and thereby modulates transcription regulation and chromatin formation
ATG10 NM_001131028 Autophagy related 10 PP12616, APG10, APG10L, pp12616 Plays a role in autophagy
ATM NM_000051 ATM serine/threonine kinase AT1, ATA, ATC, ATD, ATDC, ATE, TEL1, TELO1 Serine/threonine protein kinase Yes
ATP6V0E1 NM_003945 ATPase, H+ transporting, lysosomal 9 kDa, V0 subunit e1 ATP6H, ATP6V0E, M9.2, Vma21, Vma21p Vacuolar ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells
BAG2 NM_004282 BCL2-associated athanogene 2 RP3-496N17.2, BAG-2, dJ417I1.2 Inhibits the chaperone activity of HSP70/HSC70 by promoting substrate release
BCL2 NM_000633 B-cell CLL/lymphoma 2 Bcl-2, PPP1R50 Suppresses apoptosis Yes
BDNF NM_001143805 Brain-derived neurotrophic factor ANON2, BULN2 Promotes the survival of neuronal populations
BPGM NM_001293085 2,3-Bisphosphoglycerate mutase DPGM Plays a major role in regulating hemoglobin oxygen affinity
BRIX1 NM_018321 Biogenesis of ribosomes, homolog (S. cerevisiae) BRIX, BXDC2 Required for biogenesis of the 60S ribosomal subunit
BRMS1L NM_032352 Breast cancer metastasis-suppressor 1-like BRMS1 Involved in the HDAC1-dependent transcriptional repression activity
BTBD3 NM_001282550 BTB (POZ) domain containing 3 RP4-742J24.3, dJ742J24.1 Acts as a key regulator of dendritic field orientation during development of sensory cortex
C1orf109 NM_017850 Chromosome 1 open reading frame 109
C1orf43 NM_001098616 Chromosome 1 open reading frame 43 HSPC012, NICE-3, NS5ATP4, S863-3
C1QTNF9 NM_183175 C1q and tumor necrosis factor related protein 9 9130217G22Rik, CTRP9, Ciqtnf9 Activates AMPK, AKT, and p44/42 MAPK signaling pathways
C8A NM_000562 Complement component 8, α polypeptide C8 is a constituent of the membrane attack complex
CBX3 NM_007276 Chromobox homolog 3 HECH, HP1-GAMMA, HP1Hs-γ Involved in transcriptional silencing in heterochromatin-like complexes
CCDC6 NM_005436 Coiled-coil domain containing 6 D10S170, H4, PTC, TPC, TST1 Functions as a tumor suppressor Yes
CCDC82 NM_024725 Coiled-coil domain containing 82 HT025, HSPC048
CCND1 NM_053056 Cyclin D1 BCL1, D11S287E, PRAD1, U21B31 Essential for the control of the cell cycle at the G1/S (start) transition Yes
CCNG1 NM_004060 Cyclin G1 CCNG May play a role in growth regulation
CD46 NM_002389 CD46 molecule, complement regulatory protein AHUS2, MCP, MIC10, TLX, TRA2.10 Acts as a cofactor for complement factor I
CDKN1B NM_004064 Cyclin-dependent kinase inhibitor 1B (p27, Kip1) CDKN4, KIP1, MEN1B, MEN4, P27KIP1 Important regulator of cell cycle progression
CDX2 NM_001265 Caudal type homeobox 2 CDX-3, CDX3 Involved in the transcriptional regulation of multiple genes expressed in the intestinal epithelium Yes
CEP97 NM_024548 Centrosomal protein 97 kDa 2810403B08Rik, LRRIQ2 Collaborates with cep110, being involved in the suppression of a cilia assembly program
CFI NM_000204 Complement factor I AHUS3, ARMD13, C3BINA, C3b-INA, FI, IF, KAF Responsible for cleaving the α-chains of C4b and C3b in the presence of the cofactors C4-binding protein and factor H, respectively
CHD1 NM_001270 Chromodomain helicase DNA binding protein 1 Sequence-selective DNA-binding protein
CHL1 NM_001253387 Cell adhesion molecule L1-like CALL, L1CAM2 Plays a role in nervous system development and in synaptic plasticity
CHRFAM7A NM_139320 CHRNA7 (cholinergic receptor, nicotinic, α 7, exons 5–10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion CHRNA7, CHRNA7-DR1, D-10 Extracellular ligand-gated ion channel activity
CLUAP1 NM_015041 Clusterin associated protein 1 CFAP22, FAP22 May play a role in cell proliferation or apoptosis
COL27A1 NM_032888 Collagen, type XXVII, α 1 RP11-82I1.1 Plays a role during the calcification of cartilage and the transition of cartilage to bone
COPS2 NM_001143887 COP9 signalosome subunit 2 ALIEN, CSN2, SGN2, TRIP15 Involved in various cellular and developmental processes
CST5 NM_001900 Cystatin D Cysteine proteinase inhibitor
CXorf1 NM_004709 Transmembrane protein 257 CXorf1
D3R NM_000796.5 DRD3 D3DR; ETM1; FET1 Associated with cognitive, emotional, and endocrine functions
DCP2 NM_001242377 Decapping mRNA 2 NUDT20 Necessary for the degradation of mRNAs
DCST1 NM_001143687 DC-STAMP domain containing 1 RP11-307C12.10-003 Protein and zinc ion binding
DDIT4 NM_019058 DNA-damage-inducible transcript 4 RP11-442H21.1, Dig2, REDD-1, REDD1 Inhibits cell growth by regulating the frap1 pathway upstream of the tsc1-tsc2 complex and downstream of Akt1
DNAJC7 NM_001144766 DnaJ (HSP40) homolog, subfamily C, member 7 DJ11, DJC7, TPR2, TTC2 Acts as co-chaperone regulating the molecular chaperones HSP70 and HSP90 in folding of steroid receptors
DSCR8 NM_032589 Down syndrome critical region gene 8 C21orf65, CT25.1a, CT25.1b, MMA-1, MMA-1a, MMA-1b, MMA1, MTAG2
EIF1 NM_005801 Eukaryotic translation initiation factor 1 A121, EIF-1A, ISO1, SUI1, EIF1 Necessary for scanning and involved in initiation site selection
EIF2C1 NM_012199 Argonaute RISC catalytic component 1 RP4-789D17.1, EIF2C, AGO1, GERP95, Q99 Required for RNA-mediated gene silencing
EIF2C3 NM_024852 Argonaute RISC catalytic component 3 AGO3 Required for RNA-mediated gene silencing
ELAVL1 NM_001419 ELAV like RNA binding protein 1 ELAV1, HUR, Hua, MelG Binds avidly to the AU-rich element in FOS and IL3/interleukin-3 mRNAs
ENAH NM_001008493 Enabled homolog RP11-496N12.7, ENA, MENA, NDPP1 Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity
EP300 NM_001429 E1A binding protein p300 RP1-85F18.1, KAT3B, RSTS2, p300 Functions as HAT and regulates transcription via chromatin remodeling Yes
EPHA5 NM_001281765 EPH receptor A5 CEK7, EHK-1, EHK1, EK7, HEK7, TYRO4 Receptor for members of the ephrin-A family
ESR1 NM_000125 Estrogen receptor 1 RP1-130E4.1, ER, ESR, ESRA, ESTRR, Era, NR3A1 Nuclear hormone receptor
EYA4 NM_001301012 EYA transcriptional coactivator and phosphatase 4 RP11-704J17.4, CMD1J, DFNA10 Tyrosine phosphatase that specifically dephosphorylates “Tyr-142” of histone H2AX (H2AXY142ph)
FAM47B NM_152631 Family with sequence similarity 47, member B RP13-520K9.1
FBXO34 NM_017943 F-box protein 34 CGI-301, Fbx34 Substrate-recognition component of the SCF E3 ubiquitin ligase complex
FKBP10 NM_021939 FK506 binding protein 10 PSEC0056, FKBP65, OI11, OI6, PPIASE, hFKBP65 PPIases accelerate the folding of proteins during protein synthesis
FKBP4 NM_002014 FK506 binding protein 4 FKBP51, FKBP52, FKBP59, HBI, Hsp56, PPIase, p52 May play a role in the intracellular trafficking of heterooligomeric forms of steroid hormone receptors
FKBP7 NM_001135212 FK506 binding protein 7 UNQ670/PRO1304, FKBP23, PPIase PPIases accelerate the folding of proteins during protein synthesis
FRA10AC1 NM_145246 Fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1 PRO2972, C10orf4, F26C11.1-like, FRA10A
FSIP1 NM_152597 Fibrous sheath interacting protein 1 HSD10
FXYD6 NM_001164831 FXYD domain containing ion transport regulator 6 UNQ521/PRO1056
GADD45G NM_006705 Growth arrest and DNA-damage-inducible, γ RP11-260L6.1, CR6, DDIT2, GADD45γ, GRP17 Involved in the regulation of growth and apoptosis
GATA6 NM_005257 GATA binding protein 6 Regulates terminal differentiation and/or proliferation
GCNT1 NM_001097633 Glucosaminyl (N-acetyl) transferase 1, core 2 RP11-214N16.1, C2GNT, C2GNT-L, C2GNT1, G6NT, NACGT2, NAGCT2 Forms critical branches in O-glycans
GNA13 NM_001282425 G protein, α 13 G13 Modulators or transducers in various transmembrane signaling systems
GNB1 NM_001282538 G protein, β polypeptide 1 RP1-283E3.7 A modulator or transducer in various transmembrane signaling systems
GPR137B NM_003272 G protein-coupled receptor 137B RP5-985L19.1, TM7SF1
GPR83 NM_016540 G protein-coupled receptor 83 GIR, GPR72 Orphan receptor. Could be a neuropeptide y receptor
GSTM2 NM_000848 Glutathione S-transferase mu 2 (muscle) GST4, GSTM-2, GTHMUS, GSTM2 Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles
H1F0 NM_005318 H1 histone family, member 0 H10, H1FV Histones H1 are necessary for the condensation of nucleosome chains into higher order structures
HERC3 NM_001271602 HECT and RLD domain containing E3 ubiquitin protein ligase 3 E3 ubiquitin-protein ligase
HEY2 NM_012259 Hes-related family bHLH transcription factor with YRPW motif 2 RP1-293L8.3, CHF1, GRIDLOCK, GRL, HERP1, HESR2, HRT2, bHLHb32 Downstream effector of Notch signaling which may be required for cardiovascular development
HIPK2 NM_001113239 Homeodomain interacting protein kinase 2 PRO0593 Protein kinase acting as a corepressor of several transcription factors unwinds double-stranded DNA
HMGB2 NM_001130688 High mobility group box 2 HMG2 Binds preferentially ssDNA and
HNRPDL NM_001207000 Heterogeneous nuclear ribonucleoprotein D-like HNRNP, HNRPDL, JKTBP, JKTBP2, laAUF1 Acts as a transcriptional regulator
HOXA10 NM_018951 Homeobox A10 HOX1, HOX1.8, HOX1H, PL Sequence-specific transcription factor
HOXA11 NM_005523 Homeobox A11 HOX1, HOX1I Sequence-specific transcription factor Yes
HSD17B3 NM_000197 Hydroxysteroid (17-β) dehydrogenase 3 RP11-240L7.3, EDH17B3, SDR12C2 Favors the reduction of androstenedione to testosterone
HSP90B1 NM_003299 Heat-shock protein 90 kDa β (Grp94), member 1 ECGP, GP96, GRP94, HEL-S-125m, HEL35, TRA1 Molecular chaperone that functions in the processing and transport of secreted proteins
HSPA1B NM_005346 Heat-shock 70 kDa protein 1B DAAP-21F2.7, HSP70-1B, HSP70-2 Stabilizes preexistent proteins against aggregation and mediates the folding of newly translated polypeptides in the cytosol as well as within organelles
ICMT NM_012405 Isoprenylcysteine carboxyl methyltransferase RP1-120G22.4, HSTE14, MST098, MSTP098, PCCMT, PCMT, PPMT Catalyzes the posttranslational methylation of isoprenylated C-terminal cysteine residues
IDS NM_000202 Iduronate 2-sulfatase MPS2, SIDS Required for the lysosomal degradation of heparan sulfate and dermatan sulfate
INCENP NM_001040694 Inner centromere protein antigens Component of the chromosomal passenger complex, a complex that acts as a key regulator of mitosis
IQCG NM_001134435 IQ motif containing G CFAP122, DRC9
KAT2B NM_003884 K(lysine) acetyltransferase 2B CAF, P/CAF, PCAF Functions as a HAT to promote transcriptional activation
KBTBD3 NM_152433 Kelch repeat and BTB (POZ) domain containing 3 BKLHD3
KBTBD7 NM_032138 Kelch repeat and BTB (POZ) domain containing 7
KCTD3 NM_016121 Potassium channel tetramerization domain containing 3 RP11-5F19.1, NY-REN-45
KIAA0101 NM_001029989 KIAA0101 L5, NS5ATP9, OEATC, OEATC-1, OEATC1, PAF, PAF15, p15(PAF), p15/PAF, p15PAF May be involved in protection of cells from UV-induced cell death
KIAA2026 NM_001017969 KIAA2026
KLHL15 NM_030624 Kelch-like family member 15 HEL-S-305 Probable substrate-specific adapter of an E3 ubiquitin-protein ligase complex which mediates the ubiq uitination and subsequent proteasomal degradation of target proteins
KLRC4 NM_013431 Killer cell lectin-like receptor subfamily C, member 4 NKG2-F, NKG2F May play a role as a receptor for the recognition of MHC class I HLA-E molecules by NK cells
KRAS NM_004985 Kirsten rat sarcoma viral oncogene homolog C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS1, KRAS2, NS, NS3, RASK2, KRAS Binds GDP/GTP and possesses intrinsic GTPase activity Yes
LFNG NM_001040167 LFNG O-fucosylpeptide 3-β-N-acetylglucosaminyltransferase SCDO3 Glycosyltransferase
LPGAT1 NM_014873 Lysophosphatidylglycerol acyltransferase 1 FAM34A, FAM34A1, NET8 Lysophoshatidylglycerol-specific acyltransferase
LRRC17 NM_001031692 Leucine rich repeat containing 17 UNQ3076/PRO9909, P37NB Involved in bone homeostasis, acting as a negative regulator of RANKL-induced osteoclast precursor differentiation from bone marrow precursors
LRRN3 NM_001099658 Leucine rich repeat neuronal 3 Nbla10363, FIGLER5, NLRR-3, NLRR3
LYSMD3 NM_001286812 LysM, putative peptidoglycan-binding, domain containing 3
MAP1B NM_005909 Microtubule-associated protein 1B FUTSCH, MAP5, PPP1R102 May play a role in the cytoskeletal changes that accompany neurite extension
METAP1 NM_015143 Methionyl aminopeptidase 1 MAP1A, MetAP1A Removes the amino-terminal methionine from nascent proteins
MFAP3 NM_001135037 Microfibrillar-associated protein 3 Component of the elastin-associated microfibrils
MIF NM_002415 Macrophage migration inhibitory factor (glycosylation-inhibiting factor) GIF, GLIF, MMIF The expression of MIF at sites of inflammation suggests a role for the mediator in regulating the function of macrophage in host defense. Also acts as a phenylpyruvate tautomerase
MOB3B NM_024761 MOB kinase activator 3B C9orf35, MOB1D, MOBKL2B May regulate the activity of kinases
MRPS14 NM_022100 Mitochondrial ribosomal protein S14 DJ262D12.2, HSMRPS14, MRP-S14, S14mt
MTMR12 NM_001040446 Myotubularin-related protein 12 3-PAP, PIP3AP Inactive phosphatase that plays a role as an adapter for the phosphatase myotubularin to regulate myotubularin intracellular location
MTRR NM_002454 5-Methyltetrahydrofolate-homocysteine methyltransferase reductase MSR, cblE Involved in the reductive regeneration of cob(I)alamin cofactor required for the maintenance of methionine synthase in a functional state
MYO9A NM_006901 Myosin IXA Myosins are actin-based motor molecules with ATPase activity Unconventional myosins serve in intracellular movements
NCAPG NM_022346 Non-SMC condensin I complex, subunit G CAPG, CHCG, NY-MEL-3, YCG1 Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes
NKX3-2 NM_001189 NK3 homeobox 2 BAPX1, NKX3.2, NKX3B, SMMD Transcriptional repressor that acts as a negative regulator of chondrocyte maturation
NLK NM_016231 Nemo-like kinase Role in cell fate determination, required for differentiation of bone marrow stromal cells
NMRK2 NM_001289117 Nicotinamide riboside kinase 2 ITGB1BP3, MIBP, NRK2
NOL4 NM_001198546 Nucleolar protein 4 HRIHFB2255, CT125, NOLP
NUDT12 NM_001300741 Nudix-type motif 12 Hydrolyzes NAD(P)H to NMNH and AMP (2′,5′-ADP), and diadenosine diphosphate to AMP
OAZ1 NM_001301020 Ornithine decarboxylase antizyme 1 AZI, OAZ Binds to and destabilizes ornithine decarboxylase, which is then degraded. Also inhibits cellular uptake of polyamines by inactivating the polyamine uptake transporter
OFCC1 NM_153003 Orofacial cleft 1 candidate 1 MRDS1
OR11A1 NM_013937 Olfactory receptor, family 11, subfamily A, member 1 DAAP-34I1.2, 6M1-18, OR11A2, dJ994E9.6, hs6M1-18 Odorant receptor
OTUD1 NM_001145373 OTU deubiquitinase 1 DUBA7, OTDC1 Deubiquitinating enzyme that specifically hydrolyzes ‘Lys-63′-linked polyubiquitin to monoubiquitin
OTX2 NM_001270523 Orthodenticle homeobox 2 CPHD6, MCOPS5 Probably plays a role in the development of the brain and the sense organs
PCAF NM_003884 K(lysine) acetyltransferase 2B CAF, P/CAF, PCAF Functions as a component of the PCAF complex
PCDHB8 NM_019120 Protocadherin β 8 PCDH-β8, PCDH3I Potential calcium-dependent cell-adhesion protein
PHOX2A NM_005169 Paired-like homeobox 2a ARIX, CFEOM2, FEOM2, NCAM2, PMX2A May be involved in regulating the specificity of expression of the catecholamine biosynthetic genes
PIM3 NM_001001852 Pim-3 proto-oncogene, serine/threonine kinase CITF22-49E9.1, pim-3 May be involved in cell cycle progression and antiapoptotic process
PLA2G4C NM_001159322 Phospholipase A2, group IVC (cytosolic, calcium-independent) CPLA2-γ Has a preference for arachidonic acid at the sn-2 position of phosphatidylcholine as compared with palmitic acid
MTRR NM_002454 5-Methyltetrahydrofolate-homocysteine methyltransferase reductase MSR, cblE Involved in the reductive regeneration of cob(I)alamin cofactor required for the maintenance of methionine synthase in a functional state
MYO9A NM_006901 Myosin IXA Myosins are actin-based motor molecules with ATPase activity Unconventional myosins serve in intracellular movements
NCAPG NM_022346 Non-SMC condensin I complex, subunit G CAPG, CHCG, NY-MEL-3, YCG1 Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes
NKX3-2 NM_001189 NK3 homeobox 2 BAPX1, NKX3.2, NKX3B, SMMD Transcriptional repressor that acts as a negative regulator of chondrocyte maturation
NLK NM_016231 Nemo-like kinase Role in cell fate determination, required for differentiation of bone marrow stromal cells
NMRK2 NM_001289117 Nicotinamide riboside kinase 2 ITGB1BP3, MIBP, NRK2
NOL4 NM_001198546 Nucleolar protein 4 HRIHFB2255, CT125, NOLP
NUDT12 NM_001300741 Nudix-type motif 12 Hydrolyzes NAD(P)H to NMNH and AMP (2′,5′-ADP), and diadenosine diphosphate to AMP
OAZ1 NM_001301020 Ornithine decarboxylase antizyme 1 AZI, OAZ Binds to and destabilizes ornithine decarboxylase, which is then degraded. Also inhibits cellular uptake of polyamines by inactivating the polyamine uptake transporter
OFCC1 NM_153003 Orofacial cleft 1 candidate 1 MRDS1
OR11A1 NM_013937 Olfactory receptor, family 11, subfamily A, member 1 DAAP-34I1.2, 6M1-18, OR11A2, dJ994E9.6, hs6M1-18 Odorant receptor
OTUD1 NM_001145373 OTU deubiquitinase 1 DUBA7, OTDC1 Deubiquitinating enzyme that specifically hydrolyzes ‘Lys-63′-linked polyubiquitin to monoubiquitin
OTX2 NM_001270523 Orthodenticle homeobox 2 CPHD6, MCOPS5 Probably plays a role in the development of the brain and the sense organs
PCAF NM_003884 K(lysine) acetyltransferase 2B CAF, P/CAF, PCAF Functions as a component of the PCAF complex
PCDHB8 NM_019120 Protocadherin β 8 PCDH-β8, PCDH3I Potential calcium-dependent cell-adhesion protein
PHOX2A NM_005169 Paired-like homeobox 2a ARIX, CFEOM2, FEOM2, NCAM2, PMX2A May be involved in regulating the specificity of expression of the catecholamine biosynthetic genes
PIM3 NM_001001852 Pim-3 proto-oncogene, serine/threonine kinase CITF22-49E9.1, pim-3 May be involved in cell cycle progression and antiapoptotic process
PLA2G4C NM_001159322 Phospholipase A2, group IVC (cytosolic, calcium-independent) CPLA2-γ Has a preference for arachidonic acid at the sn-2 position of phosphatidylcholine as compared with palmitic acid
PLAG1 NM_001114634 Pleiomorphic adenoma gene 1 PSA, SGPA, ZNF912 Transcription factor whose activation results in upregulation of target genes, such as IGFII, leading to uncontrolled cell proliferation Yes
PLCL2 NM_001144382 Phospholipase C-like 2 PLCE2 May play a role in the regulation of Ins(1,4,5)P3 around the endoplasmic reticulum
PLXDC2 NM_001282736 Plexin domain containing 2 UNQ2514/PRO6003, TEM7R May play a role in tumor angiogenesis
PNPT1 NM_033109 Polyribonucleotide nucleotidyltransferase 1 COXPD13, DFNB70, OLD35, PNPASE, old-35 Involved in mRNA degradation
POLR2B NM_000938 Polymerase (RNA) II (DNA directed) polypeptide B POL2RB, RPB2, hRPB140, hsRPB2 DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucle oside triphosphates as substrates
PPA1 NM_021129 Pyrophosphatase (inorganic) 1 RP11-367H5.1, HEL-S-66p, IOPPP, PP, PP1, SID6-8061
PPM1A NM_021003 Protein phosphatase, Mg2+/Mn2+ dependent, 1A PP2C-ALPHA, PP2CA, PP2Cα Enzyme with a broad specificity
PPP2CA NM_002715 Protein phosphatase 2, catalytic subunit, α isozyme PP2Ac, PP2CA, PP2Cα, RP-C PP2A can modulate the activity of phosphorylase B kinase casein kinase 2, mitogen-stimulated S6 kinase, and MAP-2 kinase
PPP2R5C NM_001161725 Protein phosphatase 2, regulatory subunit B′, γ B56G, PR61G The B regulatory subunit might modu late substrate selectivity and catalytic activity, and also might direct the localization of the catalytic enzyme to a particular subcellular compartment
PRDX3 NM_006793 Peroxiredoxin 3 AOP-1, AOP1, HBC189, MER5, PRO1748, SP-22, prx-III Involved in redox regulation of the cell
PRLR NM_000949 Prolactin receptor HPRL, MFAB, hPRLrI This is a receptor for the anterior pituitary hormone prolactin
PROSC NM_007198 Proline synthetase co-transcribed homolog (bacterial)
PROX1 NM_001270616 Prospero homeobox 1 May play a fundamental role in early development of central nervous system
PRR4 NM_001098538 Proline rich 4 (lacrimal) LPRP, PROL4
PTGS2 NM_000963 Prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) COX-2, COX2, GRIPGHS, PGG/HS, PGHS-2, PHS-2, hCox-2 May have a role as a major mediator of inflammation and/or a role for prostanoid signaling in activity-dependent plasticity
PTPLAD1 NM_016395 Protein tyrosine phosphatase-like A domain containing 1 B-IND1, HACD3, HSPC121 Involved in Rac1-signaling pathways leading to the modulation of gene expression
PTPRZ1 NM_001206838 Protein tyrosine phosphatase, receptor-type, Z polypeptide 1 HPTPZ, HPTPζ, PTP-ζ, PTP18, PTPRZ, PTPZ, R-PTP-ζ-2, RPTPB, RPTPβ, phosphacan May be involved in the regulation of specific developmental processes in the central nervous system
RAB8B NM_016530 RAB8B, member RAS oncogene family May be involved in vesicular trafficking and neurotransmitter release
RASSF6 NM_001270391 Ras association (RalGDS/AF-6) domain family member 6 May act as a Ras effector protein
RBM15 NM_001201545 RNA binding motif protein 15 OTT, OTT1, SPEN May be implicated in HOX gene regulation
RLF NM_012421 Rearranged L-myc fusion RP1-39G22.1, ZN-15L, ZNF292L May be involved in transcriptional regulation
ROPN1L NM_001201466 Rhophilin associated tail protein 1-like RP11-1C1.7, ASP, RSPH11
RPS14 NM_001025070 Ribosomal protein S14 PRO2640, EMTB, S14
RTEL1-TNFRSF6B NR_037882 RTEL1-TNFRSF6B readthrough (NMD candidate)
S100A1 NM_006271 S100 calcium binding protein A1 RP1-178F15.1, S100, S100-α, S100A Weakly binds calcium but binds zinc very tightly-distinct binding sites with different affinities exist for both ions on each monomer
SCAMP2 NM_005697 Secretory carrier membrane protein 2 Functions in post-Golgi recycling pathways. Acts as a recycling carrier to the cell surface
SEPT2 NM_001008491 Septin 2 DIFF6, NEDD-5, NEDD5, Pnutl3, hNedd5 Required for normal progress through mitosis. Involved in cytokinesis
SF3B3 NM_012426 Splicing factor 3b, subunit 3 RSE1, SAP130, SF3b130, STAF13 Subunit of the splicing factor SF3B required for ‘A’ complex assembly formed by the stable binding of U2 snRNP to the branch point sequence in pre-mRNA
SH3BGRL NM_003022 SH3 domain binding glutamate-rich protein like HEL-S-115, SH3BGR
SIX6 NM_007374 SIX homeobox 6 MCOPCT2, OPTX2, Six9 May be involved in eye development
SLC37A3 NM_001287498 Solute carrier family 37, member 3
SLC7A11 NM_014331 Solute carrier family 7 (anionic amino acid transporter light chain, xc-system), member 11 CCBR1, xCT Sodium-independent, high-affinity exchange of anionic amino acids with high specificity for anionic form of cystine and glutamate
SLCO2A1 NM_005630 Solute carrier organic anion transporter family, member 2A1 MATR1, OATP2A1, PGT, PHOAR2, SLC21A2 May mediate the release of newly synthesized prostaglandins from cells, the transepithelial transport of prostaglandins, and the clearance of prostaglandins from the circulation
SMAD5 NM_001001419 SMAD family member 5 DWFC, JV5-1, MADH5 Transcriptional modulator activated by BMP type 1 receptor kinase
SMCHD1 NM_015295 Structural maintenance of chromosomes flexible hinge domain containing 1 Required for maintenance of X inactivation in females and hypermethylation of CpG islands associated with inactive X
SNAI2 NM_003068 Snail family zinc finger 2 SLUG, SLUGH1, SNAIL2, WS2D Transcriptional repressor. Involved in the generation and migration of neural crest cells
SRPK2 NM_001278273 SRSF protein kinase 2 SFRSK2 Phosphorylates RS domain-containing proteins
TAAR6 NM_175067 Trace amine associated receptor 6 RP11-295F4.3, TA4, TAR4, TAR6, TRAR4, taR-4, taR-6 Orphan receptor. Could be a receptor for trace amines
TAF15 NM_003487 TAF15 RNA polymerase II, TBP-associated factor Npl3, RBP56, TAF2N, TAFII68 RNA and ssDNA-binding protein that may play specific roles during transcription initiation at distinct promoters Yes
TAF2 NM_003184 TAF2 RNA polymerase II, TBP-associated factor CIF150, MRT40B, TAFII150, TAF2 Transcription factor TFIID is one of the general factors required for accurate and regulated initiation by RNA polymerase II
TAF6L NM_006473 TAF6-like RNA PCAF-associated factor PAF65A Functions as a component of the PCAF complex
TBX4 NM_018488 T-box 4 SPS Involved in the transcriptional regulation of genes required for mesoderm differentiation
TCF21 NM_003206 Transcription factor 21 POD1, bHLHa23 Involved in epithelial–mesenchymal interactions in kidney and lung morphogenesis that include epithelial differentiation and branching morphogenesis
THUMPD1 NM_017736 THUMP domain containing 1
TM9SF3 NM_020123 Transmembrane 9 superfamily member 3 RP11-34E5.1, EP70-P-iso, SMBP
TMEM14A NM_014051 Transmembrane protein 14A PTD011, C6orf73
TMEM45A NM_018004 Transmembrane protein 45A DERP7
TMPO NM_001032283 Thymopoietin CMD1T, LAP2, LEMD4, PRO0868, TP May help direct the assembly of the nuclear lamina and thereby help maintain the structural organization of the nuclear envelope
TMPRSS11A NM_001114387 Transmembrane protease, serine 11A ECRG1 Probable serine protease, which may play a role in cellular senescence
TNPO1 NM_002270 Transportin 1 IPO2, KPNB2, MIP, MIP1, TRN Functions in nuclear protein import as nuclear transport receptor
TNRC6C NM_001142640 Trinucleotide repeat containing 6C Plays a role in RNA-mediated gene silencing by micro-RNAs
TRUB1 NM_139169 TruB pseudouridine (psi) synthase family member 1 PUS4 May be responsible for synthesis of psi from uracil in transfer RNAs
TSG101 NM_006292 Tumor susceptibility 101 TSG10, VPS23 Component of the ESCRT-I complex, a regulator of vesicular trafficking process
TSHR NM_000369 Thyroid stimulating hormone receptor CHNG1, LGR3, hTSHR-I Receptor for thyrothropin. Plays a central role in controlling thyroid cell metabolism Yes
TUSC1 NM_001004125 Tumor suppressor candidate 1 TSG-9, TSG9
TWF1 NM_001242397 Twinfilin actin-binding protein 1 A6, PTK9 Actin-binding protein involved in motile and morphological processes
UGT3A1 NM_001171873 UDP glycosyltransferase 3 family, polypeptide A1 UDP-glucuronosyltransferases catalyze phase II biotransformation reactions
USP28 NM_001301029 Ubiquitin specific peptidase 28 Deubiquitinase involved in DNA damage response checkpoint and MYC proto-oncogene stability
VBP1 NM_003372 Von Hippel-Lindau binding protein 1 RP13-228J13.4, PFD3, PFDN3, VBP-1 Binds specifically to c-CPN and transfers target proteins to it
WDR33 NM_001006622 WD repeat domain 33 NET14, WDC146 Essential for both cleavage and polyadenylation of pre-mRNA 3′ ends
WNT16 NM_016087 Wingless-type MMTV integration site family, member 16 Ligand for members of the Frizzled family of seven transmembrane receptors
WNT2 NM_003391 Wingless-type MMTV integration site family member 2 INT1L1, IRP Ligand for members of the Frizzled family of seven transmembrane receptors
WNT3A NM_033131 Wingless-type MMTV integration site family, member 3A Ligand for members of the Frizzled family of seven transmembrane receptors
YY1 NM_003403 YY1 transcription factor DELTA, INO80S, NF-E1, UCRBP, YIN-YANG-1 May play an important role in development and differentiation
ZIC2 NM_007129 Zinc family member 2 HPE5 Involved in cerebellar development
ZNF12 NM_006956 Zinc finger protein 12 GIOT-3, HZF11, KOX3, ZNF325 May be involved in transcriptional regulation
ZNF121 NM_001008727 Zinc finger protein 121 D19S204, ZHC32, ZNF20 May be involved in transcriptional regulation
ZNF132 NM_003433 Zinc finger protein 132 pHZ-12 May be involved in transcriptional regulation
ZNF180 NM_001278508 Zinc finger protein 180 HHZ168 May be involved in transcriptional regulation
ZNF238 NM_001278196 Zinc finger and BTB domain containing 18 C2H2-171, MRD22, RP58, TAZ-1, ZNF18 Sequence-specific DNA-binding protein with transcriptional repression activity
ZNF25 NM_145011 Zinc finger protein 25 KOX19, Zfp9 May be involved in transcriptional regulation
ZNF30 NM_001099437 Zinc finger protein 30 KOX28 May be involved in transcriptional regulation
ZNF426 NM_001300883 Zinc finger protein 426 May be involved in transcriptional regulation
ZNF558 NM_144693 Zinc finger protein 558 May be involved in transcriptional regulation
ZNF562 NM_001130031 Zinc finger protein 562 May be involved in transcriptional regulation
ZNF564 NM_144976 Zinc finger protein 564 May be involved in transcriptional regulation
ZNF594 NM_032530 Zinc finger protein 594 hCG_1775942 May be involved in transcriptional regulation
ZNF644 NM_016620 Zinc finger protein 644 BM-005, MYP21, NatF, ZEP-2 May be involved in transcriptional regulation
ZNF652 NM_001145365 Zinc finger protein 652 Functions as a transcriptional repressor
ZNF700 NM_001271848 Zinc finger protein 700 May be involved in transcriptional regulation
ZNF703 NM_025069 Zinc finger protein 703 ZEPPO1, ZNF503L, ZPO1 May function as a transcriptional repressor
ZNF711 NM_021998 Zinc finger protein 711 CMPX1, MRX97, ZNF4, ZNF5, ZNF6, Zfp711, dJ75N13.1 May be involved in transcriptional regulation
ZNF763 NM_001012753 Zinc finger protein 763 ZNF, ZNF440L May be involved in transcriptional regulation
ZNF780A NM_001010880 Zinc finger protein 780A ZNF780 May be involved in transcriptional regulation

