Abstract
Non-O1/non-O139 Vibrio cholerae inhabits estuarine and coastal waters globally, but its clinical significance has not been sufficiently investigated, despite the fact that it has been associated with septicemia and gastroenteritis. The emergence of virulent non-O1/non-O139 V. cholerae is consistent with the recognition of new pathogenic variants worldwide. Oyster, sediment, and water samples were collected during a vibrio surveillance program carried out from 2009 to 2012 in the Chesapeake Bay, Maryland. V. cholerae O1 was detected by a direct fluorescent-antibody (DFA) assay but was not successfully cultured, whereas 395 isolates of non-O1/non-O139 V. cholerae were confirmed by multiplex PCR and serology. Only a few of the non-O1/non-O139 V. cholerae isolates were resistant to ampicillin and/or penicillin. Most of the isolates were sensitive to all antibiotics tested, and 77 to 90% carried the El Tor variant hemolysin gene hlyAET, the actin cross-linking repeats in toxin gene rtxA, the hemagglutinin protease gene hap, and the type 6 secretion system. About 19 to 21% of the isolates carried the neuraminidase-encoding gene nanH and/or the heat-stable toxin (NAG-ST), and only 5% contained a type 3 secretion system. None of the non-O1/non-O139 V. cholerae isolates contained Vibrio pathogenicity island-associated genes. However, ctxA, ace, or zot was present in nine isolates. Fifty-five different genotypes showed up to 12 virulence factors, independent of the source of isolation, and represent the first report of both antibiotic susceptibility and virulence associated with non-O1/non-O139 V. cholerae from the Chesapeake Bay. Since these results confirm the presence of potentially pathogenic non-O1/non-O139 V. cholerae, monitoring for total V. cholerae, regardless of serotype, should be done within the context of public health.
INTRODUCTION
Vibrio cholerae, a waterborne bacterial pathogen, is an autochthonous inhabitant of riverine and estuarine aquatic environments. There are >200 serogroups, based on O antigenic characters, but only serogroups O1 and O139 have been associated with epidemic cholera, and both are considered a major public health threat for developing countries (1).
Developed countries today rarely witness cholera cases caused by epidemic strains of V. cholerae, and outbreaks are typically travel associated (2). However, infections other than cholera can be caused by nonepidemic V. cholerae serogroups that are collectively referred to as non-O1/non-O139 V. cholerae and are generally acquired through the consumption of raw or undercooked seafood. Non-O1/non-O139 V. cholerae infections are continuously reported worldwide (3, 4), emphasizing their clinical significance. Although non-O1/non-O139 V. cholerae strains generally do not produce cholera toxin, other virulence factors contribute to their pathogenicity, including the hemolysin gene hlyA (5), the protease gene hapA (6), the cytotoxic actin cross-linking repeats in toxin gene rtxA (7), the sialidase gene nanH (8), the heat-stable toxin (NAG-ST) (9), a type 6 secretion system (T6SS) (10), and a type 3 secretion system (T3SS) (11). Occasionally, the cholera toxin gene ctxA and the toxin-coregulated-pilus-associated genes tcpA and tcpI are reported to be present in non-O1/non-O139 V. cholerae isolates (12, 13).
The CDC reported that V. cholerae O75 caused sporadic cholera cases traced to contaminated shellfish consumption in the U.S. Gulf Coast in 2010 to 2011 (14) and that toxigenic V. cholerae O141 infections in New Jersey and Arizona in 2011 to 2012 were likely associated with raw clam consumption and unsafe drinking water (2). In Maryland, vibriosis is associated mainly with V. parahaemolyticus and V. vulnificus, but 5 to 10% of all cases yearly are caused by non-O1/non-O139 V. cholerae (15), increasingly so over the last decade (16). According to CDC guidelines, oral rehydration is the therapy of choice for mild non-O1/non-O139 V. cholerae infections, whereas severe infections and septicemia should be treated with ciprofloxacin and/or third-generation cephalosporins (ceftazidime and ceftriaxone) (17).
The Chesapeake Bay is the largest estuary in the Unites States and has been the subject of many microbiological studies over the last 40 years. The occurrence of V. cholerae in the Chesapeake Bay was first documented in the late 1970s, when both non-O1/non-O139 V. cholerae (18) and nontoxigenic V. cholerae O1 (19) were isolated in different locations of the bay. Ecological surveys and genetic diversity analysis of V. cholerae were subsequently undertaken (20, 21) and showed that V. cholerae is a naturally occurring component of estuarine and marine coastal microbiota.