Abbreviations: CLL, chronic lymphocytic leukemia; HLA, human leukocyte antigen; HSP, heat shock protein; IGF, insulin-like growth factor; IL, interleukin; mRNA, messenger RNA; NK cells, natural killer cells; ssDNA, single-stranded DNA; UV, ultraviolet.

As shown in Table 6, our DAVID analysis showed that there were 16 functional clusters that were identified to be enriched with an enrichment score >1.0 in the target list of hsa-miR-181a-5p, based on TarBase. The functions of these clusters involved negative regulation of macromolecule biosynthetic process, negative regulation of the cellular bio-synthetic process, negative regulation of biosynthetic process, negative regulation of apoptosis, negative regulation of programmed cell death, negative regulation of cell death, negative regulation of transcription, negative regulation of nucleobase, nucleoside, nucleotide, and nucleic acid metabolic processes, negative regulation of nitrogen compound metabolic process, and lung and respiratory tube development, positive regulation of protein polymerization, positive regulation of protein complex assembly, positive regulation of protein polymerization, and positive regulation of protein complex assembly.

Table 6.

The top enriched clusters (enrich score >1) by DAVID for the targets of hsa-miR-181a-5p from TarBase 6.0

Category Term Gene count P-value FDR
Annotation cluster 1 Enrichment score: 4.3
INTERPRO Zinc finger, C2H2-type 24 2.20E-05 4.60E-03
INTERPRO Zinc finger, C2H2-like 24 2.90E-05 3.90E-03
SMART Zinc finger_C2H2 24 2.00E-04 1.90E-02
Annotation cluster 2 Enrichment score: 3.04
GOTERM_BP_FAT Negative regulation of macromolecule biosynthetic process 17 7.10E-04 9.80E-02
GOTERM_BP_FAT Negative regulation of cellular biosynthetic process 17 9.30E-04 1.20E-01
GOTERM_BP_FAT Negative regulation of biosynthetic process 17 1.20E-03 9.50E-02
Annotation cluster 3 Enrichment score: 2.97
GOTERM_BP_FAT Negative regulation of apoptosis 13 9.70E-04 1.10E-01
GOTERM_BP_FAT Negative regulation of programmed cell death 13 1.10E-03 1.00E-01
GOTERM_BP_FAT Negative regulation of cell death 13 1.10E-03 9.70E-02
Annotation cluster 4 Enrichment score: 2.67
GOTERM_BP_FAT Negative regulation of transcription 15 1.00E-03 1.00E-01
GOTERM_BP_FAT Negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process 15 2.90E-03 1.50E-01
GOTERM_BP_FAT Negative regulation of nitrogen compound metabolic process 15 3.20E-03 1.50E-01
Annotation cluster 5 Enrichment score: 2.14
GOTERM_BP_FAT Lung development 6 6.20E-03 2.30E-01
GOTERM_BP_FAT Respiratory tube development 6 7.00E-03 2.40E-01
GOTERM_BP_FAT Respiratory system development 6 8.90E-03 2.50E-01
Annotation cluster 6 Enrichment score: 1.75
GOTERM_BP_FAT Positive regulation of protein polymerization 4 3.00E-03 1.50E-01
GOTERM_BP_FAT Positive regulation of protein complex assembly 4 7.90E-03 2.60E-01
GOTERM_BP_FAT Regulation of protein polymerization 4 4.60E-02 4.90E-01
GOTERM_BP_FAT Regulation of protein complex assembly 4 9.00E-02 6.00E-01
Annotation cluster 7 Enrichment score: 1.59
GOTERM_BP_FAT Regulation of phosphorylation 12 2.20E-02 3.50E-01
GOTERM_BP_FAT Regulation of phosphate metabolic process 12 2.80E-02 3.90E-01
GOTERM_BP_FAT Regulation of phosphorus metabolic process 12 2.80E-02 3.90E-01
Annotation cluster 8 Enrichment score: 1.57
INTERPRO Secreted growth factor Wnt protein, conserved site 3 1.90E-02 7.90E-01
INTERPRO Secreted growth factor Wnt protein 3 1.90E-02 7.90E-01
INTERPRO Wnt superfamily 3 1.90E-02 7.90E-01
PIR_SUPERFAMILY PIRSF001784:int-1 transforming protein 3 2.00E-02 8.60E-01
SMART Wnt1 3 2.50E-02 5.50E-01
GOTERM_BP_FAT Wnt receptor signaling pathway, calcium modulating pathway 3 2.50E-02 3.70E-01
KEGG_PATHWAY Basal cell carcinoma 3 1.40E-01 7.00E-01
Annotation cluster 9 Enrichment score: 1.56
GOTERM_BP_FAT Positive regulation of microtubule polymerization 3 8.40E-03 2.50E-01
GOTERM_BP_FAT Regulation of microtubule polymerization 3 9.80E-03 2.60E-01
GOTERM_BP_FAT Positive regulation of microtubule polymerization or depolymerization 3 9.80E-03 2.60E-01
GOTERM_BP_FAT Regulation of microtubule polymerization or depolymerization 3 5.10E-02 5.10E-01
GOTERM_BP_FAT Regulation of microtubule cytoskeleton organization 3 8.70E-02 6.00E-01
GOTERM_BP_FAT Regulation of microtubule-based process 3 1.10E-01 6.60E-01
Annotation cluster 10 Enrichment score: 1.49
GOTERM_BP_FAT Positive regulation of cytoskeleton organization 5 1.90E-03 1.20E-01
GOTERM_BP_FAT Positive regulation of organelle organization 5 1.60E-02 3.30E-01
GOTERM_BP_FAT Regulation of cytoskeleton organization 5 7.60E-02 5.80E-01
GOTERM_BP_FAT Regulation of cellular component biogenesis 5 8.60E-02 6.00E-01
GOTERM_BP_FAT Positive regulation of cellular component organization 5 1.60E-01 7.30E-01
Annotation cluster 11 Enrichment score: 1.36
UP_SEQ_FEATURE DNA-binding region: Homeobox 7 1.60E-02 4.70E-01
INTERPRO Homeobox, conserved site 7 4.60E-02 9.10E-01
INTERPRO Homeobox 7 4.90E-02 9.00E-01
INTERPRO Homeodomain-related 7 5.10E-02 8.60E-01
SMART Hox 7 8.50E-02 7.60E-01
UP_SEQ_FEATURE Domain: BTB 6 1.80E-02 4.90E-01
INTERPRO BTB/POZ-like 6 5.10E-02 8.80E-01
INTERPRO BTB/POZ fold 6 5.30E-02 8.40E-01
SMART Btb 6 8.40E-02 8.10E-01
Annotation cluster 13 Enrichment score: 1.31
INTERPRO Peptidyl-prolyl cis-trans isomerase, FKBP-type 3 2.10E-02 7.60E-01
SP_PIR_KEYWORDS Rotamase 3 5.90E-02 5.00E-01
GOTERM_MF_FAT Peptidyl-prolyl cis-trans isomerase activity 3 6.50E-02 9.50E-01
GOTERM_MF_FAT cis-trans Isomerase activity 3 7.10E-02 9.30E-01
Annotation cluster 14 Enrichment score: 1.27
GOTERM_BP_FAT Regulation of apoptosis 16 5.10E-02 5.10E-01
GOTERM_BP_FAT Regulation of programmed cell death 16 5.50E-02 5.20E-01
GOTERM_BP_FAT Regulation of cell death 16 5.60E-02 5.20E-01
Annotation cluster 15 Enrichment score: 1.26
GOTERM_BP_FAT Positive regulation of protein kinase activity 7 4.80E-02 5.00E-01
GOTERM_BP_FAT Positive regulation of kinase activity 7 5.50E-02 5.20E-01
GOTERM_BP_FAT Positive regulation of transferase activity 7 6.40E-02 5.40E-01
Annotation cluster 16 Enrichment score: 1.09
SP_PIR_KEYWORDS RNA-mediated gene silencing 3 3.30E-02 4.10E-01
GOTERM_BP_FAT Gene silencing by RNA 3 5.70E-02 5.20E-01
GOTERM_BP_FAT Gene silencing 3 1.40E-01 6.90E-01
SP_PIR_KEYWORDS Translation regulation 3 1.60E-01 7.60E-01

Abbreviations: DAVID, Database for Annotation, Visualization and Integrated Discovery; FDR, false discovery rate.

Furthermore, our DAVID analysis revealed that there were nine KEGG pathways significantly enriched in the target list of hsa-miR-181a-5p, based on TarBase (Table 7). These pathways included pathways in cancer pathways (Figure 1), the Wnt signaling pathway (Figure 2), prostate cancer, melanogenesis, cell cycle (Figure 3), hedgehog signaling pathway, p53 signaling pathway (Figure 4), small cell lung cancer, and thyroid cancer.

Table 7.

The KEGG pathways by DAVID, for the target list of hsa-miR-181a-5p based on TarBase 6.0

Signaling pathway Gene count % P-value FDR
Pathways in cancer 11 0.5 4.50E-03 1.30E-01
Wnt signaling pathway 8 0.4 1.80E-03 1.50E-01
Prostate cancer 6 0.3 3.80E-03 1.60E-01
Melanogenesis 5 0.2 2.90E-02 4.10E-01
Cell cycle 5 0.2 5.90E-02 5.00E-01
Hedgehog signaling pathway 4 0.2 2.80E-02 4.70E-01
p53 signaling pathway 4 0.2 4.60E-02 4.50E-01
Small cell lung cancer 4 0.2 7.60E-02 5.50E-01
Thyroid cancer 3 0.1 4.50E-02 5.00E-01

Abbreviations: DAVID, Database for Annotation, Visualization and Integrated Discovery; FDR, false discovery rate; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Figure 1.

Figure 1

Cancer pathways in the target list of hsa-miR-181a-5p, based on TarBase 6.0.

Notes: Several important oncogenes and tumor suppressors are likely regulated by hsa-miR-181a-5p (marked with a red star), including Wnt, axin, CBP, Bcl-2, p27, cyclin D1, Ras, and HSP. These genes play an important role in the regulation of angiogenesis, cell proliferation, apoptosis, and metastasis.

Figure 2.

Figure 2

Wnt signaling pathway in the target list of hsa-miR-181a-5p, based on TarBase 6.0.

Notes: hsa-181a-5p is a regulator of Wnt. Three Wnt signaling pathways have been characterized: the canonical Wnt pathway, the noncanonical planar cell polarity pathway, and the noncanonical Wnt/calcium pathway.103 All three Wnt signaling pathways are activated by the binding of a Wnt-protein ligand to a Frizzled family receptor, which passes the biological signal to the protein Dishevelled inside the cell. The canonical Wnt pathway leads to regulation of gene transcription, the noncanonical planar cell polarity pathway regulates the cytoskeleton that is responsible for the shape of the cell, and the noncanonical Wnt/calcium pathway regulates calcium level inside the cell. Wnt signaling pathways are highly evolutionarily conserved. Wnt signaling has been implicated in the development of breast cancer, EC, and other types of cancer.103,104 Changes in CTNNB1 expression, which is the gene that encodes β-catenin, can be measured in, not just breast cancer but also, colorectal cancer, melanoma, prostate cancer, lung cancer, EC, and several other cancer types. Increased expression of Wnt ligand-proteins, such as Wnt 1, Wnt2, and Wnt7A, has been observed in the development of glioblastoma, esophageal cancer, EC, and ovarian cancer. There is clinical and experimental evidence that Wnt/β-catenin pathways are deregulated and play an important role in the initiation, development, growth, and metastasis of EC.105109 Targets of hsa-miR-181a-5p are marked with a red star.

Abbreviation: EC, endometrial cancer.

Figure 3.

Figure 3

Cell cycle pathway in the target list of hsa-miR-181a-5p, based on TarBase 6.0.

Notes: hsa-miR-181a-5p can regulate a number of important proteins that control the cell cycle. Control of eukaryotic cell growth and division involves molecular circuits known as “checkpoints” that ensure proper timing of cellular events. Passage through a checkpoint from one cell cycle phase to the next needs a coordinated set of proteins that monitor cell growth and DNA integrity. Uncontrolled cell division or propagation of damaged DNA can contribute to genomic instability and tumorigenesis.110 The G1/S checkpoint controls progression of cells through the restriction point (R) into the DNA synthesis S phase. During G1, the tumor suppressor Rb binds and inhibits transcription factor E2F. Phosphorylation of Rb by CDKs in late G1 induces dissociation of Rb and permits E2F-mediated transcription of S phase-promoting genes. Responding to upstream signals, INK4 and Kip/Cip family inhibitors control CDK activity and prevent entry into S phase.110 DNA damage activates response pathways through ATM/ATR and Chk1/2 kinases to block CDK activity, leading to cell cycle arrest and DNA repair or cell death. The G2/M checkpoint prevents cells containing damaged DNA from entering mitosis. Activated CDK1/Cdc2 bound to cyclin B promotes entry into M phase. Wee1 and Myt1 kinases and Cdc25 phosphatase competitively regulate CDK1 activity; Wee1 and Myt1 inhibit CDK1 and prevent entry into M phase, while Cdc25 removes inhibitory phosphates. DNA damage activates multiple kinases that phosphorylate kinases Chk1/2 and tumor suppressor protein p53. Chk1/2 kinases stimulate Wee1 activity and inhibit Cdc25C, preventing entry into M phase. Phosphorylation of p53 promotes dissociation between p53 and MDM2 and allows binding of the transcription factor to DNA. In addition, the spindle checkpoint ensures proper chromatid attachment prior to progression from metaphase to anaphase.110 The SCF and APC/C protein complexes play prominent roles, with APC-Cdc20 initiating the entry into anaphase by promoting ubiquitin-mediated degradation of multiple substrates, including cyclin B and the regulatory protein securing. Targets of hsa-miR-181a-5p are marked with a red star.

Figure 4.

Figure 4

p53 pathway in the target list of hsa-miR-181a-5p, based on TarBase 6.0.

Notes: hsa-miR-181a-5p can regulate the p53 signaling pathway. p53 is situated at the crossroads of a network of signaling pathways that are essential for cell growth regulation and apoptosis induced by genotoxic and nongenotoxic stresses. In normal unstressed cells, the level of p53 protein is downregulated via the binding of proteins such as MDM2, COP1, PIRH2, or JNK, which promote p53 degradation via the ubiquitin/proteasome pathway. As most of these genes are upregulated by p53, this leads to a regulation loop that will keep p53 level very low in normal cells. After exposure to genotoxic or nongenotoxic stresses, p53 protein level is increased via the inhibition of its interaction with MDM2 and the other negative regulators. A series of modulators, such as kinases and acetylases, will activate p53 transcriptional activity. Regardless of the type of stress, the final outcome of p53 activation is either cell cycle arrest and DNA repair or apoptosis. Dysfunctional p53 due to mutations will lead to tumorigenesis. p53 mutations can be found in 50% of human cancers including EC, but their penetrance is highly heterogeneous. Mutations in various pathways upstream of p53 (eg, ATM, p19ARF, or Hcdk2 gene) can be observed in various types of cancer, including EC. Targets of hsa-miR-181a-5p are marked with a red star.

Abbreviation: EC, endometrial cancer.

Validated targets of hsa-miR-181a-5p based on miRTarBase

Based on miRTarBase, 241 targets of hsa-miR-181a-5p have been validated with experimental evidence (Table 8). These included ACOT12, AFTPH, AKAP12, AMMECR1, ANKRD1, ANKRD13C, AP1M1, ARF6, ARHGAP12, ARL6IP6, ATF7IP2, ATG10, ATM, ATP6V0E1, ATP8A1, BAG2, BCL2, BCL2L11, BDNF, BPGM, BRCA1, BRMS1L, BTBD3, C1orf109, C1QTNF9, C8A, CCDC6, CCNG1, CD46, and CDKN1B. Among these validated targets, only 18 are cancer genes (7.47%), including ATM, BCL2, CCDC6, CDX2, FBXO11, H3F3B, HOOK3, HOXA11, HRAS, KRAS, MAP2K1, NOTCH1, NOTCH2, PLAG1, PTPN11, STAG2, TAF15, and TSHR (Table 8). Only half of these cancer genes have been included in TarBase.

Table 8.

Targets of hsa-miR-181a-5p with experimental evidence based on miRTarBase 4.0

Gene symbol Accession Full name Alias Function Cancer gene
ACOT12 NM_130767 Acyl-CoA thioesterase 12 CACH-1, Cach, STARD15, THEAL Hydrolyzes acetyl-CoA to acetate and CoA
AFTPH NM_001002243 Aftiphilin Nbla10388 May play a role in membrane trafficking
AKAP12 NM_005100 A kinase anchor protein 12 AKAP250, SSeCKS Anchoring protein that mediates the subcellular compartmentation of PKA and PKC
AMMECR1 NM_001025580 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 RP13-360B22.1, AMMERC1
ANKRD1 NM_014391 Ankyrin repeat domain 1 (cardiac muscle) ALRP, C-193, CARP, CVARP, MCARP, bA320F15.2 Plays an important role in endothelial cell activation
ANKRD13C NM_030816 Ankyrin repeat domain 13C RP4-677H15.5, dJ677H15.3
AP1M1 NM_001130524 Adaptor-related protein complex 1, mu 1 subunit AP47, CLAPM2, CLTNM, MU-1A Subunit of clathrin-associated adaptor protein complex 1 that plays a role in protein sorting in the trans-Golgi network and endosomes
ARF6 NM_001663 ADP-ribosylation factor 6 Involved in protein trafficking
ARHGAP12 NM_001270695 Rho GTPase activating protein 12 GTPase activator for the Rho-type GTPases by converting them to an inactive GDP-bound state
ARL6IP6 NM_022989 ADP-ribosylation factor-like 6 interacting protein 6 RP23-265N10.1, 2310057C01Rik, 2610529A11Rik, Aip-6 May be involved in protein transport, membrane trafficking, or cell signaling during hematopoietic maturation
ATF7IP2 NM_001256160 Activating transcription factor 7 interacting protein 2 MCAF2 Recruiter that couples transcriptional factors to general transcription apparatus and thereby modulates transcription regulation and chromatin formation
ATG10 NM_001131028 Autophagy related 10 PP12616, APG10, APG10L, pp12616 Plays a role in autophagy
ATM NM_000051 ATM serine/threonine kinase AT1, ATA, ATC, ATD, ATDC, ATE, TEL1, TELO1 Serine/threonine protein kinase Yes
ATP6V0E1 NM_003945 ATPase, H+ transporting, lysosomal 9 kDa, V0 subunit e1 ATP6H, ATP6V0E, M9.2, Vma21, Vma21p Vacuolar ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells
ATP8A1 NM_001105529 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 ATPASEII, ATPIA, ATPP2 May play a role in the transport of aminophospholipids from the outer to the inner leaflet of various membranes and the maintenance of asymmetric distribution of phospholipids
BAG2 NM_004282 BCL2-associated athanogene 2 RP3-496N17.2, BAG-2, dJ417I1.2 Inhibits the chaperone activity of HSP70/HSC70 by promoting substrate release
BCL2 NM_000633 B-cell CLL/lymphoma 2 Bcl-2, PPP1R50 Suppresses apoptosis Yes
BCL2L11 NM_001204106 BCL2-like 11 BAM, BIM, BOD Induces apoptosis
BDNF NM_001143805 Brain-derived neurotrophic factor ANON2, BULN2 Promotes the survival of neuronal populations
BPGM NM_001293085 2,3-bisphosphoglycerate mutase DPGM Plays a major role in regulating hemoglobin oxygen affinity
BRCA1 NM_007294 Breast cancer 1, early onset BRCAI, BRCC1, BROVCA1, IRIS, PNCA4, PPP1R53, PSCP, RNF53 Plays a central role in DNA repair by facilitating cellular response to DNA repair
BRMS1L NM_032352 Breast cancer metastasis-suppressor 1-like BRMS1 Involved in the HDAC1-dependent transcriptional repression activity
BTBD3 NM_001282550 BTB (POZ) domain containing 3 RP4-742J24.3, dJ742J24.1 Acts as a key regulator of dendritic field orientation during development of sensory cortex
C1orf109 NM_017850 Chromosome 1 open reading frame 109
C1QTNF9 NM_183175 C1q and tumor necrosis factor related protein 9 9130217G22Rik, CTRP9, Ciqtnf9 Activates AMPK, AKT, and p44/42 MAPK signaling pathways
C8A NM_000562 Complement component 8, α polypeptide C8 is a constituent of the membrane attack complex
CCDC6 NM_005436 Coiled-coil domain containing 6 D10S170, H4, PTC, TPC, TST1 A tumor suppressor Yes
CCNG1 NM_004060 Cyclin G1 CCNG May play a role in growth regulation
CD46 NM_002389 CD46 molecule, complement regulatory protein AHUS2, MCP, MIC10, TLX, TRA2.10 Acts as a cofactor for complement factor I
CDKN1B NM_004064 Cyclin-dependent kinase inhibitor 1B (p27, Kip1) CDKN4, KIP1, MEN1B, MEN4, P27KIP1 Important regulator of cell cycle progression
CDX2 NM_001265 Caudal type homeobox 2 CDX-3, CDX3 Involved in the transcriptional regulation of multiple genes expressed in the intestinal epithelium Yes
CFI NM_000204 Complement factor I AHUS3, ARMD13, C3BINA, C3b-INA, FI, IF, KAF Responsible for cleaving the α-chains of C4b and C3b in the presence of the cofactors C4-binding protein and factor H, respectively
CHL1 NM_001253387 Cell adhesion molecule L1-like CALL, L1CAM2 Plays a role in nervous system development and in synaptic plasticity
CHRFAM7A NM_139320 CHRNA7 (cholinergic receptor, nicotinic, α 7, exons 5–10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion CHRNA7, CHRNA7-DR1, D-10 Extracellular ligand-gated ion channel activity
CLUAP1 NM_015041 Clusterin associated protein 1 CFAP22, FAP22 May play a role in cell proliferation or apoptosis
COL27A1 NM_032888 Collagen, type XXVII, α 1 RP11-82I1.1 Plays a role during the calcification of cartilage and the transition of cartilage to bone
COPS2 NM_001143887 COP9 signalosome subunit 2 ALIEN, CSN2, SGN2, TRIP15 Involved in various cellular and developmental processes
CST5 NM_001900 Cystatin D Cysteine proteinase inhibitor
DCST1 NM_001143687 DC-STAMP domain containing 1 RP11-307C12.10-003 Protein and zinc ion binding
DDIT4 NM_019058 DNA-damage-inducible transcript 4 RP11-442H21.1, Dig2, REDD-1, REDD1 Inhibits cell growth by regulating the frap1 pathway upstream of the tsc1-tsc2 complex and downstream of Akt1
DDX27 NM_017895 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 HSPC259, DRS1, Drs1p, PP3241, RHLP, dJ686N3.1 Probable ATP-dependent RNA helicase
DDX3X NM_001193416 DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked DBX, DDX14, DDX3, HLP2 ATP-dependent RNA helicase
DNAJC7 NM_001144766 DnaJ (HSP40) homolog, subfamily C, member 7 DJ11, DJC7, TPR2, TTC2 Acts as co-chaperone regulating the molecular chaperones HSP70 and HSP90 in folding of steroid receptors
DSCR8 NM_032589 Down syndrome critical region gene 8 C21orf65, CT25.1a, CT25.1b, MMA-1, MMA-1a, MMA-1b, MMA1, MTAG2
DUSP5 NM_004419 Dual specificity phosphatase 5 DUSP, HVH3 Displays phosphatase activity toward several substrates
DUSP6 NM_001946 Dual specificity phosphatase 6 HH19, MKP3, PYST1 Inactivates MAP kinases
ENAH NM_001008493 Enabled homolog RP11-496N12.7, ENA, MENA, NDPP1 Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity
EPHA5 NM_001281765 EPH receptor A5 CEK7, EHK-1, EHK1, EK7, HEK7, TYRO4 Receptor for members of the ephrin-A family
ESR1 NM_000125 Estrogen receptor 1 RP1-130E4.1, ER, ESR, ESRA, ESTRR, Era, NR3A1 Nuclear hormone receptor
EYA4 NM_001301012 EYA transcriptional coactivator and phosphatase 4 RP11-704J17.4, CMD1J, DFNA10 Tyrosine phosphatase that specifically dephosphorylates ‘Tyr-142’ of histone H2AX (H2AXY142ph)
FAM160A2 NM_001098794 Family with sequence similarity 160, member A2 C11orf56
FAM222B NM_001077498 Family with sequence similarity 222, member B C17orf63
FAM47B NM_152631 Family with sequence similarity 47, member B RP13-520K9.1
FAT1 NM_005245 FAT atypical cadherin 1 CDHF7, CDHR8, FAT, ME5, hFat1 Could function as a cell-adhesion protein
FBXO11 NM_001190274 F-box protein 11 UG063H01, FBX11, PRMT9, UBR6, VIT1 Substrate recognition component of the SCF E3 ubiquitin-protein ligase complex Yes
FBXO28 NM_001136115 F-box protein 28 CENP-30, Fbx28 Probably recognizes and binds to some phosphorylated proteins and promotes their ubiquitination and degradation
FBXO33 NM_203301 F-box protein 33 BMND12, Fbx33, c14_5247 Substrate recognition component of the SCF E3 ubiquitin-protein ligase complex, which mediates the ubiquitination and subsequent proteasomal degradation of target proteins
FBXO34 NM_017943 F-box protein 34 CGI-301, Fbx34 Substrate recognition component of the SCF E3 ubiquitin-protein ligase complex, which mediates the ubiquitination and subsequent proteasomal degradation of target proteins
FKBP10 NM_021939 FK506 binding protein 10 PSEC0056, FKBP65, OI11, OI6, PPIASE, hFKBP65 PPIases accelerate the folding of proteins during protein synthesis
FKBP7 NM_001135212 FK506 binding protein 7 UNQ670/PRO1304, FKBP23, PPIase PPIases accelerate the folding of proteins during protein synthesis
FOS NM_005252 FBJ murine osteosarcoma viral oncogene homolog AP-1, C-FOS, p55 Nuclear phosphoprotein, which forms a tight but noncovalently linked complex with the JUN/AP-1 transcription factor
FRA10AC1 NM_145246 Fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1 PRO2972, C10orf4, F26C11.1-like, FRA10A
FSIP1 NM_152597 Fibrous sheath interacting protein 1 HSD10
FXYD6 NM_001164831 FXYD domain containing ion transport regulator 6 UNQ521/PRO1056
GADD45G NM_006705 Growth arrest and DNA-damage-inducible, γ RP11-260L6.1, CR6, DDIT2, GADD45 γ, GRP17 Involved in the regulation of growth and apoptosis
GANAB NM_001278192 Glucosidase, α; neutral AB G2AN, GLUII Cleaves sequentially the 2 innermost α-1,3-linked glucose residues from the Glc(2) Man(9)GlcNAc(2) oligosaccharide precursor of immature glycoproteins
GATA6 NM_005257 GATA binding protein 6 Regulates terminal differentiation and/or proliferation
GATAD2B NM_020699 GATA zinc finger domain containing 2B RP11-216N14.6, MRD18, P66β, p68 Has transcriptional repressor activity
GCNT1 NM_001097633 Glucosaminyl (N-acetyl) transferase 1, core 2 RP11-214N16.1, C2GNT, C2GNT-L, C2GNT1, G6NT, NACGT2, NAGCT2 Forms critical branches in O-glycans
GIGYF1 NM_022574 GRB10 interacting GYF protein 1 PP3360, GYF1, PERQ1 May act cooperatively with GRB10 to regulate tyrosine kinase receptor signaling
GNAI3 NM_006496 G protein, α inhibiting activity polypeptide 3 RP5-1160K1.2, 87U6, ARCND1 G proteins are involved as modulators or transducers in various transmembrane signaling systems
GPR137B NM_003272 G protein-coupled receptor 137B RP5-985L19.1, TM7SF1
GPR78 NM_080819 G protein-coupled receptor 78 UNQ5925/PRO19818 Orphan receptor
GPR83 NM_016540 G protein-coupled receptor 83 GIR, GPR72 Orphan receptor. Could be a neuropeptide y receptor
GPRIN3 NM_198281 GPRIN family member 3 GRIN3 May be involved in neurite outgrowth
GSTM2 NM_000848 Glutathione S-transferase mu 2 (muscle) GST4, GSTM-2, GTHMUS, GSTM2 Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles
H1F0 NM_005318 H1 histone family, member 0 H10, H1FV Histones H1 are necessary for the condensation of nucleosome chains into higher order structures
H2AFY NM_001040158 H2A histone family, member Y H2A.y, H2A/y, H2AF12M, H2AFJ, MACROH2A1.1, mH2A1, macroH2A1.2 Plays a central role in transcription regulation, DNA repair, DNA replication, and chromosomal stability
H3F3B NM_005324 H3 histone, family 3B H3.3B Plays a central role in transcription regulation, DNA repair, DNA replication, and chromosomal stability Yes
HDAC6 NM_006044 Histone deacetylase 6 JM21, CPBHM, HD6, PPP1R90 Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3, and H4)
HERC3 NM_001271602 HECT and RLD domain containing E3 ubiquitin protein ligase 3 E3 ubiquitin-protein ligase
HEY2 NM_012259 Hes-related family bHLH transcription factor with YRPW motif 2 RP1-293L8.3, CHF1, GRIDLOCK, GRL, HERP1, HESR2, HRT2, bHLHb32 Downstream effector of Notch signaling, which may be required for cardiovascular development
HIPK2 NM_001113239 Homeodomain interacting protein kinase 2 PRO0593 Protein kinase acting as a corepressor of several transcription factors
HMGB2 NM_001130688 High mobility group box 2 HMG2 Binds preferentially ssDNA and unwinds double-stranded DNA
HNRNPAB NM_004499 Heterogeneous nuclear ribonucleoprotein A/B ABBP1, HNRPAB Binds single-stranded RNA
HOOK3 NM_032410 Hook microtubule-tethering protein 3 HK3 Probable cytoskeletal linker protein, involved in tethering the G olgi complex to the cytoskeleton Yes
HOXA11 NM_005523 Homeobox A11 HOX1, HOX1I Sequence-specific transcription factor Yes
HRAS NM_001130442 Harvey rat sarcoma viral oncogene homolog C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-RASIDX, HAMSV1, RASH1, p21ras, HRAS Ras proteins bind GDP/GTP and possess intrinsic GTPase activity Yes
HSD17B3 NM_000197 Hydroxysteroid (17-β) dehydrogenase 3 RP11-240L7.3, EDH17B3, SDR12C2 Favors the reduction of androstenedione to testosterone
HSPA13 NM_006948 Heat shock protein 70 kDa family, member 13 STCH Has peptide-independent ATPase activity
HUWE1 NM_031407 HECT, UBA and WWE domain containing 1 RP3-339A18.4, ARF-BP1, HECTH9, HSPC272, Ib772, LASU1, MULE, URE-B1, UREB1 E3 ubiquitin-protein ligase mediating ubiquitination and subsequent proteasomal degradation of target proteins
IDS NM_000202 Iduronate 2-sulfatase MPS2, SIDS Required for the lysosomal degradation of heparan sulfate and dermatan sulfate
INCENP NM_001040694 Inner centromere protein antigens Component of the chromosomal passenger complex, a complex that acts as a key regulator of mitosis
IQCG NM_001134435 IQ motif containing G CFAP122, DRC9
KAT2B NM_003884 K(lysine) acetyltransferase 2B CAF, P/CAF, PCAF Functions as a HAT to promote transcriptional activation
KBTBD3 NM_152433 Kelch repeat and BTB (POZ) domain containing 3 BKLHD3
KCTD2 NM_015353 Potassium channel tetramerization domain containing 2
KCTD3 NM_016121 Potassium channel tetramerization domain containing 3 RP11-5F19.1, NY-REN-45
KIAA0100 NM_014680 KIAA0100 BCOX, BCOX1, CT101
KIAA0101 NM_001029989 KIAA0101 L5, NS5ATP9, OEATC, OEATC-1, OEATC1, PAF, PAF15, p15(PAF), p15/PAF, p15PAF May be involved in protection of cells from UV-induced cell death
KIAA1462 NM_020848 KIAA1462 JCAD
KLF6 NM_001160124 Kruppel-like factor 6 RP11-184A2.1, BCD1, CBA1, COPEB, CPBP, GBF, PAC1, ST12, ZF9 Plays a role in B-cell growth and development
KLHL15 NM_030624 Kelch-like family, member 15 HEL-S-305 Probable substrate-specific adapter of an E3 ubiquitin-protein ligase complex, which mediates the ubiquitination and subsequent proteasomal degradation of target proteins
KLHL42 NM_020782 Kelch-like family, member 42 Ctb9, KLHDC5 Substrate-specific adapter of a BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex required for mitotic progression and cytokinesis
KLRC4 NM_013431 Killer cell lectin-like receptor subfamily C, member 4 NKG2-F, NKG2F May play a role as a receptor for the recognition of MHC class I HLA-E molecules by NK cells
KRAS NM_004985 Kirsten rat sarcoma viral oncogene homolog C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS1, KRAS2, NS, NS3, RASK2, KRAS Binds GDP/GTP and possesses intrinsic GTPase activity Yes
LAMA3 NM_000227 Laminin, α 3 BM600, E170, LAMNA, LOCS, lama3a Binding to cells via a high-affinity receptor, mediating the attachment, migration, and organization of cells into tissues
LBR NM_002296 Lamin B receptor PRO0650, DHCR14B, LMN2R, PHA, TDRD18 Anchors the lamina and the heterochromatin to the inner nuclear membrane
LCLAT1 NM_001002257 Lysocardiolipin acyltransferase 1 UNQ1849/PRO3579, 1AGPAT8, AGPAT8, ALCAT1, HSRG1849, LYCAT, UNQ1849 Acyl-CoA: lysocardiolipin acyltransferase
LFNG NM_001040167 LFNG O-fucosylpeptide 3-β-N-acetylglucosaminyltransferase SCDO3 Glycosyltransferase
LGALSL NM_014181 Lectin, galactoside-binding-like HSPC159, GRP Does not bind lactose and may not bind carbohydrates
LPGAT1 NM_014873 Lysophosphatidylglycerol acyltransferase 1 FAM34A, FAM34A1, NET8 Lysophoshatidylglycerol-specific acyltransferase
LRRC17 NM_001031692 Leucine rich repeat containing 17 UNQ3076/PRO9909, P37NB Involved in bone homeostasis, acting as a negative regulator of RANKL-induced osteoclast precursor differentiation from bone marrow precursors
LRRN3 NM_001099658 Leucine rich repeat neuronal 3 Nbla10363, FIGLER5, NLRR-3, NLRR3
LYSMD3 NM_001286812 LysM, putative peptidoglycan-binding, domain containing 3
MAP2K1 NM_002755 Mitogen-activated protein kinase kinase 1 CFC3, MAPKK1, MEK1, MKK1, PRKMK1 Catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases Yes
MAZ NM_001042539 MYC-associated zinc finger protein (purine-binding transcription factor) PUR1, Pur-1, SAF-1, SAF-2, SAF-3, ZF87, ZNF801, Zif87 May function as a transcription factor with dual roles in transcription initiation and termination
MCL1 NM_001197320 Myeloid cell leukemia 1 BCL2L3, EAT-ES, MCL1L, MCL1S, Mcl-1, TM, bcl2-L-3, mcl1/EAT, MCL1 Involved in the regulation of apoptosis versus cell survival, and in the maintenance of viability but not of proliferation
METAP1 NM_015143 Methionyl aminopeptidase 1 MAP1A, MetAP1A Removes the amino terminal methionine from nascent proteins
MGAT5 NM_002410 Mannosyl (α-1,6-)-glycoprotein β-1,6-N-acetyl-glucosaminyltransferase GNT-V, GNT-VA Catalyzes the addition of N-acetylglucosamine in β 1–6 linkage to the α-linked mannose of biantennary N-linked oligosaccharides
MOB1A NM_018221 MOB kinase activator 1A C2orf6, MATS1, MOB1, MOBK1B, MOBKL1B, Mob4B Activator of LATS1/2 in the Hippo signaling pathway
MOB1B NM_001244766 MOB kinase activator 1B MATS2, MOB4A, MOBKL1A Activator of LATS1/2 in the Hippo signaling pathway
MOB3B NM_024761 MOB kinase activator 3B C9orf35, MOB1D, MOBKL2B May regulate the activity of kinases
MRPS14 NM_022100 Mitochondrial ribosomal protein S14 DJ262D12.2, HSMRPS14, MRP-S14, S14mt
MTMR12 NM_001040446 Myotubularin related protein 12 3-PAP, PIP3AP Inactive phosphatase that plays a role as an adapter for the phosphatase myotubularin, to regulate myotubularin intracellular location
MTMR3 NM_021090 Myotubularin related protein 3 hCG_2011013, FYVE-DSP1, ZFYVE10 Phosphatase that acts on lipids with a phosphoinositol head group
ND2 NADH dehydrogenase subunit 2 Core subunit of the mitochondrial membrane re-spiratory chain NADH dehydrogenase (Complex I)
NFYB NM_006166 Nuclear transcription factor Yβ CBF-A, CBF-B, HAP3, NF-YB Stimulates the transcription of various genes by recognizing and binding to a CCAAT motif in promoters
NKX3-2 NM_001189 NK3 homeobox 2 BAPX1, NKX3.2, NKX3B, SMMD Transcriptional repressor that acts as a negative regulator of chondrocyte maturation
NLK NM_016231 Nemo-like kinase Role in cell fate determination, required for differentiation of bone marrow stromal cells
NMRK2 NM_001289117 Nicotinamide riboside kinase 2 ITGB1BP3, MIBP, NRK2
NOL4 NM_001198546 Nucleolar protein 4 HRIHFB2255, CT125, NOLP
NOTCH1 NM_017617 Notch 1 TAN1, hN1 Functions as a receptor for membrane-bound ligands Jagged1, Jagged2, and Delta1 to regulate cell fate determination Yes
NOTCH2 NM_001200001 Notch 2 AGS2, HJCYS, hN2 Functions as a receptor for membrane-bound ligands Jagged1, Jagged2, and Delta1 to regulate cell fate determination Yes
NR6A1 NM_001278546 Nuclear receptor subfamily 6, group A, member 1 CT150, GCNF, GCNF1, NR61, RTR, hGCNF, hRTR Orphan nuclear receptor. May be involved in the regulation of gene expression in germ cell development during gametogenesis
NRP1 NM_001024628 Neuropilin 1 RP11-342D11.1, BDCA4, CD304, NP1, NRP, VEGF165R The membrane-bound isoform 1 is a receptor involved in the development of the cardiovascular system, in angiogenesis, in the formation of certain neuronal circuits, and in organogenesis outside the nervous system
NUDT12 NM_001300741 Nudix-type motif 12 Hydrolyzes NAD(P)H to NMNH and AMP (2′,5′-ADP), and diadenosine diphosphate to AMP
NUPL1 NM_001008564 Nucleoporin like 1 RP11-206I15.1, PRO2463 Component of the nuclear pore complex, a complex required for the trafficking across the nuclear membrane
OCA2 NM_000275 Oculocutaneous albinism II BEY, BEY1, BEY2, BOCA, D15S12, EYCL, EYCL2, EYCL3, HCL3, P, PED, SHEP1 Could be involved in the transport of tyrosine
OFCC1 NM_153003 Orofacial cleft 1 candidate 1 MRDS1
OR11A1 NM_013937 Olfactory receptor, family 11, subfamily A, member 1 DAAP-34I1.2, 6M1-18, OR11A2, dJ994E9.6, hs6M1-18 Odorant receptor
OTUD1 NM_001145373 OTU deubiquitinase 1 DUBA7, OTDC1 Deubiquitinating enzyme that specifically hydrolyzes ‘Lys-63’-linked polyubiquitin to monoubiquitin
OTX2 NM_001270523 Orthodenticle homeobox 2 CPHD6, MCOPS5 Probably plays a role in the development of the brain and the sense organs
PABPC1 NM_002568 Poly(A) binding protein, cytoplasmic 1 PAB1, PABP, PABP1, PABPC2, PABPL1 Binds the poly(A) tail of mRNA
PCDHB8 NM_019120 Protocadherin β8 PCDH-β8, PCDH3I Potential calcium-dependent cell-adhesion protein
PFKFB2 NM_001018053 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase 2 RP11-164O23.2, PFK-2/FBPase-2 Synthesis and degradation of fructose 2,6-bisphosphate
PGD NM_002631 Phosphogluconate dehydrogenase 6PGD Catalyzes the oxidative decarboxylation of 6-phosphogluconate to ribulose 5-phosphate and CO2, with concomitant reduction of NADP to NADPH
PHOX2A NM_005169 Paired-like homeobox 2a ARIX, CFEOM2, FEOM2, NCAM2, PMX2A May be involved in regulating the specificity of expression of the catecholamine biosynthetic genes
PHPT1 NM_001135861 Phosphohistidine phosphatase 1 RP11-216L13.10-005, CGI-202, HEL-S-132P, HSPC141, PHP14 Exhibits phosphohistidine phosphatase activity
PITPNB NM_001284277 Phosphatidylinositol transfer protein β RP3-353E16.2, PI-TP-β, PtdInsTP, VIB1B Catalyzes the transfer of PtdIns and phosphatidylcholine between membranes
PLA2G4C NM_001159322 Phospholipase A2, group IVC CPLA2-γ Has a preference for arachidonic acid at the sn-2 position of phosphatidylcholine as compared with palmitic acid
PLAG1 NM_001114634 Pleiomorphic adenoma gene 1 PSA, SGPA, ZNF912 Transcription factor whose activation results Yes in upregulation of target genes, such as IGFII, leading to uncontrolled cell proliferation
PLCL2 NM_001144382 Phospholipase C-like 2 PLCE2 May play a role in the regulation of Ins(1,4,5)P3 around the endoplasmic reticulum
PLXDC2 NM_001282736 Plexin domain containing 2 UNQ2514/PRO6003, TEM7R May play a role in tumor angiogenesis
PPP1R9A NM_001166160 protein phosphatase 1, regulatory subunit 9A NRB1, NRBI, Neurabin-I Binds to actin filaments (F-actin) and shows crosslinking activity
PRAP1 NM_001145201 Proline-rich acidic protein 1 RP11-122K13.6, PRO1195, UPA May play an important role in maintaining normal growth homeostasis in epithelial cells
PRDX3 NM_006793 Peroxiredoxin 3 AOP-1, AOP1, HBC189, MER5, PRO1748, SP-22, prx-III Involved in redox regulation of the cell
PRLR NM_000949 Prolactin receptor HPRL, MAB, hPRLrI This is a receptor for the anterior pituitary hormone prolactin
PROSC NM_007198 Proline synthetase co-transcribed homolog
PROX1 NM_001270616 Prospero homeobox 1 May play a fundamental role in early development of the central nervous system
PRR4 NM_001098538 Proline rich 4 LPRP, PROL4
PRRC2B NM_013318 Proline-rich coiled-coil 2B RP11-334J6.1, BAT2L, BAT2L1, KIAA0515, LQFBS-1
PTGS2 NM_000963 Prostaglandin-endoperoxide synthase 2 COX-2, COX2, GRIPGHS, PGG/HS, PGHS-2, PHS-2, hCox-2 May have a role as a major mediator of inflammation and/or a role for prostanoid signaling in activity-dependent plasticity
PTPLAD1 NM_016395 Protein tyrosine phosphatase-like A domain containing 1 B-IND1, HACD3, HSPC121 Involved in Rac1-signaling pathways leading to the modulation of gene expression
PTPN11 NM_002834 Protein tyrosine phosphatase, non-receptor type 11 BPTP3, CFC, NS1, PTP-1D, PTP2C, SH-PTP2, SH-PTP3, SHP2 Acts downstream of various receptor and Yes cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus
PTPN22 NM_001193431 Protein tyrosine phosphatase, non-receptor type 22 LYP, LYP1, LYP2, PEP, PTPN8 Seems to act on Cbl
PTPRZ1 NM_001206838 Protein tyrosine phosphatase, receptor-type, Z polypeptide 1 HPTPZ, HPTPζ, PTP-ζ, PTP18, PTPRZ, PTPZ, R-PTP-ζ-2, RPTPB, RPTPβ, phosphacan May be involved in the regulation of specific developmental processes in the central nervous system
PUM1 NM_001020658 Pumilio RNA-binding family member 1 RP1-65J11.4, HSPUM, PUMH, PUMH1, PUML1 Sequence-specific RNA-binding protein that regulates translation and mRNA stability by binding the 3′-UTR of mRNA targets
RALA NM_005402 V-ral simian leukemia viral oncogene homolog A RAL Multifunctional GTPase involved in a variety of cellular processes, including gene expression, cell migration, cell proliferation, oncogenic transformation, and membrane trafficking
RASSF6 NM_001270391 Ras association (RalGDS/AF-6) domain family member 6 May act as a Ras effector protein
RLF NM_012421 Rearranged L-myc fusion RP1-39G22.1, ZN-15L, ZNF292L May be involved in transcriptional regulation.
RNF2 NM_007212 Ring finger protein 2 GS1-120K12.1, BAP-1, BAP1, DING, HIPI3, RING1B, RING2 E3 ubiquitin-protein ligase that mediates mono-ubiquitination of “Lys-119” of histone H2A, playing a central role in histone code and gene regulation
RNF34 NM_001256858 Ring finger protein 34 CARP-1, CARP1, RFI, RIF, RIFF, hRFI Has E3 ubiquitin-protein ligase activity. Regulates the levels of CASP8 and CASP10 by targeting them for proteasomal degradation
ROPN1L NM_001201466 Rhophilin associated tail protein 1-like RP11-1C1.7, ASP, RSPH11
RPL14 NM_001034996 Ribosomal protein L14 CAG-ISL-7, CTG-B33, L14, RL14, hRL14
RPS8 NM_001012 Ribosomal protein S8 RP11-269F19.3, S8
S100A1 NM_006271 S100 calcium binding protein A1 RP1-178F15.1, S100, S100-α, S100A Weakly binds calcium but binds zinc very tightly – distinct binding sites with different affinities exist for both ions on each monomer
SCD NM_005063 Stearoyl-CoA desaturase PRO1933, FADS5, MSTP0081, SCDOS, SCD Terminal component of the liver microsomal stearyl-CoA desaturase system
SH3BGRL NM_003022 SH3 domain binding glutamate-rich protein like HEL-S-115, SH3BGR
SIK2 NM_015191 Salt-inducible kinase 2 LOH11CR1I, QIK, SNF1LK2 Phosphorylates Ser794 of IRS1 in insulin-stimulated adipocytes
SIRT1 NM_001142498 Sirtuin 1 RP11-57G10.3, SIR2L1 NAD-dependent deacetylase, which regulates processes such as apoptosis and muscle differentiation by deacetylating key proteins
SIX6 NM_007374 SIX homeobox 6 MCOPCT2, OPTX2, Six9 May be involved in eye development
SLC35B4 NM_032826 Solute carrier family 35 (UDP-xylose/UDP-N-acetylglucosamine transporter), member B4 PSEC0055, YEA, YEA4 Sugar transporter that specifically mediates the transport of UDP-Xyl and UDP-GlcNAc from cytosol into Golgi
SLC37A3 NM_001287498 Solute carrier family 37, member 3
SLC7A11 NM_014331 Solute carrier family 7 (anionic amino acid transporter light chain, xc-system), member 11 CCBR1, xCT Sodium-independent, high-affinity exchange of anionic amino acids with high specificity for anionic form of cystine and glutamate
SLCO2A1 NM_005630 Solute carrier organic anion transporter family, member 2A1 MATR1, OATP2A1, PGT, PHOAR2, SLC21A2 May mediate the release of newly synthesized prostaglandins from cells, the transepithelial transport of prostaglandins, and the clearance of prostaglandins from the circulation
SMCHD1 NM_015295 Structural maintenance of chromosomes flexible hinge domain containing 1 Required for maintenance of X inactivation in females and hypermethylation of CpG islands associated with inactive X
SMG1 NM_015092 SMG1 phosphatidylinositol 3-kinase-related kinase 61E3.4, ATX, LIP Serine/threonine protein kinase involved in both mRNA surveillance and genotoxic stress response pathways
SNAI2 NM_003068 Snail family zinc finger 2 SLUG, SLUGH1, SNAIL2, WS2D Transcriptional repressor. Involved in the generation and migration of neural crest cells
SOGA2 NM_015210 Microtubule crosslinking factor 1 CCDC165, KIAA0802, MTCL1
SPRY2 NM_005842 Sprouty homolog 2 hSPRY2 May function as an antagonist of fibroblast growth factor pathways and may negatively modulate respiratory organogenesis
SRPK2 NM_001278273 SRSF protein kinase 2 SFRSK2 Phosphorylates RS domain-containing proteins
SRSF7 NM_001031684 Serine/arginine-rich splicing factor 7 9G8, AAG3, SFRS7 Required for pre-mRNA splicing
STAG2 NM_001042749 Stromal antigen 2 RP11-517O1.1, SA-2, SA2, SCC3B, bA517O1.1 Component of cohesion complex, a complex required for the cohesion of sister chromatids after DNA replication Yes
TAAR6 NM_175067 Trace amine associated receptor 6 RP11-295F4.3, TA4, TAR4, TAR6, TRAR4, taR-4, taR-6 Orphan receptor. Could be a receptor for trace amines
TAB2 NM_001292034 TGF-β activated kinase 1/MAP3K7 binding protein 2 CHTD2, MAP3K7IP2, TAB-2 Adapter linking MAP3K7/TAK1 and TRAF6, and mediator of MAP3K7 activation in the IL1 signaling pathway
TAF15 NM_003487 TAF15 RNA polymerase II, TBP-associated factor Npl3, RBP56, TAF2N, TAFII68 RNA and ssDNA-binding protein that may play specific roles during transcription initiation at distinct promoters Yes
TAF2 NM_003184 TAF2 RNA polymerase II, TBP-associated factor CIF150, MRT40B, TAFII150, TAF2 Transcription factor TFIID is one of the general factors required for accurate and regulated initiation by RNA polymerase II
TAF6L NM_006473 TAF6-like RNA PCAF-associated factor PAF65A Functions as a component of the PCAF complex
TBX4 NM_018488 T-box 4 SPS Involved in the transcriptional regulation of genes required for mesoderm differentiation
TCF21 NM_003206 Transcription factor 21 POD1, bHLHa23 Involved in epithelial–mesenchymal interactions in kidney and lung morphogenesis that include epi thelial differentiation and branching morphogenesis
TEAD4 NM_003213 TEA domain family, member 4 EFTR-2, RTEF1, TCF13L1, TEF-3, TEF3, TEFR-1, hRTEF-1B Binds specifically and noncooperatively to the Sph and GT-IIC “enhansons” (5′GTGGAATGT-3′) and activates transcription
TGFBR3 NM_001195683 Transforming growth factor β receptor III BGCAN, β-glycan Binds to TGF-β
TGIF2 NM_001199513 TGFB-induced factor homeobox 2 Transcriptional repressor. Probably represses tran scription via the recruitment of HDAC proteins
TIAL1 NM_001033925 TIA1 cytotoxic granule-associated RNA binding protein-like 1 TCBP, TIAR RNA-binding protein. Possesses nucleolytic activity against cytotoxic lymphocyte target cells May be involved in apoptosis
TM9SF3 NM_020123 Transmembrane 9 superfamily member 3 RP11-34E5.1, EP70-P-iso, SMBP
TMED4 NM_182547 Transmembrane emp24 protein transport domain containing 4 ERS25, HNLF Involved in endoplasmic reticulum stress response. May play a role in the regulation of heat-shock response and apoptosis
TMEM132B NM_001286219 Transmembrane protein 132B
TMEM14A NM_014051 Transmembrane protein 14A PTD011, C6orf73
TMEM192 NM_001100389 Transmembrane protein 192
TMEM257 NM_004709 Transmembrane protein 257 CXorf1
TMEM45A NM_018004 Transmembrane protein 45A DERP7
TMEM64 NM_001008495 Transmembrane protein 64
TMPRSS11A NM_001114387 Transmembrane protease, serine 11A ECRG1 Probable serine protease, which may play a role in cellular senescence
TNIP1 NM_001252385 TNFAIP3 interacting protein 1 ABIN-1, NAF1, VAN, nip40-1 Interacts with zinc finger protein A20/TNFAIP3 and inhibits TNF-induced NF-κB-dependent gene expression by interfering with an RIP-or TRAF2-mediated transactivation signal
TRIM2 NM_001130067 Tripartite motif containing 2 CMT2R, RNF86 May contribute to the alteration of neural cellular mechanisms
TSHR NM_000369 Thyroid stimulating hormone receptor CHNG1, LGR3, hTSHR-I Receptor for thyrothropin. Plays a central role in controlling thyroid cell metabolism Yes
TUSC1 NM_001004125 Tumor suppressor candidate 1 TSG-9, TSG9
UBA2 NM_005499 Ubiquitin-like modifier activating enzyme 2 HRIHFB2115, ARX, SAE2 The dimeric enzyme acts as a E1 ligase for SUMO1, SUMO2, SUMO3, and probably SUMO4
UCHL1 NM_004181 Ubiquitin carboxyl-terminal esterase L1 HEL-117, NDGOA, PARK5, PGP 9.5, PGP9.5, PGP95, Uch-L1 Ubiquitin-protein hydrolase involved both in the processing of ubiquitin precursors and of ubiquitinated proteins
UGT3A1 NM_001171873 UDP glycosyltransferase 3 family, polypeptide A1 UDP-glucuronosyltransferases catalyze phase II biotransformation reactions
USP28 NM_001301029 Ubiquitin specific peptidase 28 Deubiquitinase involved in DNA damage response checkpoint and MYC proto-oncogene stability
WNT16 NM_016087 Wingless-type MMTV integration site family, member 16 Ligand for members of the Frizzled family of seven transmembrane receptors
WNT2 NM_003391 Wingless-type MMTV integration site family, member 2 INT1L1, IRP Ligand for members of the Frizzled family of seven transmembrane receptors
WNT3A NM_033131 Wingless-type MMTV integration site family, member 3A Ligand for members of the Frizzled family of seven transmembrane receptors
XIAP NM_001167 X-linked inhibitor of apoptosis RP1-315G1.5, API3, BIRC4, IAP-3, ILP1, MIHA, XLP2, hIAP-3, hIAP3 Apoptotic suppressor
YOD1 NM_001276320 YOD1 deubiquitinase RP11-164O23.1, DUBA8, OTUD2, PRO0907 May play an important regulatory role at the level of protein turnover, by preventing degradation
ZEB2 NM_001171653 Zinc finger E-box binding homeobox 2 HRIHFB2411, HSPC082, SIP-1, SIP1, SMADIP1, ZFHX1B Transcriptional inhibitor that binds to DNA sequence 5′-CACCT-3′ in different promoters Represses transcription of E-cadherin
ZFP36L2 NM_006887 Zinc finger protein 36 homolog BRF2, ERF-2, ERF2, RNF162C, TIS11D Probable regulatory protein involved in regulating the response to growth factors
ZNF12 NM_006956 Zinc finger protein 12 GIOT-3, HZF11, KOX3, ZNF325 May be involved in transcriptional regulation
ZNF148 NM_021964 Zinc finger protein 148 BERF-1, BFCOL1, HT-β, ZBP-89, ZFP148, pHZ-52 Involved in transcriptional regulation
ZNF25 NM_145011 Zinc finger protein 25 KOX19, Zfp9 May be involved in transcriptional regulation
ZNF35 NM_003420 Zinc finger protein 35 HF.10, HF10, Zfp105 May be involved in transcriptional regulation
ZNF350 NM_021632 Zinc finger protein 350 ZBRK1, ZFQR Transcriptional repressor
ZNF426 NM_001300883 Zinc finger protein 426 May be involved in transcriptional regulation
ZNF445 NM_181489 Zinc finger protein 445 ZKSCAN15, ZNF168, ZSCAN47 May be involved in transcriptional regulation
ZNF558 NM_144693 Zinc finger protein 558 May be involved in transcriptional regulation
ZNF562 NM_001130031 Zinc finger protein 562 May be involved in transcriptional regulation
ZNF594 NM_032530 Zinc finger protein 594 hCG_1775942 May be involved in transcriptional regulation
ZNF652 NM_001145365 Zinc finger protein 652 Functions as a transcriptional repressor
ZNF763 NM_001012753 Zinc finger protein 763 ZNF, ZNF440L May be involved in transcriptional regulation

Abbreviations: CLL, chronic lymphocytic leukemia; HLA, human leukocyte antigen; IGF, insulin-like growth factor; IL, interleukin; mRNA, messenger RNA; NK cells, natural killer cells; ssDNA, single-stranded DNA; TGF, transforming growth factor; TNF, tumor necrosis factor; UV, ultraviolet.