As reported previously by Baquero et al., “the study of antibiotic resistance in indigenous water organisms is important, as it might indicate the extent of alteration of water ecosystems by human action” (22). The Chesapeake Bay is characterized by high recreational use, heavy commercial fishing, and wastewater overflows from treatment plants. This composite aquatic environment makes the Chesapeake Bay a potential bioreactor for genetic exchange among bacteria subjected to antibiotic treatment (agricultural operations, poultry farms, and isolates of human origin) and autochthonous microorganisms, enhancing the spread of drug resistance in aquatic environments. V. cholerae isolated from seawater has been shown to be antibiotic resistant worldwide (23–25), but no information is available about V. cholerae populations of the Chesapeake Bay.
The reported increase in the number of non-O1/non-O139 V. cholerae cases in Maryland (16) demands a better understanding of both antibiotic resistance and pathogenic properties of these bacteria, considering that no such data are available for environmental V. cholerae in the Chesapeake Bay. The aim of this study, therefore, was to undertake an extensive analysis of virulence determinants and antibiotic resistance patterns of V. cholerae isolates collected during a 43-month surveillance carried out in the Chesapeake Bay.
MATERIALS AND METHODS
Sample collection, processing, and strain isolation.
From February 2009 to August 2012, oyster, sediment, and water samples were collected from the Chester River (CR) and Tangier Sound (TS), Chesapeake Bay, Maryland. The two sampling sites were chosen based on ecological and environmental conditions: the CR station, located at the mouth of the Chester River, is representative of the upper Chesapeake Bay (39°05′0.9″N, 76°09′49″W), whereas the TS station is located in the lower Chesapeake Bay (38°10′9.76″N, 75°57′9.01″W). Sampling was performed twice per month during summer (June to August) and once per month the rest of the year (September to May). At each site, 12 liters of epipelagic water (whole water, plankton-free water [PFW], and plankton fraction), 20 to 25 oysters, and 80 to 100 g of sediment were collected, and V. cholerae was isolated by using alkaline peptone water enrichment according to standard protocols (26). Briefly, three volumes of water (1 liter, 100 ml, and 10 ml), homogenized oysters (10 g, 1 g, and 0.1 g), and sediment samples, each added to 10× alkaline peptone water, were incubated statically at 35°C for 16 to 18 h. One milliliter of each enrichment culture grown overnight (O/N) was used for DNA extraction by boiling (27) and tested by multiplex PCR for ctxA and toxigenic V. cholerae O1 and O139 (28). A loopful of pellicle from each enrichment culture grown overnight was streaked onto the selective media CHROMagar Vibrio (CHROMagar, USA) and thiosulfate citrate bile salts sucrose (TCBS) agar (Difco, USA) and incubated overnight at 37°C. Presumptive V. cholerae colonies were subcultured onto LB agar, and multiplex toxR PCR was used to confirm that the colonies were V. cholerae (Table 1). Antiserum kits for O1 (Vibrio cholerae Antiserum Poly; Difco, USA) and O139 (O139 Bengal; Hardy Diagnostics, USA) V. cholerae were used to determine serotype by slide agglutination, according to the manufacturers' instructions. Serotyping was confirmed by multiplex PCR, as described above (Table 1). Bacterial isolates were stored at −80°C in LB broth containing 50% (vol/vol) glycerol.
TABLE 1.
Oligonucleotides used in this study
| Gene | Primer | Sequence (5′–3′) | Amplicon size (bp) | Reference |
|---|---|---|---|---|
| toxR | UtoxF | GASTTTGTTTGGCGYGARCAAGGTT | 46 | |
| vctoxR | GGTTAGCAACGATGCGTAAG | 640 | 46 | |
| vptoxR | GGTTCAACGATTGCGTCAGAAG | 297 | 46 | |
| vvtoxR | AACGGAACTTAGACTCCGAC | 435 | 46 | |
| O1 rfb | O1F2-1 | GTTTCACTGAACAGATGGG | 192 | 28 |
| O1R2-2 | GGTCATCTGTAAGTACAAC | 28 | ||
| O139 rfb | O139F2 | AGCCTCTTTATTACGGGTGG | 449 | 28 |
| O139R2 | GTCAAACCCGATCGTAAAGG | 28 | ||
| ctxA | VCT1 | ACAGAGTGAGTACTTTGACC | 308 | 28 |
| VCT2 | ATACCATCCATATATTTGGGAG | 28 | ||
| ctxB | ctxB-F | ATGCACATGGAACACCTCAAAATATTACTG | 231 | 47 |
| ctxB-R | TCCTCAGGGTATCCTTCATCCTTTCAATC | 47 | ||
| tcpI | 132-F | TAGCCTTAGTTCTCAGCAGGCA | 862 | 48 |
| 951-R | GGCAATAGTGTCGAGCTCGTTA | 48 | ||
| tcpA | 72-F | CACGATAAGAAAACCGGTCAAGAG | 481 (El Tor) | 48 |
| 477-R | CGAAAGCACCTTCTTTCACGTTG | 620 (classical) | 48 | |
| 647-R | TTACCAAATGCAACGCCGAATG | 48 | ||
| tcA-F | ATGCAATTATTAAAACAGCTTTTTAAG | 627 (atypical) | 49 | |
| tcA-R | TTAGCTGTTACCAAATGCAACAG | 49 | ||
| tcpH-tcpA | tcpH-1 | AGCCGCCTAGATAGTCTGTG | 1,289 | 50 |
| tcpA-4 | TCGCCTCCAATAATCCGAC | 50 | ||
| hlyA | 489-F | GGCAAACAGCGAAACAAATACC | 481 (El Tor) | 48 |
| 744-F | GAGCCGGCATTCATCTGAAT | 738/727 (classical) | 48 | |
| 1184-R | CTCAGCGGGCTAATACGGTTTA | 48 | ||
| stn-sto | 67-F | TCGCATTTAGCCAAACAGTAGAAA | 172 | 48 |
| 194-R | GCTGGATTGCAACATATTTCGC | 48 | ||
| zot | 225-F | TCGCTTAACGATGGCGCGTTTT | 947 | 48 |
| 1129-R | AACCCCGTTTCACTTCTACCCA | 48 | ||
| ace | Ace-F | TGATGGCTTTACGTGGCTTGTGATC | 134 | 44 |
| Ace-R | GCCTGTTGGATAAGCGGATAGATGG | 44 | ||
| hap | Hap-F | ACGTTAGTGCCCATGAGGTC | 351 | 44 |
| Hap-R | ACGGCAAACACTTCAAAACC | 44 | ||
| rtxA | Rtx-F | CTGAATATGAGTGGGTGACTTACG | 417 | 44 |
| Rtx-R | GTGTATTGTTCGATATCCGCTACG | 44 | ||
| nanH | nanH-F | CTTCCTCCAATACGGTTCTTGTCTCTTATGC | 314 | 26 |
| nanH-R | TTCGGCTACCATCGGCAACTTGTATC | 26 | ||
| vcsC | vcsC2-F | GGAAAGATCTATGCGTCGACGTTACCGATGCTATGGG | 535 | 26 |
| vcsC2-R | CATATGGAATTCCCGGGATCCATGCTCTAGAAGTCGGTTGTTTCGGTAA | 26 | ||
| vcsV | vcsV2-F | ATGCAGATCTTTTGGCTCACTTGATGG | 742 | 26 |
| vcsV2-R | ATGCGTCGACGCCACATCATTGCTTGC | 26 | ||
| vcsN | vcsN2-F | GGATCCCGGGAATTCCATATGCGTCGACAGTTGAGCCAATTCCATT | 484 | 26 |
| vcsN2-R | CGGGGTACCATGCTCTAGACGACCAAACGAGATAAT | 26 | ||
| vspD | vspD-F | ATCGTCTAGAACTCGAAGAGCAGAAAAAAGC | 422 | 26 |
| vspD-R | ATCGGTCGACCTTCCCGCTTTTGATGAAAT | 26 | ||
| vasH | vasH-857F | GTGGCACGCTATTTCTGGAT | 385 | 12 |
| vasH-1242R | TTTCAGCTCACGCACATTTC | 12 | ||
| vasA | vasA-104F | GTACGACCGATCCTGACGTT | 342 | 12 |
| vasA-446R | ATCTGAATGGTCGTGGCTTC | 12 | ||
| vasK | vasK-1851F | GCGTCAAATTCAGGAAGAGC | 399 | 12 |
| vasK-2250R | CTGTCCCAGAACCCAACTGT | 12 |
Direct fluorescent-antibody assay and direct viable counts.