As shown in Table 9, our DAVID analysis showed that there were 20 functional clusters that were identified to be enriched with an enrichment score >1.0 in the target list of hsa-miR-181a-5p, based on miRTarBase. The functions of these clusters involved negative regulation of transcription, negative regulation of gene expression, negative regulation of nucleobase, nucleoside, nucleotide, and nucleic acid metabolic processes, negative regulation of nitrogen compound metabolic process, negative regulation of macromolecule biosynthetic process, negative regulation of cellular biosynthetic process, negative regulation of bio-synthetic process, regulation of phosphorylation, regulation of phosphate metabolic process, lung development, respiratory tube development, positive regulation of transcription, positive regulation of gene expression, mesenchymal cell differentiation and development, negative regulation of apoptosis and programmed cell death, the insulin-like growth factor (IGF)-1 signaling pathway, interleukin (IL)-6 signaling pathway, insulin signaling pathway, Ubl conjugation pathway, modification-dependent macromolecule catabolic process, and modification-dependent protein catabolic process.

Table 9.

The top enriched clusters (enrich score >1) by DAVID for the targets of hsa-miR-181a-5p from miRTarBase 4.0

Category Term Gene count P-value FDR
Annotation cluster 1 Enrichment score: 2.9
GOTERM_BP_FAT Negative regulation of transcription 17 3.10E-04 7.80E-02
GOTERM_BP_FAT Negative regulation of gene expression 17 8.50E-04 9.90E-02
GOTERM_BP_FAT Negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process 17 1.00E-03 1.00E-01
GOTERM_BP_FAT Negative regulation of nitrogen compound metabolic process 17 1.20E-03 1.00E-01
GOTERM_BP_FAT Negative regulation of macromolecule biosynthetic process 17 2.00E-03 1.20E-01
GOTERM_BP_FAT Negative regulation of cellular biosynthetic process 17 2.50E-03 1.20E-01
GOTERM_BP_FAT Negative regulation of biosynthetic process 17 3.10E-03 1.20E-01
Annotation cluster 2 Enrichment score: 2.86
GOTERM_BP_FAT Regulation of phosphorylation 16 1.10E-03 1.00E-01
GOTERM_BP_FAT Regulation of phosphorus metabolic process 16 1.60E-03 1.10E-01
GOTERM_BP_FAT Regulation of phosphate metabolic process 16 1.60E-03 1.10E-01
Annotation cluster 3 Enrichment score: 2.66
GOTERM_BP_FAT Lung development 7 1.80E-03 1.10E-01
GOTERM_BP_FAT Respiratory tube development 7 2.10E-03 1.20E-01
GOTERM_BP_FAT Respiratory system development 7 2.80E-03 1.20E-01
Annotation cluster 4 Enrichment score: 2.38
GOTERM_BP_FAT Positive regulation of transcription, DNA-dependent 16 1.30E-03 1.00E-01
GOTERM_BP_FAT Positive regulation of transcription 16 6.50E-03 1.70E-01
GOTERM_BP_FAT Positive regulation of gene expression 16 8.50E-03 1.80E-01
Annotation cluster 5 Enrichment score: 2.37
GOTERM_BP_FAT Mesenchymal cell differentiation 5 4.20E-03 1.50E-01
GOTERM_BP_FAT Mesenchymal cell development 5 4.20E-03 1.50E-01
GOTERM_BP_FAT Mesenchyme development 5 4.50E-03 1.50E-01
Annotation cluster 6 Enrichment score: 2.16
GOTERM_BP_FAT Negative regulation of apoptosis 12 6.40E-03 1.70E-01
GOTERM_BP_FAT Negative regulation of programmed cell death 12 7.10E-03 1.70E-01
GOTERM_BP_FAT Negative regulation of cell death 12 7.20E-03 1.70E-01
Annotation cluster 7 Enrichment score: 2.12
BIOCARTA IGF-1 signaling pathway 4 7.60E-03 3.80E-01
BIOCARTA IL-6 signaling pathway 4 7.60E-03 3.80E-01
BIOCARTA Insulin signaling pathway 4 7.60E-03 3.80E-01
Annotation cluster 8 Enrichment score: 2.03
SP_PIR_KEYWORDS Ubl conjugation pathway 15 2.80E-03 9.30E-02
GOTERM_BP_FAT Modification-dependent macromolecule catabolic process 15 1.70E-02 2.40E-01
GOTERM_BP_FAT Modification-dependent protein catabolic process 15 1.70E-02 2.40E-01
Annotation cluster 9 Enrichment score: 2
GOTERM_CC_FAT Intracellular organelle lumen 33 7.40E-03 3.90E-01
GOTERM_CC_FAT Organelle lumen 33 1.00E-02 4.20E-01
GOTERM_CC_FAT Membrane-enclosed lumen 33 1.30E-02 4.50E-01
Annotation cluster 10 Enrichment score: 1.9
GOTERM_BP_FAT Proteolysis involved in cellular protein catabolic process 16 1.10E-02 2.00E-01
GOTERM_BP_FAT Cellular protein catabolic process 16 1.20E-02 2.00E-01
GOTERM_BP_FAT Protein catabolic process 16 1.50E-02 2.20E-01
Annotation cluster 11 Enrichment score: 1.86
INTERPRO Zinc finger, C2H2-type 19 7.50E-03 6.70E-01
INTERPRO Zinc finger, C2H2-like 19 8.80E-03 6.30E-01
SMART Zinc finger_C2H2 19 4.00E-02 9.00E-01
Annotation cluster 12 Enrichment score: 1.76
GOTERM_BP_FAT Regulation of apoptosis 19 1.60E-02 2.30E-01
GOTERM_BP_FAT Regulation of programmed cell death 19 1.80E-02 2.40E-01
GOTERM_BP_FAT Regulation of cell death 19 1.80E-02 2.40E-01
Annotation cluster 13 Enrichment score: 1.75
GOTERM_BP_FAT Determination of left/right symmetry 4 1.70E-02 2.40E-01
GOTERM_BP_FAT Determination of symmetry 4 1.80E-02 2.40E-01
GOTERM_BP_FAT Determination of bilateral symmetry 4 1.80E-02 2.40E-01
Annotation cluster 14 Enrichment score: 1.73
GOTERM_BP_FAT Neuron projection morphogenesis 9 6.50E-03 1.70E-01
GOTERM_BP_FAT Cell projection morphogenesis 9 1.40E-02 2.20E-01
GOTERM_BP_FAT Cell part morphogenesis 9 1.80E-02 2.40E-01
GOTERM_BP_FAT Neuron projection development 9 1.80E-02 2.40E-01
GOTERM_BP_FAT Neuron development 9 7.40E-02 4.90E-01
Annotation cluster 15 Enrichment score: 1.49
INTERPRO Homeobox, conserved site 8 2.40E-02 7.40E-01
INTERPRO Homeobox 8 2.50E-02 7.20E-01
SMART HOX 8 5.50E-02 7.30E-01
Annotation cluster 16 Enrichment score: 1.38
INTERPRO Wnt superfamily 3 2.20E-02 7.60E-01
INTERPRO Secreted growth factor Wnt protein 3 2.20E-02 7.60E-01
INTERPRO Secreted growth factor Wnt protein, conserved site 3 2.20E-02 7.60E-01
PIR_SUPERFAMILY PIRSF001784: int-1 transforming protein 3 2.60E-02 7.60E-01
GOTERM_BP_FAT Wnt receptor signaling pathway, calcium modulating pathway 3 3.00E-02 3.10E-01
SMART WNT1 3 3.10E-02 9.70E-01
KEGG_PATHWAY Basal cell carcinoma 3 1.90E-01 6.00E-01
KEGG_PATHWAY Hedgehog signaling pathway 3 2.00E-01 6.00E-01
Annotation cluster 17 Enrichment score: 1.26
GOTERM_BP_FAT Positive regulation of apoptosis 11 5.30E-02 4.30E-01
GOTERM_BP_FAT Positive regulation of programmed cell death 11 5.50E-02 4.40E-01
GOTERM_BP_FAT Positive regulation of cell death 11 5.60E-02 4.40E-01
Annotation cluster 18 Enrichment Score: 1.22
UP_SEQ_FEATURE Domain: F-box 4 5.30E-02 9.50E-01
INTERPRO Cyclin-like F-box 4 5.40E-02 8.70E-01
SMART FBOX 4 7.90E-02 8.00E-01
Annotation cluster 19 Enrichment score: 1.05
BIOCARTA Cadmium induces DNA synthesis and proliferation in macrophages 3 3.20E-02 7.40E-01
BIOCARTA IL-3 signaling pathway 3 3.70E-02 6.90E-01
BIOCARTA NGF pathway 3 5.30E-02 7.40E-01
BIOCARTA EPO signaling pathway 3 5.90E-02 7.10E-01
BIOCARTA Inhibition of cellular proliferation by Gleevec 3 6.50E-02 6.90E-01
BIOCARTA TPO signaling pathway 3 7.10E-02 6.80E-01
BIOCARTA Signaling pathway from G-protein families 3 7.80E-02 6.70E-01
BIOCARTA IL-2 signaling pathway 3 7.80E-02 6.70E-01
BIOCARTA PDGF signaling pathway 3 1.00E-01 7.40E-01
BIOCARTA BCR signaling pathway 3 1.10E-01 7.40E-01
BIOCARTA EGF signaling pathway 3 1.10E-01 7.40E-01
BIOCARTA Fc epsilon receptor I signaling in mast cells 3 1.40E-01 7.70E-01
BIOCARTA T-cell receptor signaling pathway 3 1.70E-01 7.90E-01
BIOCARTA MAP kinase signaling pathway 3 5.40E-01 1.00E+00
Annotation cluster 20 Enrichment score: 1.03
UP_SEQ_FEATURE Short sequence motif: BH3 3 1.70E-02 7.10E-01
INTERPRO Apoptosis regulator Bcl-2, BH 3 2.90E-02 7.30E-01
SMART Bcl 3 4.00E-02 7.90E-01
GOTERM_CC_FAT Mitochondrial outer membrane 3 2.80E-01 9.50E-01
GOTERM_CC_FAT Organelle outer membrane 3 3.40E-01 9.60E-01
GOTERM_CC_FAT Outer membrane 3 3.60E-01 9.60E-01

Abbreviations: Bcl, B-cell lymphoma; BCR, B-cell receptor; DAVID, Database for Annotation, Visualization and Integrated Discovery; EGF, epidermal growth factor; EPO, erythropoietin; FDR, false discovery rate; IGF, insulin-like growth factor; IL, interleukin; NGF, nerve growth factor; PDGF, platelet-derived growth factor; TPO, thrombopoietin.

Furthermore, our DAVID analysis revealed that there were 14 KEGG pathways significantly enriched in the target list of hsa-miR-181a-5p, based on miRTarBase (Table 10). These pathways included pathways in cancer pathways (Figure 5), the MAPK signaling pathway (Figure 6), melanogenesis, chronic myeloid leukemia, small cell lung cancer, prostate cancer, dorsoventral axis formation, thyroid cancer, the Notch signaling pathway (Figure 7), long-term depression, renal cell carcinoma, the B cell receptor signaling pathway, vascular endothelial growth factor (VEGF) signaling pathway (Figure 8), and prion diseases.

Table 10.

The KEGG pathways by DAVID for the target list of hsa-miR-181a-5p based on miRTarBase

Signaling pathway Gene count % P-value FDR
Pathways in cancer 14 6.2 8.70E-04 8.20E-02
MAPK signaling pathway 9 4 4.20E-02 3.70E-01
Melanogenesis 7 3.1 3.20E-03 1.40E-01
Chronic myeloid leukemia 5 2.2 2.40E-02 3.80E-01
Small cell lung cancer 5 2.2 3.50E-02 3.90E-01
Prostate cancer 5 2.2 4.20E-02 4.10E-01
Dorsoventral axis formation 4 1.8 5.60E-03 1.70E-01
Thyroid cancer 4 1.8 8.60E-03 1.90E-01
Notch signaling pathway 4 1.8 3.10E-02 4.10E-01
Long-term depression 4 1.8 8.10E-02 5.60E-01
Renal cell carcinoma 4 1.8 8.40E-02 5.40E-01
B-cell receptor signaling pathway 4 1.8 9.80E-02 5.40E-01
VEGF signaling pathway 4 1.8 9.80E-02 5.40E-01
Prion diseases 3 1.3 9.40E-02 5.50E-01

Abbreviations: DAVID, Database for Annotation, Visualization and Integrated Discovery; FDR, false discovery rate; KEGG, Kyoto Encyclopedia of Genes and Genomes; VEGF, vascular endothelial growth factor.

Figure 5.

Figure 5

Cancer pathways in the target list of hsa-miR-181a-5p based on miRTarBase 4.0.

Notes: Several important oncogenes and tumor suppressors are likely regulated by hsa-miR-181a-5p (marked with a red star), including ATM, p300, p27, GADD45, and cyclin D1. These genes play an important role in the regulation of angiogenesis, cell proliferation, apoptosis, and metastasis.

Figure 6.

Figure 6

MAPK signaling pathway in the target list of hsa-miR-181a-5p based on miRTarBase 4.0.

Notes: hsa-miR-181a-5p can regulate MAPK signaling pathways. The MAPK/Erk signaling cascade is activated by a wide variety of receptors involved in growth and differentiation, including receptor tyrosine kinases, integrins, and ion channels.111 The specific components of the cascade vary greatly among different stimuli, but the architecture of the pathway usually includes a set of adaptors (Shc, GRB2, Crk, etc) linking the receptor to a guanine nucleotide exchange factor (SOS, C3G, etc) transducing the signal to small GTP-binding proteins (Ras, Rap1), which in turn activate the core unit of the cascade composed of a MAPKKK (Raf), a MAPKK (MEK1/2), and MAPK (Erk). An activated Erk dimer can regulate targets in the cytosol and also translocates to the nucleus, where it phosphorylates a variety of transcription factors regulating gene expression. p38 MAPKs (α, β, γ, and δ) are members of the MAPK family that are activated by a variety of environmental stresses and inflammatory cytokines. As with other MAPK cascades, the membrane-proximal component is a MAPKKK, typically a MEKK or a mixed lineage kinase (MLK). The MAPKKK phosphorylates and activates MKK3/6, the p38 MAPK kinases.111 MKK3/6 can also be activated directly by ASK1, which is stimulated by apoptotic stimuli. p38 MAPK is involved in regulation of HSP27, MAPKAPK-2 (MK2), MAPKAPK-3 (MK3), and several transcription factors, including ATF-2, Stat1, the Max/Myc complex, MEF-2, Elk-1, and indirectly, CREB via activation of MSK1.

Figure 7.

Figure 7

Notch signaling pathway in the target list of hsa-miR-181a-5p based on miRTarBase 4.0.

Notes: hsa-miR-181a-5p can regulate the function of the Notch signaling pathway. Notch signaling is an evolutionarily conserved pathway in multicellular organisms that regulates cell fate determination during development and maintains adult tissue homeostasis. In mammalian signal-sending cells, members of the Delta-like (DLL1, DLL3 & DLL4) and the Jagged (JAG1 & JAG2) families serve as ligands for Notch signaling receptors.112 Upon ligand binding, the NECD is cleaved away (S2 cleavage) from the TM-NICD domain by TACE (TNF-α ADAM metalloprotease converting enzyme). The NECD remains bound to the ligand, and this complex undergoes endocytosis/recycling within the signal-sending cell in a manner dependent on ubiquitination by Mib. In the signal-receiving cell, γ-secretase (also involved in Alzheimer’s disease) releases the NICD from the TM (S3 cleavage), which allows for nuclear translocation where it associates with the CSL (CBF1/Su(H)/Lag-1) transcription factor complex, resulting in subsequent activation of the canonical Notch target genes, including Myc, p21, and the HES-family members. Abnormal expression of Notch and related proteins has been observed in EC, and the Notch signaling pathway may play a role in the development, growth, and metastasis of EC.113116 Targets of hsa-miR-181a-5p are marked with a red star.

Abbreviations: EC, endometrial cancer; TNF, tumor necrosis factor.

Figure 8.

Figure 8

VEGF signaling pathway in the target list of hsa-miR-181a-5p based on miRTarBase 4.0.

Notes: hsa-miR-181a-5p can regulate the VEGF signaling pathway. VEGF is an important signaling protein involved in both vasculogenesis and angiogenesis. All members of the VEGF family stimulate cellular responses by binding to tyrosine kinase receptors (the VEGFRs) on the cell surface, causing them to dimerize and become activated through transphosphorylation. This triggers a signaling cascade that activates several signaling pathways, such as PI3K/Akt, Erk1/2, Smad, and Notch, and results in endothelial cell proliferation and migration. A number of studies have shown that VEGF and its associated proteins are aberrant in EC.117122 These proteins represent useful targets in the treatment of EC.

Abbreviations: EC, endometrial cancer; VEGF, vascular endothelial growth factor.

Combined validated targets of hsa-miR-181a-5p, based on both TarBase 6.0 and miRTarBase 4.0

When we combined the target lists of hsa-miR-181a-5p with experimental evidence from both TarBase 6.0 and miRTarBase 4.0, there were 313 validated targets for hsa-miR-181a-5p (Table 11). As shown in Table 12, our DAVID analysis showed that there were 26 functional clusters that were identified to be enriched with an enrichment score >1.0 in the combined target list of hsa-miR-181a-5p, based on both TarBase 6.0 and miRTarBase 4.0. The functions of these clusters involved response to hormone stimulus, response to endogenous stimulus, response to organic substance, negative regulation of apoptosis, negative and positive regulation of programmed cell death, negative and positive regulation of cell death, the DNA damage checkpoint, DNA integrity checkpoint, DNA damage response and signal transduction, the cell cycle checkpoint, response to DNA damage stimulus, bladder cancer, endometrial cancer (Figure 9), non-small-cell lung cancer, acute myeloid leukemia, glioma, melanoma, developmental growth, cell fate commitment, tissue morphogenesis, positive regulation of macromolecule biosynthetic process, positive regulation of cellular biosynthetic process, positive regulation of biosynthetic process, regulation of phosphorylation, regulation of phosphate metabolic process, regulation of phosphorus metabolic process, positive regulation of transcription, positive regulation of gene expression, positive regulation of protein kinase activity, positive regulation of kinase activity, positive regulation of transferase activity, regulation of protein kinase activity, regulation of kinase activity, positive regulation of cellular protein metabolic process, positive regulation of protein metabolic process, branching morphogenesis of a tube, positive regulation of cell development, morphogenesis of a branching structure, tube morphogenesis, regulation of cell development, neuron projection morphogenesis, cell projection morphogenesis, neuron projection development, cell part morphogenesis, neuron development, cell morphogenesis, cell projection organization, cellular component morphogenesis, neuron differentiation, IGF-1 signaling pathway, IL6 signaling pathway, insulin signaling pathway, signaling of hepatocyte growth factor receptor, embryonic appendage morphogenesis, embryonic limb morphogenesis, limb morphogenesis, appendage morphogenesis, limb development, appendage development, embryonic morphogenesis, response to ethanol, response to metal ion, response to inorganic substance, response to drug, response to estrogen stimulus, positive regulation of protein modification process, regulation of protein modification process, protein amino acid phosphorylation, phosphorylation, phosphate metabolic process, phosphorus metabolic process, cell aging, negative regulation of neuron apoptosis, aging, actin cytoskeleton organization, actin filament-based process, membrane organization, membrane insoluble fraction, Ras protein signal transduction, long-term depression, the B cell receptor signaling pathway, VEGF signaling pathway, Fc epsilon RI signaling pathway, ErbB signaling pathway, gap junction, gonadotropin-releasing hormone (GnRH) signaling pathway, T cell receptor signaling pathway, insulin signaling pathway, small GTPase-mediated signal transduction, chemokine signaling pathway, regulation of actin cytoskeleton, MAPK signaling pathway, axonogenesis, cell morphogenesis involved in neuron differentiation, cell morphogenesis involved in differentiation, nucleoplasm, nuclear lumen, intracellular organelle lumen, organelle lumen, membrane-enclosed lumen, hemopoiesis, hemopoietic or lymphoid organ development, immune system development, and transcription regulation (Table 12).

Table 11.

Combined targets of hsa-miR-181a-5p with experimental evidence based on both TarBase and miRTarBase 4.0