Direct fluorescent-antibody (DFA) detection of V. cholerae O1 and O139 was performed by using a V. cholerae serogroup O1 (Cholera DFA) or O139 (Bengal DFA) kit (New Horizons, MD). Briefly, 1-ml water and plankton samples were incubated overnight at 30°C with 0.002% nalidixic acid and 0.025% yeast extract, and samples were fixed with 2% formaldehyde and stored at room temperature until they were processed (26). Samples were processed according to the DFA O1 kit instructions, and slides were examined by using an epifluorescence microscope (AxioScope; Carl Zeiss).
Antibiotic susceptibility.
Antibiotic susceptibility was determined by disk diffusion on Muller-Hinton agar (BD, USA), according to Clinical and Laboratory Standards Institute guidelines for V. cholerae (29) and Enterobacteriaceae (30). Escherichia coli ATCC 25922 was used as a quality control strain. All strains were tested for resistance to ampicillin (10 μg), ciprofloxacin (5 μg), chloramphenicol (30 μg), erythromycin (15 μg), kanamycin (30 μg), nalidixic acid (30 μg), penicillin (10 μg), spectinomycin (100 μg), streptomycin (10 μg), sulfamethoxazole-trimethoprim (SXT) (23.75 and 1.25 μg, respectively), and tetracycline (30 μg). Ampicillin-resistant strains were also screened for the following monobactams, carbapenems, and second-, third-, and fourth-generation cephalosporins: cefotaxime (30 μg), ceftazidime (30 μg), ceftriaxone (30 μg), cefoxitin (30 μg), cefepime (30 μg), imipenem (10 μg), and aztreonam (30 μg). MICs for strains showing intermediate susceptibility to erythromycin were determined by using Ery EM256 (0.016 to 256 μg/ml) Etest strips (bioMérieux-USA), according to the manufacturer's instructions.
DNA extraction and PCR amplification.
Genomic DNA was extracted according to a boiling protocol described previously by Ausubel et al. (27). PCR was performed in a 25-μl reaction mix containing 12.5 μl of GoTaq master mix polymerase (Promega) and 50 ng/μl DNA. Gene targets and oligonucleotide sequences are listed in Table 1. For thermal cycling conditions, see the references in Table 1. PCR amplicons were confirmed by sequencing performed at Eurofins Genomics, and Invitrogen Vector NTI software was used to compare DNA sequences against the GenBank nucleotide database. V. cholerae O1 reference strains N16961, INDRE 91/1, and O395; non-O1/non-O139 V. cholerae reference strains RC385, RC66, and AM-19226; and V. cholerae O139 reference strain MO10 were included as positive and negative controls where appropriate. Data presented in Table 4 are results from at least two independent experiments. DNA sequences were determined by Eurofins Genomics (Huntsville, AL, USA). Simpson's index of diversity was used to calculate sample diversity.
TABLE 4.
Virulence gene profiles of 395 non-O1/non-O139 V. cholerae isolates
| Gene | No. of positive isolates (%) |
||
|---|---|---|---|
| Chester River (n = 312) | Tangier Sound (n = 83) | Total (n = 395) | |
| ctxA | 4 (1.3) | 0 | 4 (1) |
| ctxB | 0 | 0 | 0 |
| tcpAa | 0 | 0 | 0 |
| tcpI | 0 | 0 | 0 |
| tcpH-tcpA | 0 | 0 | 0 |
| ace | 1 (0.3) | 0 | 1 (0.2) |
| zot | 2 (0.6) | 2 (2.4) | 4 (1) |
| hlyAETb | 279 (89.4) | 49 (59) | 328 (83) |
| stn-sto | 80 (25.6) | 6 (7.2) | 86 (21.8) |
| hap | 280 (89.7) | 49 (59) | 329 (83.3) |
| rtxA | 251 (80.4) | 56 (67.5) | 307 (77.7) |
| nanH | 63 (20.2) | 15 (18.1) | 78 (19.7) |
| T3SS | |||
| vscC | 19 (6.1) | 3 (3.6) | 22 (5.6) |
| vspD | 18 (5.8) | 3 (3.6) | 21 (5.3) |
| vscN | 20 (6.4) | 3 (3.6) | 23 (5.8) |
| vscV | 18 (5.8) | 3 (3.6) | 21 (5.3) |
| T6SS | |||
| vasA | 284 (91) | 73 (88) | 357 (90.4) |
| vasK | 283 (90.7) | 67 (80.7) | 350 (88.6) |
| vasH | 268 (85.9) | 39 (47) | 307 (77.7) |
Classical, El Tor, and atypical tcpA alleles were investigated (Table 1).
hlyA classical allele negative for all isolates.