Gene symbol Full name Alias Function
ACOT12 Acyl-CoA thioesterase 12 CACH-1, Cach, STARD15, THEAL Hydrolyzes acetyl-CoA to acetate and CoA
AFTPH Aftiphilin Nbla10388 May play a role in membrane trafficking
AKAP12 A kinase anchor protein 12 AKAP250, SSeCKS Anchoring protein that mediates the subcellular compartmentation of PKA and PKC
ALG10B α-1,2-Glucosyltransferase ALG10, KCR1 Transfers glucose from dolichyl phosphate glucose onto the lipid-linked oligosaccharide Glc(2)Man(9)GlcNAc(2)-PP-Dol
AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 RP13-360B22.1, AMMERC1
ANKRD1 Ankyrin repeat domain 1 (cardiac muscle) ALRP, C-193, CARP, CVARP, MCARP, bA320F15.2 Plays an important role in endothelial cell activation
ANKRD13C Ankyrin repeat domain 13C RP4-677H15.5, dJ677H15.3
AP1M1 Adaptor-related protein complex 1, mu 1 subunit AP47, CLAPM2, CLTNM, MU-1A Subunit of clathrin-associated adaptor protein complex 1 that plays a role in protein sorting in the trans-Golgi network and endosomes
ARF6 ADP-ribosylation factor 6 Involved in protein trafficking
ARHGAP11A Rho GTPase activating protein 11A RP11-1000B6.5, GAP (1–12) GTPase activator activity
ARHGAP12 Rho GTPase activating protein 12 GTPase activator for the Rho-type GTPases, by converting them to an inactive GDP-bound state
ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 AIP1, ARL6IP, ARMER, SPG61 May be involved in protein transport, membrane trafficking, or cell signaling during hematopoietic maturation
ARL6IP6 ADP-ribosylation factor-like 6 interacting protein 6 RP23-265N10.1, 2310057C01Rik, 2610529A11Rik, Aip-6 May be involved in protein transport, membrane trafficking, or cell signaling during hematopoietic maturation
ATF7IP2 Activating transcription factor 7 interacting protein 2 MCAF2 Recruiter that couples transcriptional factors to general transcription apparatus and thereby modulates transcription regulation and chromatin formation
ATG10 Autophagy related 10 PP12616, APG10, APG10L, pp12616 Plays a role in autophagy
ATM ATM serine/threonine kinase AT1, ATA, ATC, ATD, ATDC, ATE, TEL1, TELO1 Serine/threonine protein kinase
ATP6V0E1 ATPase, H+ transporting, lysosomal 9 kDa, V0 subunit e1 ATP6H, ATP6V0E, M9.2, Vma21, Vma21p Vacuolar ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells
ATP8A1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 ATPASEII, ATPIA, ATPP2 May play a role in the transport of aminophospholipids from the outer to the inner leaflet of various membranes and the maintenance of asymmetric distribution of phospholipids
BAG2 BCL2-associated athanogene 2 RP3-496N17.2, BAG-2, dJ417I1.2 Inhibits the chaperone activity of HSP70/HSC70 by promoting substrate release
BCL2 B-cell CLL/lymphoma 2 Bcl-2, PPP1R50 Suppresses apoptosis
BCL2L11 BCL2-like 11 BAM, BIM, BOD Induces apoptosis
BDNF Brain-derived neurotrophic factor ANON2, BULN2 Promotes the survival of neuronal populations
BPGM 2,3-bisphosphoglycerate mutase DPGM Plays a major role in regulating hemoglobin oxygen affinity
BRCA1 Breast cancer 1, early onset BRCAI, BRCC1, BROVCA1, IRIS, PNCA4, PPP1R53, PSCP, RNF53 Plays a central role in DNA repair by facilitating cellular response to DNA repair
BRIX1 Biogenesis of ribosomes, homolog (S. cerevisiae) BRIX, BXDC2 Required for biogenesis of the 60S ribosomal subunit
BRMS1L Breast cancer metastasis-suppressor 1-like BRMS1 Involved in the HDAC1-dependent transcriptional repression activity
BTBD3 BTB (POZ) domain containing 3 RP4-742J24.3, dJ742J24.1 Acts as a key regulator of dendritic field orientation during the development of sensory cortex
C1orf109 Chromosome 1 open reading frame 109
C1orf43 Chromosome 1 open reading frame 43 HSPC012, NICE-3, NS5ATP4, S863-3
C1QTNF9 C1q and tumor necrosis factor related protein 9 9130217G22Rik, CTRP9, Ciqtnf9 Activates AMPK, AKT, and p44/42 MAPK signaling pathways
C8A Complement component 8, α polypeptide C8 is a constituent of the membrane attack complex
CBX3 Chromobox homolog 3 HECH, HP1-GAMMA, HP1Hs-γ Involved in transcriptional silencing in heterochromatin-like complexes
CCDC6 Coiled-coil domain containing 6 D10S170, H4, PTC, TPC, TST1 Functions as a tumor suppressor
CCDC82 Coiled-coil domain containing 82 HT025, HSPC048
CCND1 Cyclin D1 BCL1, D11S287E, PRAD1, U21B31 Essential for the control of the cell cycle at the G1/S (start) transition
CCNG1 Cyclin G1 CCNG May play a role in growth regulation
CD46 CD46 molecule, complement regulatory protein AHUS2, MCP, MIC10, TLX, TRA2.10 Acts as a cofactor for complement factor I
CDKN1B Cyclin-dependent kinase inhibitor 1B (p27, Kip1) CDKN4, KIP1, MEN1B, MEN4, P27KIP1 Important regulator of cell cycle progression
CDX2 Caudal type homeobox 2 CDX-3, CDX3 Involved in the transcriptional regulation of multiple genes expressed in the intestinal epithelium
CEP97 Centrosomal protein 97 kDa 2810403B08Rik, LRRIQ2 Collaborates with cep110, being involved in the suppression of a cilia assembly program
CFI Complement factor I AHUS3, ARMD13, C3BINA, C3b-INA, FI, IF, KAF Responsible for cleaving the α-chains of C4b and C3b, in the presence of the cofactors C4-binding protein and factor H, respectively
CHD1 Chromodomain helicase DNA binding protein 1 Sequence-selective DNA-binding protein
CHL1 Cell adhesion molecule L1-like CALL, L1CAM2 Plays a role in nervous system development and in synaptic plasticity
CHRFAM7A CHRNA7 (cholinergic receptor, nicotinic, α 7, exons 5–10) and FAM7A (family with sequence similarity 7A, exons A–E) fusion CHRNA7, CHRNA7-DR1, D-10 Extracellular ligand-gated ion channel activity
CLUAP1 Clusterin associated protein 1 CFAP22, FAP22 May play a role in cell proliferation or apoptosis
COL27A1 Collagen, type XXVII, α 1 RP11-82I1.1 Plays a role during the calcification of cartilage and the transition of cartilage to bone
COPS2 COP9 signalosome subunit 2 ALIEN, CSN2, SGN2, TRIP15 Involved in various cellular and developmental processes
CST5 Cystatin D Cysteine proteinase inhibitor
CXorf1 Transmembrane protein 257 CXorf1
D3R Dopamine receptor D3 DRD3; D3DR; ETM1; FET1 Inhibits adenylyl cyclase through inhibitory G-proteins, plays a role in cognitive and emotional functions
DCP2 Decapping mRNA 2 NUDT20 Necessary for the degradation of mRNAs
DCST1 DC-STAMP domain containing 1 RP11-307C12.10-003 Protein and zinc ion binding
DDIT4 DNA-damage-inducible transcript 4 RP11-442H21.1, Dig2, REDD-1, REDD1 Inhibits cell growth by regulating the frap1 pathway upstream of the tsc1-tsc2 complex and downstream of Akt1
DDX27 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 HSPC259, DRS1, Drs1p, PP3241, RHLP, dJ686N3.1 Probable ATP-dependent RNA helicase
DDX3X DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked DBX, DDX14, DDX3, HLP2 ATP-dependent RNA helicase
DNAJC7 DnaJ (HSP40) homolog, subfamily C, member 7 DJ11, DJC7, TPR2, TTC2 Acts as co-chaperone regulating the molecular chaperones HSP70 and HSP90 in folding of steroid receptors
DSCR8 Down syndrome critical region gene 8 C21orf65, CT25.1a, CT25.1b, MMA-1, MMA-1a, MMA-1b, MMA1, MTAG2
DUSP5 Dual specificity phosphatase 5 DUSP, HVH3 Displays phosphatase activity toward several substrates
DUSP6 Dual specificity phosphatase 6 HH19, MKP3, PYST1 Inactivates MAP kinases
EIF1 Eukaryotic translation initiation factor 1 A121, EIF-1A, ISO1, SUI1, EIF1 Necessary for scanning and involved in initiation site selection
EIF2C1 Argonaute RISC catalytic component 1 RP4-789D17.1, EIF2C, AGO1, GERP95, Q99 Required for RNA-mediated gene silencing
EIF2C3 Argonaute RISC catalytic component 3 AGO3 Required for RNA-mediated gene silencing
ELAVL1 ELAV like RNA binding protein 1 ELAV1, HUR, Hua, MelG Binds avidly to the AU-rich element in FOS and IL3 mRNAs
ENAH Enabled homolog RP11-496N12.7, ENA, MENA, NDPP1 Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity
EP300 E1A binding protein p300 RP1-85F18.1, KAT3B, RSTS2, p300 Functions as HAT and regulates transcription via chromatin remodeling
EPHA5 EPH receptor A5 CEK7, EHK-1, EHK1, EK7, HEK7, TYRO4 Receptor for members of the ephrin-A family
ESR1 Estrogen receptor 1 RP1-130E4.1, ER, ESR, ESRA, ESTRR, Era, NR3A1 Nuclear hormone receptor
EYA4 EYA transcriptional coactivator and phosphatase 4 RP11-704J17.4, CMD1J, DFNA10 Tyrosine phosphatase that specifically dephosphorylates “Tyr-142” of histone H2AX (H2AXY142ph)
FAM160A2 Family with sequence similarity 160, member A2 C11orf56
FAM222B Family with sequence similarity 222, member B C17orf63
FAM47B Family with sequence similarity 47, member B RP13-520K9.1
FAT1 FAT atypical cadherin 1 CDHF7, CDHR8, FAT, ME5, hFat1 Could function as a cell-adhesion protein
FBXO11 F-box protein 11 UG063H01, FBX11, PRMT9, UBR6, VIT1 Substrate recognition component of the SCF E3 ubiquitin-protein ligase complex
FBXO28 F-box protein 28 CENP-30, Fbx28 Probably recognizes and binds to some phosphorylated proteins and promotes their ubiquitination and degradation
FBXO33 F-box protein 33 BMND12, Fbx33, c14_5247 Substrate recognition component of the SCF E3 ubiquitin-protein ligase complex, which mediates the ubiquitination and subsequent proteasomal degradation of target proteins
FBXO34 F-box protein 34 CGI-301, Fbx34 Substrate-recognition component of the SCF E3 ubiquitin ligase complex
FKBP10 FK506 binding protein 10 PSEC0056, FKBP65, OI11, OI6, PPIASE, hFKBP65 PPIases accelerate the folding of proteins during protein synthesis
FKBP4 FK506 binding protein 4 FKBP51, FKBP52, FKBP59, HBI, Hsp56, PPIase, p52 May play a role in the intracellular trafficking of heterooligomeric forms of steroid hormone receptors
FKBP7 FK506 binding protein 7 UNQ670/PRO1304, FKBP23, PPIase PPIases accelerate the folding of proteins during protein synthesis
FOS FBJ murine osteosarcoma viral oncogene homolog AP-1, C-FOS, p55 Nuclear phosphoprotein, which forms a tight but noncovalently linked complex with the JUN/AP-1 transcription factor
FRA10AC1 Fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1 PRO2972, C10orf4, F26C11.1-like, FRA10A
FSIP1 Fibrous sheath interacting protein 1 HSD10
FXYD6 FXYD domain containing ion transport regulator 6 UNQ521/PRO1056
GADD45G Growth arrest and DNA-damage-inducible, γ RP11-260L6.1, CR6, DDIT2, GADD45γ, GRP17 Involved in the regulation of growth and apoptosis
GANAB Glucosidase, α; neutral AB G2AN, GLUII Cleaves sequentially the 2 innermost α-1,3-linked glucose residues from the Glc(2)Man(9)GlcNAc(2) oligosaccharide precursor of immature glycoproteins
GATA6 GATA binding protein 6 Regulates terminal differentiation and/or proliferation
GATAD2B GATA zinc finger domain containing 2B RP11-216N14.6, MRD18, P66β, p68 Has transcriptional repressor activity
GCNT1 Glucosaminyl (N-acetyl) transferase 1, core 2 RP11-214N16.1, C2GNT, C2GNT-L, C2GNT1, G6NT, NACGT2, NAGCT2 Forms critical branches in O-glycans
GIGYF1 GRB10 interacting GYF protein 1 PP3360, GYF1, PERQ1 May act cooperatively with GRB10 to regulate tyrosine kinase receptor signaling
GNA13 G protein, α 13 G13 Modulators or transducers in various transmembrane signaling systems
GNAI3 G protein, α inhibiting activity polypeptide 3 RP5-1160K1.2, 87U6, ARCND1 G proteins are involved as modulators or transducers in various transmembrane signaling systems
GNB1 G protein, β polypeptide 1 RP1-283E3.7 A modulator or transducer in various transmembrane signaling systems
GPR137B G protein-coupled receptor 137B RP5-985L19.1, TM7SF1
GPR78 G protein-coupled receptor 78 UNQ5925/PRO19818 Orphan receptor
GPR83 G protein-coupled receptor 83 GIR, GPR72 Orphan receptor. Could be a neuropeptide y receptor
GPRIN3 GPRIN family member 3 GRIN3 May be involved in neurite outgrowth
GSTM2 Glutathione S-transferase mu 2 (muscle) GST4, GSTM-2, GTHMUS, GSTM2 Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles
H1F0 H1 histone family, member 0 H10, H1FV Histones H1 are necessary for the condensation of nucleosome chains into higher-order structures
H2AFY H2A histone family, member Y H2A.y, H2A/y, H2AF12M, H2AFJ, MACROH2A1.1, mH2A1, macroH2A1.2 Plays a central role in transcription regulation, DNA repair, DNA replication, and chromosomal stability
H3F3B H3 histone, family 3B H3.3B Plays a central role in transcription regulation, DNA repair, DNA replication, and chromosomal stability
HDAC6 Histone deacetylase 6 JM21, CPBHM, HD6, PPP1R90 Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4)
HERC3 HECT and RLD domain containing E3 ubiquitin protein ligase 3 E3 ubiquitin-protein ligase
HEY2 Hes-related family bHLH transcription factor with YRPW motif 2 RP1-293L8.3, CHF1, GRIDLOCK, GRL, HERP1, HESR2, HRT2, bHLHb32 Downstream effector of Notch signaling, which may be required for cardiovascular development
HIPK2 Homeodomain interacting protein kinase 2 PRO0593 Protein kinase acting as a corepressor of several transcription factors
HMGB2 High mobility group box 2 HMG2 Binds preferentially ssDNA and unwinds double stranded DNA
HNRNPAB Heterogeneous nuclear ribonucleoprotein A/B ABBP1, HNRPAB Binds single-stranded RNA
HNRPDL Heterogeneous nuclear ribonucleoprotein D-like HNRNP, HNRPDL, JKTBP, JKTBP2, laAUF1 Acts as a transcriptional regulator
HOOK3 Hook microtubule-tethering protein 3 HK3 Probable cytoskeletal linker protein, involved in tethering the Golgi complex to the cytoskeleton
HOXA10 Homeobox A10 HOX1, HOX1.8, HOX1H, PL Sequence-specific transcription factor
HOXA11 Homeobox A11 HOX1, HOX1I Sequence-specific transcription factor
HRAS Harvey rat sarcoma viral oncogene homolog C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-RASIDX, HAMSV1, RASH1, p21ras, HRAS Ras proteins bind GDP/GTP and possess intrinsic GTPase activity
HSD17B3 Hydroxysteroid (17-β) dehydrogenase 3 RP11-240L7.3, EDH17B3, SDR12C2 Favors the reduction of androstenedione to testosterone
HSP90B1 Heat-shock protein 90 kDa β (Grp94), member 1 ECGP, GP96, GRP94, HEL-S-125m, HEL35, TRA1 Molecular chaperone that functions in the processing and transport of secreted proteins
HSPA13 Heat-shock protein 70 kDa family, member 13 STCH Has peptide-independent ATPase activity
HSPA1B Heat-shock 70 kDa protein 1B DAAP-21F2.7, HSP70-1B, HSP70-2 Stabilizes preexistent proteins against aggregation and mediates the folding of newly translated polypeptides in the cytosol as well as within organelles
HUWE1 HECT, UBA and WWE domain containing 1 RP3-339A18.4, ARF-BP1, HECTH9, HSPC272, Ib772, LASU1, MULE, URE-B1, UREB1 E3 ubiquitin-protein ligase mediating ubiquitination and subsequent proteasomal degradation of target proteins.
ICMT Isoprenylcysteine carboxyl methyltransferase RP1-120G22.4, HSTE14, MST098, MSTP098, PCCMT, PCMT, PPMT Catalyzes the posttranslational methylation of isoprenylated C-terminal cysteine residues
IDS Iduronate 2-sulfatase MPS2, SIDS Required for the lysosomal degradation of heparan sulfate and dermatan sulfate
INCENP Inner centromere protein antigens Component of the chromosomal passenger complex, a complex that acts as a key regulator of mitosis
IQCG IQ motif containing G CFAP122, DRC9
KAT2B K(lysine) acetyltransferase 2B CAF, P/CAF, PCAF Functions as a HAT to promote transcriptional activation
KBTBD3 Kelch repeat and BTB (POZ) domain containing 3 BKLHD3
KBTBD7 Kelch repeat and BTB (POZ) domain containing 7
KCTD2 Potassium channel tetramerization domain containing 2
KCTD3 Potassium channel tetramerization domain containing 3 RP11-5F19.1, NY-REN-45
KIAA0100 KIAA0100 BCOX, BCOX1, CT101
KIAA0101 KIAA0101 L5, NS5ATP9, OEATC, OEATC-1, OEATC1, PAF, PAF15, p15(PAF), p15/PAF, p15PAF May be involved in protection of cells from UV-induced cell death
KIAA1462 KIAA1462 JCAD
KIAA2026 KIAA2026
KLF6 Kruppel-like factor 6 RP11-184A2.1, BCD1, CBA1, COPEB, CPBP, GBF, PAC1, ST12, ZF9 Plays a role in B-cell growth and development
KLHL15 Kelch-like family member 15 HEL-S-305 Probable substrate-specific adapter of an E3 ubiquitin-protein ligase complex, which mediates the ubiquitination and subsequent proteasomal degradation of target proteins
KLHL42 Kelch-like family member 42 Ctb9, KLHDC5 Substrate-specific adapter of a BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex required for mitotic progression and cytokinesis
KLRC4 Killer cell lectin-like receptor subfamily C, member 4 NKG2-F, NKG2F May play a role as a receptor for the recognition of MHC class I HLA-E molecules by NK cells
KRAS Kirsten rat sarcoma viral oncogene homolog C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS1, KRAS2, NS, NS3, RASK2, KRAS Binds GDP/GTP and possesses intrinsic GTPase activity
LAMA3 Laminin, α3 BM600, E170, LAMNA, LOCS, lama3a Binding to cells via a high-affinity receptor, mediating the attachment, migration, and organization of cells into tissues
LBR Lamin B receptor PRO0650, DHCR14B, LMN2R, PHA, TDRD18 Anchors the lamina and the heterochromatin to the inner nuclear membrane.
LCLAT1 Lysocardiolipin acyltransferase 1 UNQ1849/PRO3579, 1AGPAT8, AGPAT8, ALCAT1, HSRG1849, LYCAT, UNQ1849 Acyl-CoA: lysocardiolipin acyltransferase
LFNG LFNG O-fucosylpeptide 3-β-N- acetylglucosaminyltransferase SCDO3 Glycosyltransferase
LGALSL Lectin, galactoside-binding-like HSPC159, GRP Does not bind lactose and may not bind carbohydrates
LPGAT1 Lysophosphatidylglycerol acyltransferase 1 FAM34A, FAM34A1, NET8 Lysophoshatidylglycerol-specific acyltransferase
LRRC17 Leucine rich repeat containing 17 UNQ3076/PRO9909, P37NB Involved in bone homeostasis, acting as a negative regulator of RANKL-induced osteoclast precursor differentiation from bone marrow precursors
LRRN3 Leucine rich repeat neuronal 3 Nbla10363, FIGLER5, NLRR-3, NLRR3
LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3
MAP1B Microtubule-associated protein 1B FUTSCH, MAP5, PPP1R102 May play a role in the cytoskeletal changes that accompany neurite extension
MAP2K1 Mitogen-activated protein kinase kinase 1 CFC3, MAPKK1, MEK1, MKK1, PRKMK1 Catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases
MAZ MYC-associated zinc finger protein (purine-binding transcription factor) PUR1, Pur-1, SAF-1, SAF-2, SAF-3, ZF87, ZNF801, Zif87 May function as a transcription factor, with dual roles in transcription initiation and termination
MCL1 Myeloid cell leukemia 1 BCL2L3, EAT-ES, MCL1L, MCL1S, Mcl-1, TM, bcl2-L-3, mcl1/EAT, MCL1 Involved in the regulation of apoptosis versus cell survival, and in the maintenance of viability but not of proliferation
METAP1 Methionyl aminopeptidase 1 MAP1A, MetAP1A Removes the amino-terminal methionine from nascent proteins
MFAP3 Microfibrillar-associated protein 3 Component of the elastin-associated microfibrils
MGAT5 Mannosyl (α-1,6-)-glycoprotein β1,6-N-acetyl- glucosaminyltransferase GNT-V, GNT-VA Catalyzes the addition of N-acetylglucosamine in β1-6 linkage to the α-linked mannose of biantennary N-linked oligosaccharides
MIF Macrophage migration inhibitory factor (glycosylation-inhibiting factor) GIF, GLIF, MMIF The expression of MIF at sites of inflammation suggests a role for the mediator in regulating the function of macrophage in host defense. Also acts as a phenylpyruvate tautomerase
MOB1A MOB kinase activator 1A C2orf6, MATS1, MOB1, MOBK1B, MOBKL1B, Mob4B Activator of LATS1/2 in the Hippo signaling pathway
MOB1B MOB kinase activator 1B MATS2, MOB4A, MOBKL1A Activator of LATS1/2 in the Hippo signaling pathway
MOB3B MOB kinase activator 3B C9orf35, MOB1D, MOBKL2B May regulate the activity of kinases
MRPS14 Mitochondrial ribosomal protein S14 DJ262D12.2, HSMRPS14, MRP-S14, S14mt
MTMR12 Myotubularin related protein 12 3-PAP, PIP3AP Inactive phosphatase that plays a role as an adapter for the phosphatase myotubularin to regulate myotubularin intracellular location
MTMR3 Myotubularin related protein 3 hCG_2011013, FYVE-DSP1, ZFYVE10 Phosphatase that acts on lipids with a phosphoinositol head group
MTRR 5-methyltetrahydrofolate-homocysteine methyltransferase reductase MSR, cblE Involved in the reductive regeneration of cob(I)alamin cofactor required for the maintenance of methionine synthase in a functional state
MYO9A Myosin IXA Myosins are actin-based motor molecules with ATPase activity
Unconventional myosins serve in intracellular movements
NCAPG Non-SMC condensin I complex, subunit G CAPG, CHCG, NY-MEL-3, YCG1 Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes
ND2 NADH dehydrogenase subunit 2 Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I)
NFYB Nuclear transcription factor Y β CBF-A, CBF-B, HAP3, NF-YB Stimulates the transcription of various genes by recognizing and binding to a CCAAT motif in promoters
NKX3-2 NK3 homeobox 2 BAPX1, NKX3.2, NKX3B, SMMD Transcriptional repressor that acts as a negative regulator of chondrocyte maturation
NLK Nemo-like kinase Role in cell fate determination, required for differentiation of bone marrow stromal cells
NMRK2 Nicotinamide riboside kinase 2 ITGB1BP3, MIBP, NRK2
NOL4 Nucleolar protein 4 HRIHFB2255, CT125, NOLP
NOTCH1 Notch 1 TAN1, hN1 Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell fate determination
NOTCH2 Notch 2 AGS2, HJCYS, hN2 Functions as a receptor for membrane-bound ligands Jagged1, Jagged2, and Delta1 to regulate cell fate determination
NR6A1 Nuclear receptor subfamily 6, group A, member 1 CT150, GCNF, GCNF1, NR61, RTR, hGCNF, hRTR Orphan nuclear receptor. May be involved in the regulation of gene expression in germ cell development during gametogenesis
NRP1 Neuropilin 1 RP11-342D11.1, BDCA4, CD304, NP1, NRP, VEGF165R The membrane-bound isoform 1 is a receptor involved in the development of the cardiovascular system, in angiogenesis, in the formation of certain neuronal circuits, and in organogenesis outside the nervous system
NUDT12 Nudix-type motif 12 Hydrolyzes NAD(P)H to NMNH and AMP (2′,5′-ADP), and diadenosine diphosphate to AMP
NUPL1 Nucleoporin like 1 RP11-206I15.1, PRO2463 Component of the nuclear pore complex, a complex required for the trafficking across the nuclear membrane
OAZ1 Ornithine decarboxylase antizyme 1 AZI, OAZ Binds to and destabilizes ornithine decarboxylase, which is then degraded. Also inhibits cellular uptake of polyamines by inactivating the polyamine uptake transporter
OCA2 Oculocutaneous albinism II BEY, BEY1, BEY2, BOCA, D15S12, EYCL, EYCL2, EYCL3, HCL3, P, PED, SHEP1 Could be involved in the transport of tyrosine
OFCC1 Orofacial cleft 1 candidate 1 MRDS1
OR11A1 Olfactory receptor, family 11, subfamily A, member 1 DAAP-34I1.2, 6M1-18, OR11A2, dJ994E9.6, hs6M1-18 Odorant receptor
OTUD1 OTU deubiquitinase 1 DUBA7, OTDC1 Deubiquitinating enzyme that specifically hydrolyzes “Lys-63”- linked polyubiquitin to monoubiquitin
OTX2 Orthodenticle homeobox 2 CPHD6, MCOPS5 Probably plays a role in the development of the brain and the sense organs
PABPC1 Poly(A) binding protein, cytoplasmic 1 PAB1, PABP, PABP1, PABPC2, PABPL1 Binds the poly(A) tail of mRNA
PCAF K(lysine) acetyltransferase 2B CAF, P/CAF, PCAF Functions as a component of the PCAF complex
PCDHB8 Protocadherin β 8 PCDH-β8, PCDH3I Potential calcium-dependent cell-adhesion protein
PFKFB2 6-Phosphofructo-2-kinase/fructose-2, 6-biphosphatase 2 RP11-164O23.2, PFK-2/FBPase-2 Synthesis and degradation of fructose 2,6-bisphosphate
PGD Phosphogluconate dehydrogenase 6PGD Catalyzes the oxidative decarboxylation of 6-phosphogluconate to ribulose 5-phosphate and CO2, with concomitant reduction of NADP to NADPH
PHOX2A Paired-like homeobox 2a ARIX, CFEOM2, FEOM2, NCAM2, PMX2A May be involved in regulating the specificity of expression of the catecholamine biosynthetic genes
PHPT1 Phosphohistidine phosphatase 1 RP11-216L13.10-005, CGI-202, HEL-S-132P, HSPC141, PHP14 Exhibits phosphohistidine phosphatase activity
PIM3 Pim-3 proto-oncogene, serine/threonine kinase CITF22-49E9.1, pim-3 May be involved in cell cycle progression and antiapoptotic process
PITPNB Phosphatidylinositol transfer protein β RP3-353E16.2, PI-TP-β, PtdInsTP, VIB1B Catalyzes the transfer of PtdIns and phosphatidylcholine between membranes
PLA2G4C Phospholipase A2, group IVC CPLA2-γ Has a preference for arachidonic acid at the sn-2 position of phosphatidylcholine as compared with palmitic acid
PLAG1 Pleiomorphic adenoma gene 1 PSA, SGPA, ZNF912 Transcription factor whose activation results in upregulation of target genes, such as IGFII, leading to uncontrolled cell proliferation
PLCL2 Phospholipase C-like 2 PLCE2 May play an role in the regulation of Ins(1,4,5)P3 around the endoplasmic reticulum
PLXDC2 Plexin domain containing 2 UNQ2514/PRO6003, TEM7R May play a role in tumor angiogenesis
PNPT1 Polyribonucleotide nucleotidyltransferase 1 COXPD13, DFNB70, OLD35, PNPASE, old-35 Involved in mRNA degradation
POLR2B Polymerase (RNA) II (DNA directed) polypeptide B POL2RB, RPB2, hRPB140, hsRPB2 DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA, using the four ribonucleoside triphosphates as substrates
PPA1 Pyrophosphatase (inorganic) 1 RP11-367H5.1, HEL-S-66p, IOPPP, PP, PP1, SID6-8061
PPM1A Protein phosphatase, Mg2+/Mn2+ dependent, 1A PP2C-ALPHA, PP2CA, PP2Cα Enzyme with a broad specificity
PPP1R9A Protein phosphatase 1, regulatory subunit 9A NRB1, NRBI, Neurabin-I Binds to actin filaments (F-actin) and shows crosslinking activity
PPP2CA Protein phosphatase 2, catalytic subunit, α isozyme PP2Ac, PP2CA, PP2Cα, RP-C PP2A can modulate the activity of phosphorylase B kinase casein kinase 2, mitogen-stimulated S6 kinase, and MAP-2 kinase
PPP2R5C Protein phosphatase 2, regulatory subunit B’, γ B56G, PR61G The B regulatory subunit might modulate substrate selectivity and catalytic activity, and also might direct the localization of the catalytic enzyme to a particular subcellular compartment
PRAP1 Proline-rich acidic protein 1 RP11-122K13.6, PRO1195, UPA May play an important role in maintaining normal growth homeostasis in epithelial cells
PRDX3 Peroxiredoxin 3 AOP-1, AOP1, HBC189, MER5, PRO1748, SP-22, prx-III Involved in redox regulation of the cell
PRLR Prolactin receptor HPRL, MFAB, hPRLrI This is a receptor for the anterior pituitary hormone prolactin
PROSC Proline synthetase co-transcribed homolog
PROX1 Prospero homeobox 1 May play a fundamental role in early development of the central nervous system
PRR4 Proline rich 4 LPRP, PROL4
PRRC2B Proline-rich coiled-coil 2B RP11-334J6.1, BAT2L, BAT2L1, KIAA0515, LQFBS-1
PTGS2 Prostaglandin-endoperoxide synthase 2 COX-2, COX2, GRIPGHS, PGG/HS, PGHS-2, PHS-2, hCox-2 May have a role as a major mediator of inflammation and/or a role for prostanoid signaling in activity-dependent plasticity
PTPLAD1 Protein tyrosine phosphatase-like A domain containing 1 B-IND1, HACD3, HSPC121 Involved in Rac1-signaling pathways leading to the modulation of gene expression
PTPN11 Protein tyrosine phosphatase, non-receptor type 11 BPTP3, CFC, NS1, PTP-1D, PTP2C, SH-PTP2, SH-PTP3, SHP2 Acts downstream of various receptor and cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus
PTPN22 Protein tyrosine phosphatase, non-receptor type 22 LYP, LYP1, LYP2, PEP, PTPN8 Seems to act on casitas B-lineage lymphoma (Cbl)
PTPRZ1 Protein tyrosine phosphatase, receptor-type, Z polypeptide 1 HPTPZ, HPTPζ, PTP-ζ, PTP18, PTPRZ, PTPZ, R-PTP-ζ-2, RPTPB, RPTPβ, phosphacan May be involved in the regulation of specific developmental processes in the central nervous system
PUM1 Pumilio RNA-binding family member 1 RP1-65J11.4, HSPUM, PUMH, PUMH1, PUML1 Sequence-specific RNA-binding protein that regulates translation and mRNA stability by binding the 3′-UTR of mRNA targets
RAB8B RAB8B, member RAS oncogene family May be involved in vesicular trafficking and neurotransmitter release
RALA V-ral simian leukemia viral oncogene homolog A RAL Multifunctional GTPase involved in a variety of cellular processes, including gene expression, cell migration, cell proliferation, oncogenic transformation, and membrane trafficking
RASSF6 Ras association (RalGDS/AF-6) domain family member 6 May act as a Ras effector protein
RBM15 RNA binding motif protein 15 OTT, OTT1, SPEN May be implicated in HOX gene regulation
RLF Rearranged L-myc fusion RP1-39G22.1, ZN-15L, ZNF292L May be involved in transcriptional regulation
RNF2 Ring finger protein 2 GS1-120K12.1, BAP-1, BAP1, DING, HIPI3, RING1B, RING2 E3 ubiquitin-protein ligase that mediates monoubiquitination of “Lys-119” of histone H2A, playing a central role in histone code and gene regulation
RNF34 Ring finger protein 34 CARP-1, CARP1, RFI, RIF, RIFF, hRFI Has E3 ubiquitin-protein ligase activity. Regulates the levels of CASP8 and CASP10 by targeting them for proteasomal degradation
ROPN1L Rhophilin associated tail protein 1-like RP11-1C1.7, ASP, RSPH11
RPL14 Ribosomal protein L14 CAG-ISL-7, CTG-B33, L14, RL14, hRL14
RPS14 Ribosomal protein S14 PRO2640, EMTB, S14
RPS8 Ribosomal protein S8 RP11-269F19.3, S8
RTEL1-TNFRSF6B RTEL1-TNFRSF6B readthrough (NMD candidate)
S100A1 S100 calcium binding protein A1 RP1-178F15.1, S100, S100-α, S100A Weakly binds calcium but binds zinc very tightly – distinct binding sites with different affinities exist for both ions on each monomer
SCAMP2 Secretory carrier membrane protein 2 Functions in post-Golgi recycling pathways. Acts as a recycling carrier to the cell surface
SCD Stearoyl-CoA desaturase PRO1933, FADS5, MSTP0081, SCDOS, SCD Terminal component of the liver microsomal stearyl-CoA desaturase system
SEPT2 Septin 2 DIFF6, NEDD-5, NEDD5, Pnutl3, hNedd5 Required for normal progress through mitosis. Involved in cytokinesis
SF3B3 Splicing factor 3b, subunit 3 RSE1, SAP130, SF3b130, STAF13 Subunit of the splicing factor SF3B required for “A” complex assembly formed by the stable binding of U2 snRNP to the branch point sequence in pre-mRNA
SH3BGRL SH3 domain binding glutamate-rich protein like HEL-S-115, SH3BGR
SIK2 Salt-inducible kinase 2 LOH11CR1I, QIK, SNF1LK2 Phosphorylates “Ser-794” of IRS1 in insulin-stimulated adipocytes
SIRT1 Sirtuin 1 RP11-57G10.3, SIR2L1 NAD-dependent deacetylase, which regulates processes such as apoptosis and muscle differentiation by deacetylating key proteins
SIX6 SIX homeobox 6 MCOPCT2, OPTX2, Six9 May be involved in eye development
SLC35B4 Solute carrier family 35 (UDP-xylose/UDP-N-acetylglucosamine transporter), member B4 PSEC0055, YEA, YEA4 Sugar transporter that specifically mediates the transport of UDP-Xyl and UDP-GlcNAc from cytosol into Golgi
SLC37A3 Solute carrier family 37, member 3
SLC7A11 Solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 CCBR1, xCT Sodium-independent, high-affinity exchange of anionic amino acids with high specificity for anionic form of cystine and glutamate
SLCO2A1 Solute carrier organic anion transporter family, member 2A1 MATR1, OATP2A1, PGT, PHOAR2, SLC21A2 May mediate the release of newly synthesized prostaglandins from cells, the transepithelial transport of prostaglandins, and the clearance of prostaglandins from the circulation
SMAD5 SMAD family member 5 DWFC, JV5-1, MADH5 Transcriptional modulator activated by BMP type 1 receptor kinase
SMCHD1 Structural maintenance of chromosomes flexible hinge domain containing 1 Required for maintenance of X inactivation in females and hypermethylation of CpG islands associated with inactive X
SMG1 SMG1 phosphatidylinositol 3-kinase-related kinase 61E3.4, ATX, LIP Serine/threonine protein kinase involved in both mRNA surveillance and genotoxic stress response pathways
SNAI2 Snail family zinc finger 2 SLUG, SLUGH1, SNAIL2, WS2D Transcriptional repressor. Involved in the generation and migration of neural crest cells
SOGA2 Microtubule crosslinking factor 1 CCDC165, KIAA0802, MTCL1
SPRY2 Sprouty homolog 2 hSPRY2 May function as an antagonist of FGF pathways and may negatively modulate respiratory organogenesis
SRPK2 SRSF protein kinase 2 SFRSK2 Phosphorylates RS domain-containing proteins
SRSF7 Serine/arginine-rich splicing factor 7 9G8, AAG3, SFRS7 Required for pre-mRNA splicing
STAG2 Stromal antigen 2 RP11-517O1.1, SA-2, SA2, SCC3B, bA517O1.1 Component of cohesin complex, a complex required for the cohesion of sister chromatids after DNA replication
TAAR6 Trace amine associated receptor 6 RP11-295F4.3, TA4, TAR4, TAR6, TRAR4, taR-4, taR-6 Orphan receptor. Could be a receptor for trace amines
TAB2 TGF-β activated kinase 1/MAP3K7 binding protein 2 CHTD2, MAP3K7IP2, TAB-2 Adapter linking MAP3K7/TAK1 and TRAF6 and mediator of MAP3K7 activation in the IL1 signaling pathway
TAF15 TAF15 RNA polymerase II, TBP-associated factor Npl3, RBP56, TAF2N, TAFII68 RNA and ssDNA-binding protein that may play specific roles during transcription initiation at distinct promoters
TAF2 TAF2 RNA polymerase II, TBP-associated factor CIF150, MRT40B, TAFII150, TAF2 Transcription factor TFIID is one of the general factors required for accurate and regulated initiation by RNA polymerase II
TAF6L TAF6-like RNA polymerase II, PCAF-associated factor PAF65A Functions as a component of the PCAF complex
TBX4 T-box 4 SPS Involved in the transcriptional regulation of genes required for mesoderm differentiation
TCF21 Transcription factor 21 POD1, bHLHa23 Involved in epithelial–mesenchymal interactions in kidney and lung morphogenesis that include epithelial differentiation and branching morphogenesis
TEAD4 TEA domain family member 4 EFTR-2, RTEF1, TCF13L1, TEF-3, TEF3, TEFR-1, hRTEF-1B Binds specifically and noncooperatively to the Sph and GT-IIC “enhansons” (5′-GTGGAATGT-3′) and activates transcription
TGFBR3 Transforming growth factor β receptor III BGCAN, β-glycan Binds to TGF-β
TGIF2 TGFβ-induced factor homeobox 2 Transcriptional repressor. Probably represses transcription via the recruitment of histone deacetylase proteins
THUMPD1 THUMP domain containing 1
TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 TCBP, TIAR RNA-binding protein. Possesses nucleolytic activity against cytotoxic lymphocyte target cells. May be involved in apoptosis
TM9SF3 Transmembrane 9 superfamily member 3 RP11-34E5.1, EP70-P-iso, SMBP
TMED4 Transmembrane emp24 protein transport domain containing 4 ERS25, HNLF Involved in endoplasmic reticulum stress response. May play a role in the regulation of heat-shock response and apoptosis
TMEM132B Transmembrane protein 132B
TMEM14A Transmembrane protein 14A PTD011, C6orf73
TMEM192 Transmembrane protein 192
TMEM257 Transmembrane protein 257 CXorf1
TMEM45A Transmembrane protein 45A DERP7
TMEM64 Transmembrane protein 64
TMPO Thymopoietin CMD1T, LAP2, LEMD4, PRO0868, TP May help direct the assembly of the nuclear lamina and thereby help maintain the structural organization of the nuclear envelope
TMPRSS11A Transmembrane protease, serine 11A ECRG1 Probable serine protease, which may play a role in cellular senescence
TNIP1 TNFAIP3 interacting protein 1 ABIN-1, NAF1, VAN, nip40-1 Interacts with zinc finger protein A20/TNFAIP3 and inhibits TNF-induced NF-κB-dependent gene expression by interfering with an RIP- or TRAF2-mediated transactivation signal
TNPO1 Transportin 1 IPO2, KPNB2, MIP, MIP1, TRN Functions in nuclear protein import as nuclear transport receptor
TNRC6C Trinucleotide repeat containing 6C Plays a role in RNA-mediated gene silencing by miRNAs
TRIM2 Tripartite motif containing 2 CMT2R, RNF86 May contribute to the alteration of neural cellular mechanisms
TRUB1 TruB psi synthase family member 1 PUS4 May be responsible for synthesis of psi from uracil in transfer RNAs
TSG101 Tumor susceptibility 101 TSG10, VPS23 Component of the ESCRT-I complex, a regulator of vesicular trafficking process
TSHR Thyroid stimulating hormone receptor CHNG1, LGR3, hTSHR-I Receptor for thyrothropin. Plays a central role in controlling thyroid cell metabolism
TUSC1 Tumor suppressor candidate 1 TSG-9, TSG9
TWF1 Twinfilin actin-binding protein 1 A6, PTK9 Actin-binding protein involved in motile and morphological processes
UBA2 Ubiquitin-like modifier activating enzyme 2 HRIHFB2115, ARX, SAE2 The dimeric enzyme acts as an E1 ligase for SUMO1, SUMO2, SUMO3, and probably SUMO4
UCHL1 Ubiquitin carboxyl-terminal esterase L1 HEL-117, NDGOA, PARK5, PGP 9.5, PGP9.5, PGP95, Uch-L1 Ubiquitin-protein hydrolase involved both in the processing of ubiquitin precursors and of ubiquitinated proteins
UGT3A1 UDP glycosyltransferase 3 family, polypeptide A1 UDP-glucuronosyltransferases catalyze phase II biotransformation reactions
USP28 Ubiquitin specific peptidase 28 Deubiquitinase involved in DNA damage response checkpoint and MYC proto-oncogene stability
VBP1 Von Hippel-Lindau binding protein 1 RP13-228J13.4, PFD3, PFDN3, VBP-1 Binds specifically to c-CPN and transfers target proteins to it
WDR33 WD repeat domain 33 NET14, WDC146 Essential for both cleavage and polyadenylation of pre-mRNA 3′ ends
WNT16 Wingless-type MMTV integration site family, member 16 Ligand for members of the Frizzled family of seven transmembrane receptors
WNT2 Wingless-type MMTV integration site family, member 2 INT1L1, IRP Ligand for members of the Frizzled family of seven transmembrane receptors
WNT3A Wingless-type MMTV integration site family member 3A Ligand for members of the Frizzled family of seven transmembrane receptors
XIAP X-linked inhibitor of apoptosis RP1-315G1.5, API3, BIRC4, IAP-3, ILP1, MIHA, XLP2, hIAP-3, hIAP3 Apoptotic suppressor
YOD1 YOD1 deubiquitinase RP11-164O23.1, DUBA8, OTUD2, PRO0907 May play an important regulatory role at the level of protein turnover by preventing degradation
YY1 YY1 transcription factor DELTA, INO80S, NF-E1, UCRBP, YIN-YANG-1 May play an important role in development and differentiation
ZEB2 Zinc finger E-box binding homeobox 2 HRIHFB2411, HSPC082, SIP-1, SIP1, SMADIP1, ZFHX1B Transcriptional inhibitor that binds to DNA sequence 5′-CACCT-3′ in different promoters. Represses transcription of E-cadherin
ZFP36L2 ZFP36 ring finger protein-like 2 BRF2, ERF-2, ERF2, RNF162C, TIS11D Probable regulatory protein involved in regulating the response to growth factors
ZIC2 Zinc family member 2 HPE5 Involved in cerebellar development
ZNF12 Zinc finger protein 12 GIOT-3, HZF11, KOX3, ZNF325 May be involved in transcriptional regulation
ZNF121 Zinc finger protein 121 D19S204, ZHC32, ZNF20 May be involved in transcriptional regulation
ZNF132 Zinc finger protein 132 pHZ-12 May be involved in transcriptional regulation
ZNF148 Zinc finger protein 148 BERF-1, BFCOL1, HT-β, ZBP-89, ZFP148, pHZ-52 Involved in transcriptional regulation
ZNF180 Zinc finger protein 180 HHZ168 May be involved in transcriptional regulation
ZNF238 Zinc finger and BTB domain containing 18 C2H2-171, MRD22, RP58, TAZ-1, ZNF18 Sequence-specific DNA-binding protein with transcriptional repression activity
ZNF25 Zinc finger protein 25 KOX19, Zfp9 May be involved in transcriptional regulation
ZNF30 Zinc finger protein 30 KOX28 May be involved in transcriptional regulation
ZNF35 Zinc finger protein 35 HF.10, HF10, Zfp105 May be involved in transcriptional regulation
ZNF350 Zinc finger protein 350 ZBRK1, ZFQR Transcriptional repressor
ZNF426 Zinc finger protein 426 May be involved in transcriptional regulation
ZNF445 Zinc finger protein 445 ZKSCAN15, ZNF168, ZSCAN47 May be involved in transcriptional regulation
ZNF558 Zinc finger protein 558 May be involved in transcriptional regulation
ZNF562 Zinc finger protein 562 May be involved in transcriptional regulation
ZNF594 Zinc finger protein 594 hCG_1775942 May be involved in transcriptional regulation
ZNF644 Zinc finger protein 644 BM-005, MYP21, NatF, ZEP-2 May be involved in transcriptional regulation
ZNF652 Zinc finger protein 652 Functions as a transcriptional repressor
ZNF700 Zinc finger protein 700 May be involved in transcriptional regulation
ZNF703 Zinc finger protein 703 ZEPPO1, ZNF503L, ZPO1 May function as a transcriptional repressor
ZNF711 Zinc finger protein 711 CMPX1, MRX97, ZNF4, ZNF5, ZNF6, Zfp711, dJ75N13.1 May be involved in transcriptional regulation
ZNF763 Zinc finger protein 763 ZNF, ZNF440L May be involved in transcriptional regulation
ZNF780A Zinc finger protein 780A ZNF780 May be involved in transcriptional regulation

Abbreviations: FGF, fibroblast growth factor; HLA, human leukocyte antigen; IL, interleukin; miRNA, microRNA; mRNA, messenger RNA; NK cells, natural killer cells; ssDNA, single-stranded DNA; TGF, Transforming growth factor; TNF, tumor necrosis factor; UV, ultraviolet; VEGF, vascular endothelial growth factor.

Table 12.

The top enriched clusters (enrich score >1) by DAVID for the combined targets of hsa-miR-181a-5p from both TarBase 6.0 and miRTarBase 4.0

Category Term Gene count P-value FDR
Annotation cluster 1 Enrichment score: 4.49
GOTERM_BP_FAT Response to hormone stimulus 7 7.70E-06 1.10E-03
GOTERM_BP_FAT Response to endogenous stimulus 7 1.40E-05 1.50E-03
GOTERM_BP_FAT Response to organic substance 7 3.30E-04 8.80E-03
Annotation cluster 2 Enrichment score: 3.97
GOTERM_BP_FAT Negative regulation of apoptosis 6 1.00E-04 5.60E-03
GOTERM_BP_FAT Negative regulation of programmed cell death 6 1.10E-04 5.00E-03
GOTERM_BP_FAT Negative regulation of cell death 6 1.10E-04 4.80E-03
Annotation cluster 3 Enrichment score: 3.57
GOTERM_BP_FAT DNA damage checkpoint 4 3.90E-05 3.10E-03
GOTERM_BP_FAT DNA integrity checkpoint 4 5.00E-05 3.60E-03
GOTERM_BP_FAT DNA damage response, signal transduction 4 1.80E-04 6.50E-03
GOTERM_BP_FAT Cell cycle checkpoint 4 2.60E-04 7.20E-03
GOTERM_BP_FAT Response to DNA damage stimulus 4 1.50E-02 1.00E-01
Annotation cluster 4 Enrichment score: 3.38
KEGG_PATHWAY Bladder cancer 4 1.80E-04 1.50E-03
KEGG_PATHWAY Endometrial cancer 4 3.40E-04 2.30E-03
KEGG_PATHWAY Non-small-cell lung cancer 4 3.80E-04 2.30E-03
KEGG_PATHWAY Acute myeloid leukemia 4 4.70E-04 2.60E-03
KEGG_PATHWAY Glioma 4 6.00E-04 3.00E-03
KEGG_PATHWAY Melanoma 4 8.50E-04 3.60E-03
Annotation cluster 5 Enrichment score: 3.2
GOTERM_BP_FAT Regulation of apoptosis 7 6.00E-04 1.40E-02
GOTERM_BP_FAT Regulation of programmed cell death 7 6.30E-04 1.40E-02
GOTERM_BP_FAT Regulation of cell death 7 6.50E-04 1.40E-02
Annotation cluster 6 Enrichment score: 3.13
GOTERM_BP_FAT Developmental growth 4 2.30E-04 7.20E-03
GOTERM_BP_FAT Cell fate commitment 4 9.10E-04 1.90E-02
GOTERM_BP_FAT Tissue morphogenesis 4 1.90E-03 3.30E-02
Annotation cluster 7 Enrichment score: 2.74
GOTERM_BP_FAT Apoptosis 6 1.20E-03 2.20E-02
GOTERM_BP_FAT Programmed cell death 6 1.30E-03 2.30E-02
GOTERM_BP_FAT Cell death 6 2.60E-03 3.90E-02
GOTERM_BP_FAT Death 6 2.70E-03 3.80E-02
Annotation cluster 8 Enrichment score: 2.7
GOTERM_BP_FAT Positive regulation of macromolecule biosynthetic process 6 1.70E-03 3.00E-02
GOTERM_BP_FAT Positive regulation of cellular biosynthetic process 6 2.10E-03 3.50E-02
GOTERM_BP_FAT Positive regulation of biosynthetic process 6 2.20E-03 3.70E-02
Annotation cluster 9 Enrichment score: 2.56
GOTERM_BP_FAT Positive regulation of apoptosis 5 2.70E-03 3.90E-02
GOTERM_BP_FAT Positive regulation of programmed cell death 5 2.70E-03 3.80E-02
GOTERM_BP_FAT Positive regulation of cell death 5 2.80E-03 3.80E-02
Annotation cluster 10 Enrichment score: 2.41
GOTERM_BP_FAT Regulation of phosphorylation 5 3.60E-03 4.40E-02
GOTERM_BP_FAT Regulation of phosphate metabolic process 5 4.10E-03 4.50E-02
GOTERM_BP_FAT Regulation of phosphorus metabolic process 5 4.10E-03 4.50E-02
Annotation cluster 11 Enrichment score: 2.22
GOTERM_BP_FAT Positive regulation of transcription, DNA-dependent 5 3.90E-03 4.40E-02
GOTERM_BP_FAT Positive regulation of transcription 5 7.00E-03 6.70E-02
GOTERM_BP_FAT Positive regulation of gene expression 5 7.80E-03 7.20E-02
Annotation cluster 12 Enrichment score: 2.15
GOTERM_BP_FAT Positive regulation of protein kinase activity 4 3.50E-03 4.40E-02
GOTERM_BP_FAT Positive regulation of kinase activity 4 3.90E-03 4.40E-02
GOTERM_BP_FAT Positive regulation of transferase activity 4 4.30E-03 4.60E-02
GOTERM_BP_FAT Regulation of protein kinase activity 4 1.20E-02 9.20E-02
GOTERM_BP_FAT Regulation of kinase activity 4 1.30E-02 9.80E-02
GOTERM_BP_FAT Regulation of transferase activity 4 1.40E-02 1.00E-01
Annotation cluster 13 Enrichment score: 2.1
GOTERM_BP_FAT Positive regulation of cellular protein metabolic process 4 4.00E-03 4.40E-02
GOTERM_BP_FAT Positive regulation of protein metabolic process 4 4.50E-03 4.70E-02
GOTERM_BP_FAT Regulation of cellular protein metabolic process 4 2.70E-02 1.80E-01
Annotation cluster 14 Enrichment score: 2.1
GOTERM_BP_FAT Branching morphogenesis of a tube 3 3.70E-03 4.30E-02
GOTERM_BP_FAT Positive regulation of cell development 3 4.10E-03 4.50E-02
GOTERM_BP_FAT Morphogenesis of a branching structure 3 4.80E-03 4.90E-02
GOTERM_BP_FAT Tube morphogenesis 3 1.30E-02 1.00E-01
GOTERM_BP_FAT Regulation of cell development 3 3.30E-02 2.00E-01
Annotation cluster 15 Enrichment score: 2.06
GOTERM_BP_FAT Neuron projection morphogenesis 4 3.10E-03 4.00E-02
GOTERM_BP_FAT Cell projection morphogenesis 4 4.60E-03 4.80E-02
GOTERM_BP_FAT Neuron projection development 4 5.20E-03 5.10E-02
GOTERM_BP_FAT Cell part morphogenesis 4 5.20E-03 5.10E-02
GOTERM_BP_FAT Neuron development 4 1.10E-02 9.00E-02
GOTERM_BP_FAT Cell morphogenesis 4 1.30E-02 9.80E-02
GOTERM_BP_FAT Cell projection organization 4 1.40E-02 1.00E-01
GOTERM_BP_FAT Cellular component morphogenesis 4 1.70E-02 1.20E-01
GOTERM_BP_FAT Neuron differentiation 4 2.20E-02 1.50E-01
Annotation cluster 16 Enrichment score: 2.03
BIOCARTA IGF-1 signaling pathway 3 7.00E-03 3.00E-01
BIOCARTA IL-6 signaling pathway 3 7.00E-03 3.00E-01
BIOCARTA Insulin signaling pathway 3 7.00E-03 3.00E-01
BIOCARTA Signaling of hepatocyte growth factor receptor 3 2.20E-02 3.10E-01
Annotation cluster 17 Enrichment score: 1.97
GOTERM_BP_FAT Embryonic appendage morphogenesis 3 6.50E-03 6.30E-02
GOTERM_BP_FAT Embryonic limb morphogenesis 3 6.50E-03 6.30E-02
GOTERM_BP_FAT Limb morphogenesis 3 8.40E-03 7.50E-02
GOTERM_BP_FAT Appendage morphogenesis 3 8.40E-03 7.50E-02
GOTERM_BP_FAT Limb development 3 9.00E-03 7.70E-02
GOTERM_BP_FAT Appendage development 3 9.00E-03 7.70E-02
GOTERM_BP_FAT Embryonic morphogenesis 3 6.80E-02 3.40E-01
Annotation cluster 18 Enrichment score: 1.81
GOTERM_BP_FAT Response to ethanol 3 3.60E-03 4.30E-02
GOTERM_BP_FAT Response to metal ion 3 1.40E-02 1.00E-01
GOTERM_BP_FAT Response to inorganic substance 3 3.30E-02 2.00E-01
GOTERM_BP_FAT Response to drug 3 3.60E-02 2.10E-01
Annotation cluster 19 Enrichment score: 1.59
GOTERM_BP_FAT Response to estrogen stimulus 3 9.40E-03 7.90E-02
GOTERM_BP_FAT Positive regulation of protein modification process 3 2.80E-02 1.80E-01
GOTERM_BP_FAT Regulation of protein modification process 3 6.40E-02 3.20E-01
Annotation cluster 20 Enrichment score: 1.57
GOTERM_BP_FAT Protein amino acid phosphorylation 5 1.30E-02 9.70E-02
GOTERM_BP_FAT Phosphorylation 5 2.30E-02 1.50E-01
GOTERM_BP_FAT Phosphate metabolic process 5 4.30E-02 2.40E-01
GOTERM_BP_FAT Phosphorus metabolic process 5 4.30E-02 2.40E-01
Annotation cluster 21 Enrichment score: 1.55
GOTERM_BP_FAT Cell aging 3 9.60E-04 1.90E-02
GOTERM_BP_FAT Negative regulation of neuron apoptosis 3 2.30E-03 3.70E-02
GOTERM_BP_FAT Aging 3 1.00E-02 8.50E-02
GOTERM_BP_FAT Actin cytoskeleton organization 3 3.90E-02 2.20E-01
GOTERM_BP_FAT Actin filament-based process 3 4.40E-02 2.40E-01
GOTERM_BP_FAT Membrane organization 3 9.90E-02 4.40E-01
GOTERM_CC_FAT Membrane fraction 3 3.20E-01 9.40E-01
GOTERM_CC_FAT Insoluble fraction 3 3.30E-01 9.30E-01
Annotation cluster 22 Enrichment score: 1.47
GOTERM_BP_FAT Ras protein signal transduction 3 9.40E-03 7.90E-02
KEGG_PATHWAY Long-term depression 3 1.50E-02 4.40E-02
KEGG_PATHWAY B cell receptor signaling pathway 3 1.70E-02 4.50E-02
KEGG_PATHWAY VEGF signaling pathway 3 1.70E-02 4.50E-02
KEGG_PATHWAY Fc epsilon RI signaling pathway 3 1.90E-02 4.60E-02
KEGG_PATHWAY ErbB signaling pathway 3 2.30E-02 5.40E-02
KEGG_PATHWAY Gap junction 3 2.40E-02 5.50E-02
KEGG_PATHWAY GnRH signaling pathway 3 2.90E-02 6.30E-02
KEGG_PATHWAY T-cell receptor signaling pathway 3 3.40E-02 7.20E-02
KEGG_PATHWAY Insulin signaling pathway 3 5.20E-02 1.00E-01
GOTERM_BP_FAT Small GTPase-mediated signal transduction 3 6.70E-02 3.40E-01
KEGG_PATHWAY Chemokine signaling pathway 3 9.20E-02 1.70E-01
KEGG_PATHWAY Regulation of actin cytoskeleton 3 1.20E-01 2.10E-01
KEGG_PATHWAY MAPK signaling pathway 3 1.70E-01 2.80E-01
Annotation cluster 23 Enrichment score: 1.45
GOTERM_BP_FAT Axonogenesis 3 3.00E-02 1.80E-01
GOTERM_BP_FAT Cell morphogenesis involved in neuron differentiation 3 3.40E-02 2.00E-01
GOTERM_BP_FAT Cell morphogenesis involved in differentiation 3 4.50E-02 2.50E-01
Annotation cluster 24 Enrichment score: 1.31
GOTERM_CC_FAT Nucleoplasm 6 6.20E-03 4.90E-01
GOTERM_CC_FAT Nuclear lumen 6 4.50E-02 5.70E-01
GOTERM_CC_FAT Intracellular organelle lumen 6 9.40E-02 7.40E-01
GOTERM_CC_FAT Organelle lumen 6 1.00E-01 7.20E-01
GOTERM_CC_FAT Membrane-enclosed lumen 6 1.10E-01 7.10E-01
Annotation cluster 25 Enrichment score: 1.3
GOTERM_BP_FAT Hemopoiesis 3 4.30E-02 2.40E-01
GOTERM_BP_FAT Hemopoietic or lymphoid organ development 3 5.10E-02 2.70E-01
GOTERM_BP_FAT Immune system development 3 5.60E-02 2.90E-01
Annotation cluster 26 Enrichment score: 1.06
SP_PIR_KEYWORDS Transcription regulation 6 6.30E-02 3.80E-01
SP_PIR_KEYWORDS Transcription 6 6.80E-02 3.90E-01
GOTERM_BP_FAT Transcription 6 1.60E-01 6.10E-01

Abbreviations: DAVID, Database for Annotation, Visualization and Integrated Discovery; FDR, false discovery rate; GnRH, gonadotropin releasing hormone; IGF, insulin-like growth factor; IL, interleukin; VEGF, vascular endothelial growth factor.

Figure 9.

Figure 9

Endometrial carcinoma pathways in the combined target list of hsa-miR-181a-5p based on both TarBase and miRTarBase 4.0.

Notes: EC has two types. Type I EC, or estrogen-dependent endometrioid EC, represents the most common subtype. It is an estrogen-associated lesion often seen in conjunction with endometrial hyperplasia. The histological subtypes that correspond to endometrioid adenocarcinoma and its variants, as well as mucinous adenocarcinoma, are allocated to this group. Type II EC, or nonendometrioid EC, tends to affect older, postmenopausal women and is a non-estrogen-associated lesion. These cancers are not preceded by endometrial hyperplasia, though they can occasionally arise in endometrial polyps or from precancerous lesions, endometrial intraepithelial carcinoma, or in the vicinity of atrophic endometrium. The clinicopathological differences between the two types are paralleled by specific genetic alterations, with type I EC showing microsatellite instability and mutations in PTEN, PIK3CA, KRAS, and CTNNB1 (β-catenin), and type II exhibiting p53 mutations and chromosomal instability.17 hsa-miR-181a-5p has been found to regulate these genes and eventually promote EC initiation, development, growth, and metastasis.

Abbreviation: EC, endometrial cancer.

Furthermore, our DAVID analysis revealed that there were 33 KEGG pathways significantly enriched in the target list of hsa-miR-181a-5p, based on both TarBase and miR-TarBase (Table 13). These pathways included pathways in cancer, prostate cancer, thyroid cancer, renal cell carcinoma, chronic myeloid leukemia, neurotrophin signaling pathway, dorsoventral axis formation, bladder cancer, endometrial cancer, non-small-cell lung cancer, acute myeloid leukemia, glioma, long-term potentiation, melanoma, colorectal cancer, melanogenesis, cell cycle, natural killer cell–mediated cytotoxicity, focal adhesion, notch signaling pathway, long-term depression, pancreatic cancer, B cell receptor signaling pathway, VEGF signaling pathway, Fc epsilon RI signaling pathway, ErbB signaling pathway, gap junction, GnRH signaling pathway, T cell receptor signaling pathway, insulin signaling pathway, Jak-STAT signaling pathway, chemokine signaling pathway, and prion diseases.

Table 13.

KEGG pathways for the combined targets of hsa-miR-181a-5p based on TarBase 6.0 and miRTarBase 4.0

Signaling pathway Gene count % P-value FDR
Pathways in cancer 7 31.8 1.30E-04 1.30E-03
Prostate cancer 6 27.3 2.60E-06 7.80E-05
Thyroid cancer 5 22.7 8.20E-07 4.90E-05
Renal cell carcinoma 5 22.7 3.00E-05 5.90E-04
Chronic myeloid leukemia 5 22.7 3.90E-05 4.70E-04
Neurotrophin signaling pathway 5 22.7 2.80E-04 2.10E-03
Dorsoventral axis formation 4 18.2 3.70E-05 5.50E-04
Bladder cancer 4 18.2 1.80E-04 1.50E-03
Endometrial cancer 4 18.2 3.40E-04 2.30E-03
Non-small-cell lung cancer 4 18.2 3.80E-04 2.30E-03
Acute myeloid leukemia 4 18.2 4.70E-04 2.60E-03
Glioma 4 18.2 6.00E-04 3.00E-03
Long-term potentiation 4 18.2 7.50E-04 3.50E-03
Melanoma 4 18.2 8.50E-04 3.60E-03
Colorectal cancer 4 18.2 1.40E-03 5.50E-03
Melanogenesis 4 18.2 2.20E-03 8.30E-03
Cell cycle 4 18.2 4.30E-03 1.50E-02
Natural killer cell–mediated cytotoxicity 4 18.2 5.20E-03 1.70E-02
Focal adhesion 4 18.2 1.60E-02 4.50E-02
Notch signaling pathway 3 13.6 7.10E-03 2.20E-02
Long-term depression 3 13.6 1.50E-02 4.40E-02
Pancreatic cancer 3 13.6 1.60E-02 4.30E-02
B-cell receptor signaling pathway 3 13.6 1.70E-02 4.50E-02
VEGF signaling pathway 3 13.6 1.70E-02 4.50E-02
Fc epsilon RI signaling pathway 3 13.6 1.90E-02 4.60E-02
ErbB signaling pathway 3 13.6 2.30E-02 5.40E-02
Gap junction 3 13.6 2.40E-02 5.50E-02
GnRH signaling pathway 3 13.6 2.90E-02 6.30E-02
T cell receptor signaling pathway 3 13.6 3.40E-02 7.20E-02
Insulin signaling pathway 3 13.6 5.20E-02 1.00E-01
Jak-STAT signaling pathway 3 13.6 6.60E-02 1.30E-01
Chemokine signaling pathway 3 13.6 9.20E-02 1.70E-01
Prion diseases 2 9.1 9.20E-02 1.70E-01

Abbreviations: FDR, false discovery rate; GnRH, gonadotropin releasing hormone; KEGG, Kyoto Encyclopedia of Genes and Genomes; VEGF, vascular endothelial growth factor.

Among the 313 validated targets of hsa-miR-181a-5p, 22 were cancer genes (Table 14). These included ATM, BCL2, BRCA1, CCDC6, CCND1, CDX2, EP300, FBXO11, H3F3B, HOOK3, HOXA11, HRAS, KRAS, MAP2K1, NOTCH1, NOTCH2, PLAG1, PTPN11, RBM15, STAG2, TAF15, and TSHR. The KEGG pathway analysis also indicate that the targets regulated by hsa-miR-181a that are cancer genes are all involved in the tumorigenesis of bladder cancer, endometrial cancer, non-small-cell lung cancer, acute myeloid leukemia, glioma, melanoma, and colorectal cancer.

Table 14.

Combined targets of hsa-miR-181a-5p based on TarBase 6.0 and miRTarBase 4.0, that are cancer genes

Gene symbol Name Tumor types (somatic) Tumor types (germline)
ATM Ataxia telangiectasia mutated T-PLL Leukemia; lymphoma; medulloblastoma; glioma
BCL2 B-cell CLL/lymphoma 2 NHL; CLL
BRCA1 Familial breast/ovarian cancer gene 1 Ovarian Breast; ovarian
CCDC6 Coiled-coil domain containing 6 NSCLC
CCND1 Cyclin D1 CLL; B-ALL; breast
CDX2 Caudal type homeobox transcription factor 2 AML
EP300 300 kDa E1A-binding protein gene Colorectal; breast; pancreatic; AML; ALL; DLBCL
FBXO11 F-box protein 11 DLBCL
H3F3B H3 histone; family 3B (H3.3B) Chondroblastoma
HOOK3 Hook homolog 3 Papillary thyroid
HOXA11 Homeobox A11 CML
HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog Infrequent sarcomas; rare other tumor types Rhabdomyosarcoma; ganglioneuroblastoma; bladder
KRAS v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog Pancreatic; colorectal; lung; thyroid; AML; other tumor types
MAP2K1 Mitogen-activated protein kinase kinase 1 NSCLC; melanoma; colorectal
NOTCH1 Notch homolog 1; translocation-associated (Drosophila) (TAN1) T-ALL
NOTCH2 Notch homolog 2 Marginal zone lymphoma; DLBCL
PLAG1 Pleiomorphic adenoma gene 1 Salivary adenoma
PTPN11 Protein tyrosine phosphatase; nonreceptor type 11 JMML; AML; MDS
RBM15 RNA binding motif protein 15 Acute megakaryocytic leukemia
STAG2 Stromal antigen 2 Bladder carcinoma; glioblastoma; melanoma; Ewing’s sarcoma; myeloid neoplasms
TAF15 TAF15 RNA polymerase II; TBP-associated factor; 68 kDa Extraskeletal myxoid chondrosarcoma; ALL
TSHR Thyroid stimulating hormone receptor Toxic thyroid adenoma Thyroid adenoma

Abbreviations: ALL, acute lymphocytic leukemia; AML, adult acute myeloid leukemia; B-ALL, B-cell ALL; CLL, chronic lymphocytic leukemia; CML, chronic myelogenous leukemia; DLBCL, diffuse large B-cell lymphoma; JMML, juvenile myelomonocytic leukemia; MDS, myelodysplastic syndrome; NHL, non-Hodgkin lymphoma; NSCLC, non-small-cell lung cancer; T-ALL, T-cell ALL; T-PLL, T-cell subtype of prolymphocytic leukemia.

Now when we looked at the prediction accuracy of all the nine algorithms we used, we found that all the predicting programs behaved poorly. The reasons for this may include: a) the predicting criteria were not set up properly; b) the matching criteria for hsa-miR-181a with the complementary sites of the target mRNAs may have been too restrictive or too loose; c) the value for the threshold was not properly set prior to prediction; and d) the calculation of the P-values may have been too simple or too complicated. The poor predictive ability for all these algorithms also emphasizes the importance of experimental validation of the targets of any specific miRNAs.

Clinical validation of the role of hsa-miR-181a in EC tumorigenesis

Next, we aimed to validate the function of hsa-miR-181a in the pathogenesis of EC by measuring and comparing the expression levels of hsa-miR-181a in normal, benign, and malignant endometrial tissues. The association of disease progression of EC with the expression profile of hsa-miR-181a was also determined. There are two types of EC with distinct histological characteristics.15,51 Herein, a total of 78 tissue samples were classified by immunohistochemical staining. There were 47, 18, and 13 samples that were categorized as EC, endometrial hyperplasia, or normal endometrium, respectively. For the EC group, there were 37 samples, and 10 samples that belonged to type I and type II EC, respectively. The type I EC was ER-and PR-positive (Figure 10), and the type II EC was ER- and PR-negative (Figure 11).

Figure 10.

Figure 10

The expression of ER and PR in type I EC.

Notes: The expression of ER and PR was evaluated by immunohistochemistry. Dewaxed and dehydrated sections were washed with PBS and then, incubated with 3% peroxyl in methanol to terminate the activity of endogenous peroxidases. The sections were washed with PBS and immersed into boiled citrate-buffered solution for 10 minutes. The sections were blocked with 5% bovine serum albumin in PBS for 20 minutes at room temperature. Following that, the sections were probed with primary antibody against ER or PR, followed by biotinylated second anti-rabbit antibody. (A) Positive expression of ER; and (B) positive expression of PR.

Abbreviations: EC, endometrial cancer; ER, estrogen receptor; PBS, phosphate-buffered saline; PR, progesterone receptor.

Figure 11.

Figure 11

The expression of ER and PR in type II EC.

Notes: The expression of ER and PR was evaluated by immunohistochemistry. Dewaxed and dehydrated sections were washed with PBS and then, incubated with 3% peroxyl in methanol to terminate the activity of endogenous peroxidases. The sections were washed with PBS and immersed into boiled citrate-buffered solution for 10 minutes. The sections were blocked with 5% bovine serum albumin in PBS for 20 minutes at room temperature. Following that, the sections were probed with primary antibody against ER or PR, followed by biotinylated second anti-rabbit antibody. (A) Negative expression of ER; and (B) negative expression of PR.

Abbreviations: EC, endometrial cancer; ER, estrogen receptor; PBS, phosphate-buffered saline; PR, progesterone receptor.

To examine the potential role of hsa-miR-181a in the development and progression of EC, the expression profile of hsa-miR-181a was tested in all collected clinical samples, using RT-PCR (Figure S1). In comparison with normal endometrium, the expression level of hsa-miR-181a was increased 8.5-, 31.2-, and 4.1-fold in type I EC, type II EC, and endometrial hyperplasia, respectively (P<0.05, by one-way ANOVA) (Tables 15 and 16). The expression level of hsa-miR-181a in type II EC was higher (3.7-fold) than that in type I EC (P<0.05). In addition, hsa-miR-181a had a higher expression level in EC than that in endometrial hyperplasia.

Table 15.

Expression level of hsa-miR-181a in normal endometrium, endometrial hyperplasia, and EC

Tissue N ΔCt 2−ΔΔCt
Endometrial cancer 47 −3.356±2.401 10.240
Endometrial hyperplasia 18 −1.893±2.568 4.073
Normal endometrium 13 0.133±2.527 1.000

Note: ΔCt, normalized threshold cycle; 2−ΔΔCt, a method used to calculate relative changes in the gene expression determined from real-time quantitative polymerase chain reaction experiments and it means the fold change.

Abbreviations: ΔCt, normalized threshold cycle; EC, endometrial cancer.

Table 16.

Differential expression level of hsa-miR181a in endometrium tissues

Tissue 2−ΔΔCt P
Endometrial hyperplasia vs normal endometrial tissue 4.073 0.027
Type II endometrial cancer vs type I endometrial cancer 3.668 0.032
Type II endometrial cancer vs endometrial hyperplasia 7.669 0.003
Type II endometrial cancer vs normal endometrial tissue 31.233 0.000
Type I endometrial cancer vs endometrial hyperplasia 2.091 0.127
Type I endometrial cancer vs normal endometrial tissue 8.515 0.000

Note: 2−ΔΔCt: a method used to calculate relative changes in the gene expression determined from real-time quantitative polymerase chain reaction experiments and it means the fold change.

Since we have observed the differential expression profile of hsa-miR-181a in all examined clinical samples, we further assessed the association between the expression of hsa-miR-181a and the development of EC with regard to histological type, stage, grade, migration, and invasion. As shown in Table 17, compared with the stage I and II EC, there was a remarkable increase in the expression level of hsa-miR-181a in stage III and VI EC (P=0.01, by one-way ANOVA). The expression level of hsa-miR-181a was increased in EC with lymph migration and myometrial invasion. In addition, compared with the grade 1 EC, there was an increase in the expression level of hsa-miR-181a in grade 2 and grade 3 EC (P>0.05; Table 17). Taken together, these results indicate that there is an association between the expression level of hsa-miR-181a and the clinical development and progression of EC.

Table 17.

Association between hsa-miR-181a expression and pathological characteristics of EC

Pathological characteristics N ΔCt F P
FIGO stage
 I+II 38 −2.929±2.306 7.120 0.011
 III+VI 9 −5.160±2.002
Tumor grade
 G1 32 −3.152±2.528 0.723 0.400
 G2 + G3 15 −3.792±2.118
Lymph migration
 No 42 −3.183±2.370 2.095 0.155
 Yes 5 −4.808±2.401
Myometrial invasion
 ≤1/2 39 −3.086±2.406 3.033 0.088
 >1/2 8 −4.674±2.015

Abbreviations: ΔCt, normalized threshold cycle; EC, endometrial cancer; FIGO, International Federation of Gynecology and Obstetrics.

Discussion

miRNAs play critical roles in regulating proliferation, differentiation, apoptosis, development, metabolism, and immunity.2 miRNAs may act as oncogenes or tumor suppressors, and they could play a potential role as diagnostic and prognostic biomarkers of cancers.7,52 Specific miRNAs are expressed in various tissues, and changes in regulation of gene expression are thought to cause carcinogenesis. Thus, tissue-specific miRNAs may be used as effective biomarkers for cancer diagnosis, treatment, and prognosis.8 Hsa-miR-181a has been proposed to play a role in the pathogenesis, development, progression, metastasis, prognosis, and therapeutic response to chemo- and radiotherapy in EC,4,53 ovarian cancer,54 glioma,30,55 liver cancer,56 colorectal cancer,5759 gastric cancer,60,61 lung cancer,62 breast cancer,6367 cervical carcinoma,68,69 pancreatic cancer,46 osteosarcoma,70 oral squamous cell carcinoma,71,72 B-cell lymphoma,73 thyroid cancer,74 salivary adenoid cystic carcinoma,75 and acute and chronic leukemias.7681 Ciafrè et al,82 firstly reported that the expression of hsa-miR-181a was significantly downregulated in primary glioblastomas and human glioblastoma cell lines compared with normal brain tissue. As in glioblastoma, significant downregulation of hsa-miR-181a was also observed in squamous lung cell carcinoma,83 oral squamous cell carcinoma,71 luminal A-like breast cancer,67 and non-small-cell lung cancer.84 However, hsa-miR-181a was significantly overexpressed in MCF-7 breast cancer cells,85 colorectal cancer,28 and hepatocellular carcinoma cells.56,86,87 Hsa-miR-181a was upregulated in acute myeloid leukemia,76 especially in the M1 and M2 subtypes, and in myelodysplastic syndromes88 but downregulated in multiple myeloma89 and chronic lymphocyte leukemia.79,90 hsa-miR-181a can serve as an oncogene46,54,5658,60,61,65,66,6870,87,91 or tumor suppressor,55,67,71,75,78,79,92 implicating its multifaceted and complex roles in the regulation of its target genes and signaling pathways associated with cancer initiation, growth, development, progression, and metastasis.

In the present study, our bioinformatic study predicted that hsa-miR-181a could regulate a large number of targets, including proteins that participate in regulation of cell proliferation, cell cycle, apoptosis, autophagy, metabolism, signaling transduction, and transport. A further search in TarBase and miRTarBase identified 313 targets of hsa-miR-181a-5p, and 22 of these genes are cancer genes that play critical roles in the tumorigenesis of various cancers.

During the prediction process, we employed ten different predicting programs that are based on different matching criteria and calculating algorithms. All the algorithms displayed disappointing predictive accuracy and ability when compared with the validated targets of hsa-miR-181a. It appears that there is a need to refine or combine these algorithms to improve their predictive accuracy and ability. Indeed, most of these prediction algorithms, including RNAhybrid, miRanda, TargetScan, DIANA microT, and PicTar exhaustively analyze all the possible miRNA: mRNA pairs, searching for structural evidence that could suggest the existence of an interaction. Although these approaches are significantly cheaper than those based on experimental validation, results of these methods are in many cases uncorrelated to each other, and their degree of overlap is low as shown in this study. The weakness of these algorithms depends on many factors, especially on the impossibility of incorporating in a single model all the possible interplaying variants/factors that can affect miRNA targeting and the prediction outcomes, especially in mammals. Different results can also depend on the approach used and on the rules considered for the miRNA targeting, as well as on the type of resource of sequences they use as a reference dataset.93 Shirdel et al94 found that the precision and recall values computed against validated interactions of a specific algorithm were generally poor, but a combination of these algorithms can improve the prediction precision. Recently, some machine learning approaches have been incorporated, to learn to combine the outputs of distinct prediction algorithms and improve their accuracy.9597 Zhang and Verbeek97 proposed the application of a supervised learning algorithm, ie, a Bayesian network learner, to distinct sets of features considered in three prediction algorithms, including RNAhybrid, miRanda, and TargetScan. Pio et al96 proposed a semisupervised ensemble learning approach using miRTarBase as the set of labeled (positive) interactions and microRNA Data Integration Portal (mirDIP) as the set of unlabeled interactions, and the predictive accuracy was improved.

We next compared the expression levels of hsa-miR-181a in normal endometrium, endometrial hyperplasia, and type I and type II EC. We found that the expression level of hsa-miR-181a was significantly higher in EC than that in normal endometrium and that advanced EC exhibited a higher expression level of hsa-miR-181a. These observations demonstrate that there was an association between the expression level of hsa-miR-181a and the progression of EC and that hsa-miR-181a might serve as an oncogene in the development and progression of EC.

Many miRNAs are aberrantly expressed in cancer, resulting in functional alterations in cell differentiation, proliferation, migration, invasion, programmed cell death, and survival.5,6,8,53 A number of oncogenes and tumor-suppressor genes could be potentially regulated by miRNAs. miRNAs are presumed to be a class of genes involved in human tumorigenesis, and miRNA-mediated gene regulation is an important cellular biologic process in cancer development.5,6,8,53 For example, let-7 acts as tumor suppressor gene, which was found to be downregulated in lung tumors and associated with a poor postoperative prognosis.98 It has been showed that the RAS oncogene was regulated by let-7 and that a decreased expression level of let-7 in lung cancer resulted in an increase in the expression level of the RAS oncogene.99

Many studies have showed that upregulation of hsa-miR-181a promotes carcinogenesis, cancer cell growth, and metastasis in a variety of cancers, via regulation of a number of molecular targets and signaling pathways related to cell proliferation, invasion, migration, survival, and cell death.46,54,5658,60,61,65,66,6870,87,91 Zou et al87 observed an increase in the expression level of hsa-miR-181a, which may contribute to the development and progression of hepatocellular carcinoma via targeting of E2F transcription factor 5, p130-binding (E2F5). hsa-miR-181a was also upregulated in hepatocellular cancer stem cells.86,100 Silencing hsa-miR-181 led to a decreased motility and invasion of hepatocellular cancer stem cells, via targeting of the putative tumor suppressor Ras association domain family 1 isoform A (RASSF1), metalloproteinase inhibitor 3 (ie, TIMP3), and nemo-like kinase (NLK).100 has-miR-181 could directly target hepatic transcriptional regulators of differentiation, including caudal type homeobox 2 (CDX2), GATA binding protein 6 (GATA6), and NLK, an inhibitor of Wnt/β-catenin signaling.86 hsa-miR-181a promoted tumor growth and liver metastasis in colorectal cancer patients by targeting the tumor suppressor WNT inhibitory factor 1 (WIF1).28 hsa-miR-181a was most elevated in these colorectal cancer patients with liver metastases and could serve as an independent prognostic factor of poor overall survival.28 hsa-miR-181a showed a potent tumor-promoting effect through inhibition of the expression of WIF1 and promotion of epithelial–mesenchymal transition.28 Moreover, upregulation of hsa-miR-181a plays a potential role in the development of gastric cancer by targeting the tumor suppressor ATM serine/threonine kinase (ATM). Consequently, it leads to promotion of gastric cancer cell proliferation and inhibition of apoptosis. Wei et al101 showed that the PTEN/Akt signaling pathway was involved in the regulatory effect of hsa-miR-181a in the development of colon cancer, by promoting cell growth. hsa-miR-181a also played an important role in ovarian cancer progression, by promoting epithelial–mesenchymal transition.54 These data indicate that hsa-miR-181a may function as oncogenic miRNA in cancer development and progression. In agreement with previous studies, our findings showed that there was a significant increase in the expression level of hsa-miR-181a in EC compared with that in normal endometrium. Moreover, our results showed that advanced EC had a significant higher expression level of hsa-miR-181a than that in early stage of EC, suggesting that hsa-miR-181a may have a critical role in tumor metastasis of advanced EC.

On the other hand, hsa-miR-181 may function as a tumor suppressor. In glioma, hsa-miR-181a was shown to be downregulated.30 Both hsa-miR-181a and hsa-miR-181b triggered growth inhibition, induced apoptosis, and inhibited invasion in glioma cells. Transiently overexpressed hsa-miR-181a significantly sensitized malignant glioma U87MG cells to radiation with downregulated BCL2.55 In chronic lymphocytic leukemia, hsa-miR-181a together with hsa-miR-15a, hsa-miR-16-1, hsa-miR-29b, and hsa-miR-181b were all downregulated.90 These miRNAs may play a role in the pathogenesis of chronic lymphocytic leukemia and serve as new biomarkers for the prediction of prognosis in chronic lymphocytic leukemia. hsa-miR-181a expression level was found to be significantly lower in poor prognosis patients, and a low expression of hsa-miR-181a and hsa-miR-181b was associated with shorter overall survival and treatment-free survival in patients with chronic lymphocytic leukemia.79 Furthermore, hsa-miR-181a inhibited the migration, invasion, and proliferation of salivary adenoid cystic carcinoma cells, and suppressed tumor growth and lung metastasis in nude mice, via targeting of MAP2K1, MAPK1, and SNAI2.75

Based on our DAVID and KEGG pathway analysis, PI3K/Akt, MAPK, and Wnt signaling pathways played important roles in the development of type I EC. CCND1, HRAS, and KRAS are all key components in these pathways, which are all validated targets of hsa-miR-181a.

The expression level of hsa-miR-181a has been proposed as a potential biomarker for assessing prognosis and therapeutic response in cancer. Ouyang et al102 suggested that hsa-miR-181a may be a potential biomarker for predicting chemoresistance in the treatment of triple negative breast cancer. It also has been showed that hsa-miRNA-181a enhanced the chemoresistance of human cervical squamous cell carcinoma to cisplatin by targeting protein kinase Cδ69 and that hsa-miR-181a may serve an oncologic miRNA biomarker for luminal A-like breast cancer.67 Interestingly, Pichler et al59 showed a reverse correlation between hsa-miR-181a expression level and survival rate in patients with colorectal cancer. In our study, we observed a significant difference in the expression level of hsa-miR-181a among normal endometrium, endometrial hyperplasia, and EC, and a higher expression level of hsa-miR-181a in advanced EC. Our findings suggest that the expression level of hsa-miR-181a might serve as a useful biomarker for the prediction of prognosis of EC in clinic.

In summary, our bioinformatics studies have showed that hsa-miR-181a might regulate a large number of target genes that are important in the regulation of critical cell processes. To date, 313 targets of hsa-miR-181a have been validated, and 22 of these targets are cancer genes. Many of these genes are involved in tumorigenesis of various cancers, including EC. Our data demonstrate that hsa-miR-181a is upregulated in EC, with a possible role in the development and progression of EC (Figure 12). It might serve as a new biomarker for prognosis prediction in EC in clinical practice and has important implication in the treatment of EC. More mechanistic and functional studies are needed to validate the role of hsa-miR-181a in the pathogenesis of EC and to establish the association between the expression level of hsa-miR-181a and the clinical phenotypes, including disease status and therapeutic response of EC to chemo- and radiotherapy.

Figure 12.

Figure 12

Proposed mechanisms for how hsa-miR-181a regulates cancer genes and may serve as an oncogene for the development of EC.

Notes: hsa-miR-181a may play a role in the tumorigenesis of EC via multiple pathways that interplay with many important oncogenes and tumor suppressors. hsa-miR-181a may interact with H3F3B, ATM, CCDC6, TAF15, RAS, and PLAG1 to promote cell proliferation. It may suppress cell apoptosis via interaction with NOTCH1, NOTCH2, MAPK1, and BCL2. It may affect ubiquitin-mediated proteolysis via regulation of FBXO11, STAG2, BRCA2, HOXA11, and RBM15. All these actions may transform the normal endometrial cells into tumor cells.

Abbreviation: EC, endometrial cancer; ATM, ATM serine/threonine kinase; BCL2, B-cell lymphoma 2; CCDC6, coiled-coil domain containing 6; PLAG1, pleiomorphic adenoma gene 1; MAPK1, mitogen activated kinase-like protein 1; RAS, rat sarcoma viral oncogene homolog; BRCA2, breast cancer 2, early onset; STAG2, stromal antigen 2; HOXA11, homeobox A11; RBM15, RNA binding motif protein 15; NOTCH1, notch 1; H3F3B, H3 histone, family 3B; FBXO11, F-box protein 11; TAF15, TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68 kDa; HOOK3, hook microtubule-tethering protein 3; PTPN11, protein tyrosine phosphatase, non-receptor type 11; TSHR, thyroid stimulating hormone receptor; CDX2, caudal type homeobox 2; EP300, E1A binding protein p300.

Supplementary materials

Table S1 A full list of cancer genes, based on Futreal et al1. Reprinted by permission from Macmillan Publishers Ltd: Nature Reviews Cancer. Futreal PA, Coin L, Marshall M, et al. A census of human cancer genes. Nat Rev Cancer. 2004;4(3):177–183. Copyright © 2004.1

Table S2 Predicted targets of hsa-miR-181a-5p, by DIANA microT v5.0

Table S3 Predicted targets of hsa-miR-181a-5p, by miRanda-mirSVR

Table S4 Predicted targets of hsa-miR-181a-5p, by miRanda-mirSVR, that are cancer genes

Table S5 Predicted targets of hsa-miR-181a-5p, by miRDB

Table S6 Predicted targets of hsa-miR-181a-5p, by RNA22 v2

Table S7 Predicted targets of hsa-miR-181a-5p, by RNA22 v2, that are cancer genes

Table S8 Predicted targets of hsa-miR-181a-5p, by TargetMiner

Table S9 Predicted targets of hsa-miR-181a-5p, by TargetScan 6.2

Table S10 Predicted targets of hsa-miR-181a-5p, by PicTar

Table S11 Predicted targets of hsa-miR-181a-5p, by MicroCosm Targets v5

Table S12 Predicted targets of hsa-miR-181a-3p, by DIANA microT v5.0

Table S13 Predicted targets of hsa-miR-181a-3p, by miRanda-mirSVR

Table S14 Predicted targets of hsa-miR-181a-3p, by miRanda-mirSVR, that are cancer genes

Table S15 Predicted targets of hsa-miR-181a-3p, by miRDB

Table S16 Predicted targets of hsa-miR-181a-3p, by RNA22 v2

Table S17 Predicted targets of hsa-miR-181a-3p, by TargetMiner

Table S18 Predicted targets of hsa-miR-181a-5p, by MicroCosm Targets v5

Table S19 Predicted targets of hsa-miR-181a, by miRWALK

Table S20 Predicted genes of hsa-miR-181a, by miRWALK

Table S21 A summarized table that includes all the targets predicted to be regulated by hsa-miR-181a by the eight algorithms

Figure S1

Analysis of hsa-miR-181a expression in a human endometrial specimen by real-time PCR.

Notes: (A) Melting curve showing the single melt peak for hsa-miR-181a and U6, respectively; and (B) the amplification plot of the target gene.

Abbreviation: PCR, polymerase chain reaction.

dddt-9-1103s1.tif (1.4MB, tif)

Reference

Acknowledgments

This work was supported by Guangdong Natural Science Foundation (grant number S2012010010024), Guangzhou, People’s Republic of China. Dr Zhi-Wei Zhou is a postdoctoral fellow supported by the College of Pharmacy, University of South Florida, Tampa, FL, USA.

Footnotes

Disclosure

The authors report no conflicts of interest in this work.

References

  • 1.Croce CM, Calin GA. miRNAs, cancer, and stem cell division. Cell. 2005;122(1):6–7. doi: 10.1016/j.cell.2005.06.036. [DOI] [PubMed] [Google Scholar]
  • 2.Yates LA, Norbury CJ, Gilbert RJ. The long and short of microRNA. Cell. 2013;153(3):516–519. doi: 10.1016/j.cell.2013.04.003. [DOI] [PubMed] [Google Scholar]
  • 3.Lu J, Getz G, Miska EA, et al. MicroRNA expression profiles classify human cancers. Nature. 2005;435(7043):834–838. doi: 10.1038/nature03702. [DOI] [PubMed] [Google Scholar]
  • 4.Banno K, Yanokura M, Kisu I, Yamagami W, Susumu N, Aoki D. MicroRNAs in endometrial cancer. Int J Clin Oncol. 2013;18(2):186–192. doi: 10.1007/s10147-013-0526-9. [DOI] [PubMed] [Google Scholar]
  • 5.Lujambio A, Lowe SW. The microcosmos of cancer. Nature. 2012;482(7385):347–355. doi: 10.1038/nature10888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Esquela-Kerscher A, Slack FJ. Oncomirs – microRNAs with a role in cancer. Nat Rev Cancer. 2006;6(4):259–269. doi: 10.1038/nrc1840. [DOI] [PubMed] [Google Scholar]
  • 7.Ryan BM, Robles AI, Harris CC. Genetic variation in microRNA networks: the implications for cancer research. Nat Rev Cancer. 2010;10(6):389–402. doi: 10.1038/nrc2867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Nana-Sinkam SP, Croce CM. Clinical applications for microRNAs in cancer. Clin Pharmacol Ther. 2013;93(1):98–104. doi: 10.1038/clpt.2012.192. [DOI] [PubMed] [Google Scholar]
  • 9.Ritchie W, Rasko JE. Refining microRNA target predictions: sorting the wheat from the chaff. Biochem Biophys Res Commun. 2014;445(4):780–784. doi: 10.1016/j.bbrc.2014.01.181. [DOI] [PubMed] [Google Scholar]
  • 10.Peterson SM, Thompson JA, Ufkin ML, Sathyanarayana P, Liaw L, Congdon CB. Common features of microRNA target prediction tools. Front Genet. 2014;5:23. doi: 10.3389/fgene.2014.00023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ferlay J, Soerjomataram I, Ervik M, et al. GLOBOCAN 2012 v.10, Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 11 [Internet] Lyon: International Agency for Research on Cancer; 2013. [Accessed November 10, 2014]. Available from: http://globocan.iarc.fr. [Google Scholar]
  • 12.Howlader N, Noone AM, Krapcho M, et al. SEER Cancer Statistics Review, 1975–2011. Bethesda, MD: National Cancer Institute; 2014. [Google Scholar]
  • 13.Balch C, Matei DE, Huang TH, Nephew KP. Role of epigenomics in ovarian and endometrial cancers. Epigenomics. 2010;2(3):419–447. doi: 10.2217/epi.10.19. [DOI] [PubMed] [Google Scholar]
  • 14.Amant F, Moerman P, Neven P, Timmerman D, Van Limbergen E, Vergote I. Endometrial cancer. Lancet. 2005;366(9484):491–505. doi: 10.1016/S0140-6736(05)67063-8. [DOI] [PubMed] [Google Scholar]
  • 15.Colombo N, Preti E, Landoni F, et al. ESMO Guidelines Working Group Endometrial cancer: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol. 2013;24(Suppl 6):vi33–vi38. doi: 10.1093/annonc/mdt353. [DOI] [PubMed] [Google Scholar]
  • 16.Hecht JL, Mutter GL. Molecular and pathologic aspects of endometrial carcinogenesis. J Clin Oncol. 2006;24(29):4783–4791. doi: 10.1200/JCO.2006.06.7173. [DOI] [PubMed] [Google Scholar]
  • 17.Yeramian A, Moreno-Bueno G, Dolcet X, et al. Endometrial carcinoma: molecular alterations involved in tumor development and progression. Oncogene. 2013;32(4):403–413. doi: 10.1038/onc.2012.76. [DOI] [PubMed] [Google Scholar]
  • 18.National Cancer Institute . Endometrial Cancer: 2014. [Accessed December 15, 2014]. Available from http://www.cancer.gov/cancertopics/types/endometrial. [Google Scholar]
  • 19.Dong P, Kaneuchi M, Konno Y, Watari H, Sudo S, Sakuragi N. Emerging therapeutic biomarkers in endometrial cancer. Biomed Res Int. 2013;2013:130362. doi: 10.1155/2013/130362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ow TJ, Sandulache VC, Skinner HD, Myers JN. Integration of cancer genomics with treatment selection: from the genome to predictive biomarkers. Cancer. 2013;119(22):3914–3928. doi: 10.1002/cncr.28304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Mitra S, Das S, Chakrabarti J. Systems biology of cancer biomarker detection. Cancer Biomark. 2013;13(4):201–213. doi: 10.3233/CBM-130363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Widschwendter M, Jones A, Teschendorff AE. Epigenetics makes its mark on women-specific cancers – an opportunity to redefine oncological approaches? Gynecol Oncol. 2013;128(1):134–143. doi: 10.1016/j.ygyno.2012.09.027. [DOI] [PubMed] [Google Scholar]
  • 23.Schwarzenbach H, Hoon DS, Pantel K. Cell-free nucleic acids as biomarkers in cancer patients. Nat Rev Cancer. 2011;11(6):426–437. doi: 10.1038/nrc3066. [DOI] [PubMed] [Google Scholar]
  • 24.Kasinski AL, Slack FJ. Epigenetics and genetics. MicroRNAs en route to the clinic: progress in validating and targeting microRNAs for cancer therapy. Nat Rev Cancer. 2011;11(12):849–864. doi: 10.1038/nrc3166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Chen CZ, Li L, Lodish HF, Bartel DP. MicroRNAs modulate hematopoietic lineage differentiation. Science. 2004;303(5654):83–86. doi: 10.1126/science.1091903. [DOI] [PubMed] [Google Scholar]
  • 26.Lin Y, Nie Y, Zhao J, et al. Genetic polymorphism at miR-181a binding site contributes to gastric cancer susceptibility. Carcinogenesis. 2012;33(12):2377–2383. doi: 10.1093/carcin/bgs292. [DOI] [PubMed] [Google Scholar]
  • 27.Havelange V, Stauffer N, Heaphy CC, et al. Functional implications of microRNAs in acute myeloid leukemia by integrating microRNA and messenger RNA expression profiling. Cancer. 2011;117(20):4696–4706. doi: 10.1002/cncr.26096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ji D, Chen Z, Li M, et al. MicroRNA-181a promotes tumor growth and liver metastasis in colorectal cancer by targeting the tumor suppressor WIF-1. Mol Cancer. 2014;13:86. doi: 10.1186/1476-4598-13-86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Fei J, Li Y, Zhu X, Luo X. miR-181a post-transcriptionally downregulates oncogenic RalA and contributes to growth inhibition and apoptosis in chronic myelogenous leukemia (CML) PLoS One. 2012;7(3):e32834. doi: 10.1371/journal.pone.0032834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Shi L, Cheng Z, Zhang J, et al. hsa-mir-181a and hsa-mir-181b function as tumor suppressors in human glioma cells. Brain Res. 2008;1236:185–193. doi: 10.1016/j.brainres.2008.07.085. [DOI] [PubMed] [Google Scholar]
  • 31.Panda H, Chuang TD, Luo X, Chegini N. Endometrial miR-181a and miR-98 expression is altered during transition from normal into cancerous state and target PGR, PGRMC1, CYP19A1, DDX3X, and TIMP3. J Clin Endocrinol Metab. 2012;97(7):E1316–E1326. doi: 10.1210/jc.2012-1018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kozomara A, Griffiths-Jones S. miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 2014;42(Database issue):D68–D73. doi: 10.1093/nar/gkt1181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kozomara A, Griffiths-Jones S. miRBase: integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res. 2011;39(Database issue):D152–D157. doi: 10.1093/nar/gkq1027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res. 2006;34(Database issue):D140–D144. doi: 10.1093/nar/gkj112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Betel D, Koppal A, Agius P, Sander C, Leslie C. Comprehensive modeling of microRNA targets predicts functional non-conserved and non-canonical sites. Genome Biol. 2010;11(8):R90. doi: 10.1186/gb-2010-11-8-r90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Maragkakis M, Alexiou P, Papadopoulos GL, et al. Accurate microRNA target prediction correlates with protein repression levels. BMC Bioinformatics. 2009;10:295. doi: 10.1186/1471-2105-10-295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Paraskevopoulou MD, Georgakilas G, Kostoulas N, et al. DIANA-microT web server v5.0: service integration into miRNA functional analysis workflows. Nucleic Acids Res. 2013;41(Web Server issue):W169–W173. doi: 10.1093/nar/gkt393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wang X. miRDB: a microRNA target prediction and functional annotation database with a wiki interface. RNA. 2008;14(6):1012–1017. doi: 10.1261/rna.965408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Miranda KC, Huynh T, Tay Y, et al. A pattern-based method for the identification of MicroRNA binding sites and their corresponding heteroduplexes. Cell. 2006;126(6):1203–1217. doi: 10.1016/j.cell.2006.07.031. [DOI] [PubMed] [Google Scholar]
  • 40.Bandyopadhyay S, Mitra R. TargetMiner: microRNA target prediction with systematic identification of tissue-specific negative examples. Bioinformatics. 2009;25(20):2625–2631. doi: 10.1093/bioinformatics/btp503. [DOI] [PubMed] [Google Scholar]
  • 41.Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. 2005;120(1):15–20. doi: 10.1016/j.cell.2004.12.035. [DOI] [PubMed] [Google Scholar]
  • 42.Garcia DM, Baek D, Shin C, Bell GW, Grimson A, Bartel DP. Weak seed-pairing stability and high target-site abundance decrease the proficiency of lsy-6 and other microRNAs. Nat Struct Mol Biol. 2011;18(10):1139–1146. doi: 10.1038/nsmb.2115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Krek A, Grün D, Poy MN, et al. Combinatorial microRNA target predictions. Nat Genet. 2005;37(5):495–500. doi: 10.1038/ng1536. [DOI] [PubMed] [Google Scholar]
  • 44.Dweep H, Sticht C, Pandey P, Gretz N. miRWALK – database: prediction of possible miRNA binding sites by “walking” the genes of three genomes. J Biomed Inform. 2011;44(5):839–847. doi: 10.1016/j.jbi.2011.05.002. [DOI] [PubMed] [Google Scholar]
  • 45.Vergoulis T, Vlachos IS, Alexiou P, et al. TarBase 6.0: capturing the exponential growth of miRNA targets with experimental support. Nucleic Acids Res. 2012;40(Database issue):D222–D229. doi: 10.1093/nar/gkr1161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Hsu SD, Tseng YT, Shrestha S, et al. miRTarBase update 2014: an information resource for experimentally validated miRNA-target interactions. Nucleic Acids Res. 2014;42(Database issue):D78–D85. doi: 10.1093/nar/gkt1266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Futreal PA, Coin L, Marshall M, et al. A census of human cancer genes. Nat Rev Cancer. 2004;4(3):177–183. doi: 10.1038/nrc1299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Vogelstein B, Papadopoulos N, Velculescu VE, Zhou S, Diaz LA, Jr, Kinzler KW. Cancer genome landscapes. Science. 2013;339(6127):1546–1558. doi: 10.1126/science.1235122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Huang da W, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4(1):44–57. doi: 10.1038/nprot.2008.211. [DOI] [PubMed] [Google Scholar]
  • 50.Huang da W, Sherman BT, Tan Q, et al. DAVID bioinformatics resources: expanded annotation database and novel algorithms to better extract biology from large gene lists. Nucleic Acids Res. 2007;35(Web Server issue):W169–W175. doi: 10.1093/nar/gkm415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Pecorelli S. Revised FIGO staging for carcinoma of the vulva, cervix, and endometrium. Int J Gynaecol Obstet. 2009;105(2):103–104. doi: 10.1016/j.ijgo.2009.02.012. [DOI] [PubMed] [Google Scholar]
  • 52.Di Leva G, Garofalo M, Croce CM. MicroRNAs in cancer. Annu Rev Pathol. 2014;9:287–314. doi: 10.1146/annurev-pathol-012513-104715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Gilabert-Estelles J, Braza-Boils A, Ramon LA, et al. Role of microRNAs in gynecological pathology. Curr Med Chem. 2012;19(15):2406–2413. doi: 10.2174/092986712800269362. [DOI] [PubMed] [Google Scholar]
  • 54.Parikh A, Lee C, Peronne J, et al. microRNA-181a has a critical role in ovarian cancer progression through the regulation of the epithelial-mesenchymal transition. Nat Commun. 2014;5:2977. doi: 10.1038/ncomms3977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Chen G, Zhu W, Shi D, et al. MicroRNA-181a sensitizes human malignant glioma U87MG cells to radiation by targeting Bcl-2. Oncol Rep. 2010;23(4):997–1003. doi: 10.3892/or_00000725. [DOI] [PubMed] [Google Scholar]
  • 56.Brockhausen J, Tay SS, Grzelak CA, et al. miR-181a mediates TGF-β-induced hepatocyte EMT and is dysregulated in cirrhosis and hepatocellular cancer. Liver Int. 2015;35(1):240–253. doi: 10.1111/liv.12517. [DOI] [PubMed] [Google Scholar]
  • 57.Nishimura J, Handa R, Yamamoto H, et al. microRNA-181a is associated with poor prognosis of colorectal cancer. Oncol Rep. 2012;28(6):2221–2226. doi: 10.3892/or.2012.2059. [DOI] [PubMed] [Google Scholar]
  • 58.Zou C, Chen J, Chen K, et al. Functional analysis of miR-181a and Fas involved in hepatitis B virus-related hepatocellular carcinoma pathogenesis. Exp Cell Res. 2015 doi: 10.1016/j.yexcr.2014.11.007. [Epub ahead of print] [DOI] [PubMed] [Google Scholar]
  • 59.Pichler M, Winter E, Ress AL, et al. miR-181a is associated with poor clinical outcome in patients with colorectal cancer treated with EGFR inhibitor. J Clin Pathol. 2014;67(3):198–203. doi: 10.1136/jclinpath-2013-201904. [DOI] [PubMed] [Google Scholar]
  • 60.Zhang X, Nie Y, Du Y, Cao J, Shen B, Li Y. MicroRNA-181a promotes gastric cancer by negatively regulating tumor suppressor KLF6. Tumour Biol. 2012;33(5):1589–1597. doi: 10.1007/s13277-012-0414-3. [DOI] [PubMed] [Google Scholar]
  • 61.Zhang X, Nie Y, Li X, et al. MicroRNA-181a functions as an oncomir in gastric cancer by targeting the tumour suppressor gene ATM. Pathol Oncol Res. 2014;20(2):381–389. doi: 10.1007/s12253-013-9707-0. [DOI] [PubMed] [Google Scholar]
  • 62.Galluzzi L, Morselli E, Vitale I, et al. miR-181a and miR-630 regulate cisplatin-induced cancer cell death. Cancer Res. 2010;70(5):1793–1803. doi: 10.1158/0008-5472.CAN-09-3112. [DOI] [PubMed] [Google Scholar]
  • 63.Farazi TA, Horlings HM, Ten Hoeve JJ, et al. MicroRNA sequence and expression analysis in breast tumors by deep sequencing. Cancer Res. 2011;71(13):4443–4453. doi: 10.1158/0008-5472.CAN-11-0608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Guo LJ, Zhang QY. Decreased serum miR-181a is a potential new tool for breast cancer screening. Int J Mol Med. 2012;30(3):680–686. doi: 10.3892/ijmm.2012.1021. [DOI] [PubMed] [Google Scholar]
  • 65.Taylor MA, Sossey-Alaoui K, Thompson CL, Danielpour D, Schiemann WP. TGF-β upregulates miR-181a expression to promote breast cancer metastasis. J Clin Invest. 2013;123(1):150–163. doi: 10.1172/JCI64946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Bisso A, Faleschini M, Zampa F, et al. Oncogenic miR-181a/b affect the DNA damage response in aggressive breast cancer. Cell Cycle. 2013;12(11):1679–1687. doi: 10.4161/cc.24757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.McDermott AM, Miller N, Wall D, et al. Identification and validation of oncologic miRNA biomarkers for luminal A-like breast cancer. PLoS One. 2014;9(1):e87032. doi: 10.1371/journal.pone.0087032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Ke G, Liang L, Yang JM, et al. MiR-181a confers resistance of cervical cancer to radiation therapy through targeting the pro-apoptotic PRKCD gene. Oncogene. 2013;32(25):3019–3027. doi: 10.1038/onc.2012.323. [DOI] [PubMed] [Google Scholar]
  • 69.Chen Y, Ke G, Han D, Liang S, Yang G, Wu X. MicroRNA-181a enhances the chemoresistance of human cervical squamous cell carcinoma to cisplatin by targeting PRKCD. Exp Cell Res. 2014;320(1):12–20. doi: 10.1016/j.yexcr.2013.10.014. [DOI] [PubMed] [Google Scholar]
  • 70.Jianwei Z, Fan L, Xiancheng L, Enzhong B, Shuai L, Can L. MicroRNA 181a improves proliferation and invasion, suppresses apoptosis of osteosarcoma cell. Tumour Biol. 2013;34(6):3331–3337. doi: 10.1007/s13277-013-0902-0. [DOI] [PubMed] [Google Scholar]
  • 71.Shin KH, Bae SD, Hong HS, Kim RH, Kang MK, Park NH. miR-181a shows tumor suppressive effect against oral squamous cell carcinoma cells by downregulating K-ras. Biochem Biophys Res Commun. 2011;404(4):896–902. doi: 10.1016/j.bbrc.2010.12.055. [DOI] [PubMed] [Google Scholar]
  • 72.Liu M, Wang J, Huang H, Hou J, Zhang B, Wang A. miR-181a-Twist1 pathway in the chemoresistance of tongue squamous cell carcinoma. Biochem Biophys Res Commun. 2013;441(2):364–370. doi: 10.1016/j.bbrc.2013.10.051. [DOI] [PubMed] [Google Scholar]
  • 73.Alencar AJ, Malumbres R, Kozloski GA, et al. MicroRNAs are independent predictors of outcome in diffuse large B-cell lymphoma patients treated with R-CHOP. Clin Cancer Res. 2011;17(12):4125–4135. doi: 10.1158/1078-0432.CCR-11-0224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Keutgen XM, Filicori F, Crowley MJ, et al. A panel of four miRNAs accurately differentiates malignant from benign indeterminate thyroid lesions on fine needle aspiration. Clin Cancer Res. 2012;18(7):2032–2038. doi: 10.1158/1078-0432.CCR-11-2487. [DOI] [PubMed] [Google Scholar]
  • 75.He Q, Zhou X, Li S, et al. MicroRNA-181a suppresses salivary adenoid cystic carcinoma metastasis by targeting MAPK-Snai2 pathway. Biochim Biophys Acta. 2013;1830(11):5258–5266. doi: 10.1016/j.bbagen.2013.07.028. [DOI] [PubMed] [Google Scholar]
  • 76.Debernardi S, Skoulakis S, Molloy G, Chaplin T, Dixon-McIver A, Young BD. MicroRNA miR-181a correlates with morphological subclass of acute myeloid leukaemia and the expression of its target genes in global genome-wide analysis. Leukemia. 2007;21(5):912–916. doi: 10.1038/sj.leu.2404605. [DOI] [PubMed] [Google Scholar]
  • 77.Cuesta R, Martínez-Sánchez A, Gebauer F. miR-181a regulates cap-dependent translation of p27(kip1) mRNA in myeloid cells. Mol Cell Biol. 2009;29(10):2841–2851. doi: 10.1128/MCB.01971-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Bai H, Cao Z, Deng C, Zhou L, Wang C. miR-181a sensitizes resistant leukaemia HL-60/Ara-C cells to Ara-C by inducing apoptosis. J Cancer Res Clin Oncol. 2012;138(4):595–602. doi: 10.1007/s00432-011-1137-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Zhu DX, Zhu W, Fang C, et al. miR-181a/b significantly enhances drug sensitivity in chronic lymphocytic leukemia cells via targeting multiple anti-apoptosis genes. Carcinogenesis. 2012;33(7):1294–1301. doi: 10.1093/carcin/bgs179. [DOI] [PubMed] [Google Scholar]
  • 80.Dahlhaus M, Schult C, Lange S, Freund M, Junghanss C. MicroRNA 181a influences the expression of HMGB1 and CD4 in acute leukemias. Anticancer Res. 2013;33(2):445–452. [PubMed] [Google Scholar]
  • 81.Lin S, Pan L, Guo S, et al. Prognostic role of microRNA-181a/b in hematological malignancies: a meta-analysis. PLoS One. 2013;8(3):e59532. doi: 10.1371/journal.pone.0059532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Ciafrè SA, Galardi S, Mangiola A, et al. Extensive modulation of a set of microRNAs in primary glioblastoma. Biochem Biophys Res Commun. 2005;334(4):1351–1358. doi: 10.1016/j.bbrc.2005.07.030. [DOI] [PubMed] [Google Scholar]
  • 83.Gao W, Shen H, Liu L, Xu J, Xu J, Shu Y. MiR-21 overexpression in human primary squamous cell lung carcinoma is associated with poor patient prognosis. J Cancer Res Clin Oncol. 2011;137(4):557–566. doi: 10.1007/s00432-010-0918-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Gao W, Yu Y, Cao H, et al. Deregulated expression of miR-21, miR-143 and miR-181a in non small cell lung cancer is related to clinicopathologic characteristics or patient prognosis. Biomed Pharmacother. 2010;64(6):399–408. doi: 10.1016/j.biopha.2010.01.018. [DOI] [PubMed] [Google Scholar]
  • 85.Miller TE, Ghoshal K, Ramaswamy B, et al. MicroRNA-221/222 confers tamoxifen resistance in breast cancer by targeting p27Kip1. J Biol Chem. 2008;283(44):29897–29903. doi: 10.1074/jbc.M804612200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Ji J, Yamashita T, Budhu A, et al. Identification of microRNA-181 by genome-wide screening as a critical player in EpCAM-positive hepatic cancer stem cells. Hepatology. 2009;50(2):472–480. doi: 10.1002/hep.22989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Zou C, Li Y, Cao Y, et al. Up-regulated MicroRNA-181a induces carcinogenesis in hepatitis B virus-related hepatocellular carcinoma by targeting E2F5. BMC Cancer. 2014;14:97. doi: 10.1186/1471-2407-14-97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Pons A, Nomdedeu B, Navarro A, et al. Hematopoiesis-related microRNA expression in myelodysplastic syndromes. Leuk Lymphoma. 2009;50(11):1854–1859. doi: 10.3109/10428190903147645. [DOI] [PubMed] [Google Scholar]
  • 89.Pichiorri F, Suh SS, Ladetto M, et al. MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis. Proc Natl Acad Sci U S A. 2008;105(35):12885–12890. doi: 10.1073/pnas.0806202105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Zhu DX, Miao KR, Fang C, et al. Aberrant microRNA expression in Chinese patients with chronic lymphocytic leukemia. Leuk Res. 2011;35(6):730–734. doi: 10.1016/j.leukres.2010.11.005. [DOI] [PubMed] [Google Scholar]
  • 91.Albulescu R. TGF-β upregulates miR-181a expression to promote breast cancer metastasis. Biomark Med. 2013;7(2):204. [PubMed] [Google Scholar]
  • 92.Jiao X, Zhao L, Ma M, et al. MiR-181a enhances drug sensitivity in mitoxantone-resistant breast cancer cells by targeting breast cancer resistance protein (BCRP/ABCG2) Breast Cancer Res Treat. 2013;139(3):717–730. doi: 10.1007/s10549-013-2607-x. [DOI] [PubMed] [Google Scholar]
  • 93.Ritchie W, Flamant S, Rasko JE. Predicting microRNA targets and functions: traps for the unwary. Nat Methods. 2009;6(6):397–398. doi: 10.1038/nmeth0609-397. [DOI] [PubMed] [Google Scholar]
  • 94.Shirdel EA, Xie W, Mak TW, Jurisica I. NAViGaTing the micronome – using multiple microRNA prediction databases to identify signalling pathway-associated microRNAs. PLoS One. 2011;6(2):e17429. doi: 10.1371/journal.pone.0017429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Godsey B. Discovery of miR-mRNA interactions via simultaneous Bayesian inference of gene networks and clusters using sequence-based predictions and expression data. J Integr Bioinform. 2013;10(1):227. doi: 10.2390/biecoll-jib-2013-227. [DOI] [PubMed] [Google Scholar]
  • 96.Pio G, Malerba D, D’Elia D, Ceci M. Integrating microRNA target predictions for the discovery of gene regulatory networks: a semi-supervised ensemble learning approach. BMC Bioinformatics. 2014;15(Suppl 1):S4. doi: 10.1186/1471-2105-15-S1-S4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Zhang Y, Verbeek FJ. Comparison and integration of target prediction algorithms for microRNA studies. J Integr Bioinform. 2010;7(3) doi: 10.2390/biecoll-jib-2010-127. [DOI] [PubMed] [Google Scholar]
  • 98.Takamizawa J, Konishi H, Yanagisawa K, et al. Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer Res. 2004;64(11):3753–3756. doi: 10.1158/0008-5472.CAN-04-0637. [DOI] [PubMed] [Google Scholar]
  • 99.Johnson SM, Grosshans H, Shingara J, et al. RAS is regulated by the let-7 microRNA family. Cell. 2005;120(5):635–647. doi: 10.1016/j.cell.2005.01.014. [DOI] [PubMed] [Google Scholar]
  • 100.Meng F, Glaser SS, Francis H, et al. Functional analysis of microRNAs in human hepatocellular cancer stem cells. J Cell Mol Med. 2012;16(1):160–173. doi: 10.1111/j.1582-4934.2011.01282.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Wei Z, Cui L, Mei Z, Liu M, Zhang D. miR-181a mediates metabolic shift in colon cancer cells via the PTEN/AKT pathway. FEBS Lett. 2014;588(9):1773–1779. doi: 10.1016/j.febslet.2014.03.037. [DOI] [PubMed] [Google Scholar]
  • 102.Ouyang M, Li Y, Ye S, et al. MicroRNA profiling implies new markers of chemoresistance of triple-negative breast cancer. PLoS One. 2014;9(5):e96228. doi: 10.1371/journal.pone.0096228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 103.Clevers H, Nusse R. Wnt/β-catenin signaling and disease. Cell. 2012;149(6):1192–1205. doi: 10.1016/j.cell.2012.05.012. [DOI] [PubMed] [Google Scholar]
  • 104.MacDonald BT, Tamai K, He X. Wnt/β-catenin signaling: components, mechanisms, and diseases. Dev Cell. 2009;17(1):9–26. doi: 10.1016/j.devcel.2009.06.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105.Pijnenborg JM, Kisters N, van Engeland M, et al. APC, β-catenin, and E-cadherin and the development of recurrent endometrial carcinoma. Int J Gynecol Cancer. 2004;14(5):947–956. doi: 10.1111/j.1048-891X.2004.014534.x. [DOI] [PubMed] [Google Scholar]
  • 106.van der Zee M, Jia Y, Wang Y, et al. Alterations in Wnt-β-catenin and Pten signalling play distinct roles in endometrial cancer initiation and progression. J Pathol. 2013;230(1):48–58. doi: 10.1002/path.4160. [DOI] [PubMed] [Google Scholar]
  • 107.Liu Y, Meng F, Xu Y, et al. Overexpression of Wnt7a is associated with tumor progression and unfavorable prognosis in endometrial cancer. Int J Gynecol Cancer. 2013;23(2):304–311. doi: 10.1097/IGC.0b013e31827c7708. [DOI] [PubMed] [Google Scholar]
  • 108.Zhao Y, Yang Y, Trovik J, et al. A novel wnt regulatory axis in endometrioid endometrial cancer. Cancer Res. 2014;74(18):5103–5117. doi: 10.1158/0008-5472.CAN-14-0427. [DOI] [PubMed] [Google Scholar]
  • 109.Liu Y, Patel L, Mills GB, et al. Clinical significance of CTNNB1mutation and Wnt pathway activation in endometrioid endometrial carcinoma. J Natl Cancer Inst. 2014;106(9):dju245. doi: 10.1093/jnci/dju245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 110.Malumbres M, Barbacid M. Cell cycle, CDKs and cancer: a changing paradigm. Nat Rev Cancer. 2009;9(3):153–166. doi: 10.1038/nrc2602. [DOI] [PubMed] [Google Scholar]
  • 111.Plotnikov A, Zehorai E, Procaccia S, Seger R. The MAPK cascades: signaling components, nuclear roles and mechanisms of nuclear translocation. Biochim Biophys Acta. 2011;1813(9):1619–1633. doi: 10.1016/j.bbamcr.2010.12.012. [DOI] [PubMed] [Google Scholar]
  • 112.Ranganathan P, Weaver KL, Capobianco AJ. Notch signalling in solid tumours: a little bit of everything but not all the time. Nat Rev Cancer. 2011;11(5):338–351. doi: 10.1038/nrc3035. [DOI] [PubMed] [Google Scholar]
  • 113.Suzuki T, Aoki D, Susumu N, Udagawa Y, Nozawa S. Imbalanced expression of TAN-1 and human Notch4 in endometrial cancers. Int J Oncol. 2000;17(6):1131–1139. doi: 10.3892/ijo.17.6.1131. [DOI] [PubMed] [Google Scholar]
  • 114.Cobellis L, Caprio F, Trabucco E, et al. The pattern of expression of Notch protein members in normal and pathological endometrium. J Anat. 2008;213(4):464–472. doi: 10.1111/j.1469-7580.2008.00963.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 115.Mitsuhashi Y, Horiuchi A, Miyamoto T, Kashima H, Suzuki A, Shiozawa T. Prognostic significance of Notch signalling molecules and their involvement in the invasiveness of endometrial carcinoma cells. Histopathology. 2012;60(5):826–837. doi: 10.1111/j.1365-2559.2011.04158.x. [DOI] [PubMed] [Google Scholar]
  • 116.Jonusiene V, Sasnauskiene A, Lachej N, et al. Down-regulated expression of Notch signaling molecules in human endometrial cancer. Med Oncol. 2013;30(1):438. doi: 10.1007/s12032-012-0438-y. [DOI] [PubMed] [Google Scholar]
  • 117.Nickkho-Amiry M, McVey R, Holland C. Peroxisome proliferator-activated receptors modulate proliferation and angiogenesis in human endometrial carcinoma. Mol Cancer Res. 2012;10(3):441–453. doi: 10.1158/1541-7786.MCR-11-0233. [DOI] [PubMed] [Google Scholar]
  • 118.Pengchong H, Tao H. Expression of IGF-1R, VEGF-C and D2-40 and their correlation with lymph node metastasis in endometrial adenocarcinoma. Eur J Gynaecol Oncol. 2011;32(6):660–664. [PubMed] [Google Scholar]
  • 119.Dobrzycka B, Mackowiak-Matejczyk B, Kinalski M, Terlikowski SJ. Pretreatment serum levels of bFGF and VEGF and its clinical significance in endometrial carcinoma. Gynecol Oncol. 2013;128(3):454–460. doi: 10.1016/j.ygyno.2012.11.035. [DOI] [PubMed] [Google Scholar]
  • 120.Saarelainen SK, Staff S, Peltonen N, et al. Endoglin, VEGF, and its receptors in predicting metastases in endometrial carcinoma. Tumour Biol. 2014;35(5):4651–4657. doi: 10.1007/s13277-014-1609-6. [DOI] [PubMed] [Google Scholar]
  • 121.Wang J, Taylor A, Showeil R, et al. Expression profiling and significance of VEGF-A, VEGFR2, VEGFR3 and related proteins in endometrial carcinoma. Cytokine. 2014;68(2):94–100. doi: 10.1016/j.cyto.2014.04.005. [DOI] [PubMed] [Google Scholar]
  • 122.Saharinen P, Eklund L, Pulkki K, Bono P, Alitalo K. VEGF and angiopoietin signaling in tumor angiogenesis and metastasis. Trends Mol Med. 2011;17(7):347–362. doi: 10.1016/j.molmed.2011.01.015. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Analysis of hsa-miR-181a expression in a human endometrial specimen by real-time PCR.

Notes: (A) Melting curve showing the single melt peak for hsa-miR-181a and U6, respectively; and (B) the amplification plot of the target gene.

Abbreviation: PCR, polymerase chain reaction.

dddt-9-1103s1.tif (1.4MB, tif)

Articles from Drug Design, Development and Therapy are provided here courtesy of Dove Press

RESOURCES