RESULTS
Detection and isolation of V. cholerae.
Altogether, 111 rounds of sampling took place at the Chester River (CR) site (n = 54) and the Tangier Sound (TS) site (n = 57) between February 2009 and August 2012. Chester River samples were more frequently positive for V. cholerae than were Tangier Sound samples, with 63% (34/54) and 31% (17/54) positive sampling rounds, respectively. Water temperature in the Chesapeake Bay displayed annual seasonal patterns with dramatic changes over the study period at both sites, from a low of 0.5°C in January to a maximum of 30.14°C in July. The seasonal fluctuation of salinity in the upper and mid-Chesapeake Bay is shown in Fig. 1. Salinity ranged between 3 and 12.5 ppt in the Chester River and between 7.3 and 19.1 ppt in Tangier Sound.
FIG 1.
Isolation of V. cholerae by enrichment over the course of the 43-month study in the Chester River (top) and Tangier Sound (bottom). Shown are water temperatures in degrees Celsius (right y axis) and V. cholerae detection (left y axis) in sediment (S), oysters (O), the plankton fraction (P), water (W), and plankton-free water (PFW).
Combined sampling at both sites yielded 395 V. cholerae isolates by an enrichment method (Table 2), and all isolates were confirmed to be non-O1/non-O139 V. cholerae by multiplex PCR and serology. A total of 312 V. cholerae isolates were isolated from the CR site, half of which were from water samples. V. cholerae was also isolated from oysters (6 isolates from two sampling rounds) and sediment (21 isolates from seven rounds), predominantly during the summer months of 2011 and 2012 (Fig. 1). Over the entire 43-month study at the CR site, the yield of V. cholerae isolates for the summer months (June to August) in 2010 was ∼60% lower than that in 2011 (40 and 139 isolates, respectively), and interestingly, the proportion of positive samples dropped by ∼1/10 in the summer of 2012 (15 isolates from 6 samplings). The peak of V. cholerae isolation in the summer of 2011 was strongly correlated (R2 = 0.9) with lower salinity (3.9 to 6.4 ppt), compared with the higher salinity in 2011 (8 to 9.5 ppt) and 2012 (8.2 to 11.1 ppt). V. cholerae isolation was episodic in Tangier Sound for the entire sampling period, with 83 isolates from the three water fractions and none from oysters or sediment (Table 2). The largest number of isolates was obtained during February to May 2010, and these isolates were mainly from water, but there was no recurrent seasonal pattern detected during the 43-month study (Fig. 1).
TABLE 2.
Non-O1/non-O139 V. cholerae isolated by enrichment of samples from the Chester River and Tangier Sound between February 2009 and August 2012
| Sample type | No. of isolatesa |
|
|---|---|---|
| Chester River | Tangier Sound | |
| Sediment | 21 | 0 |
| Oyster | 6 | 0 |
| Water | 174 | 60 |
| Plankton-free water | 56 | 9 |
| Plankton | 55 | 14 |
| Total | 312 | 83 |
There were 395 isolates in total.
V. cholerae O1 and O139 were not isolated in culture from any of the samples collected in this study, and their presence was never detected by multiplex PCR (28) directly from samples of enrichment cultures grown O/N. Since V. cholerae can be present in the natural environment in a viable but nonculturable (VBNC) state, a direct fluorescent-antibody (DFA) method was employed to detect V. cholerae O1 and O139 in all of the plankton and PFW samples. All samples tested were negative for V. cholerae O139 during the entire surveillance period. Plankton and/or PFW samples collected from both the Chester River and Tangier Sound were positive for V. cholerae O1, but the results showed a scattered presence of V. cholerae O1 during the entire sampling period (Table 3). All samples collected during 2011 were negative for V. cholerae O1. Overall, 32 of 111 sampling rounds (29%) resulted in isolates that were positive for V. cholerae O1 from plankton and/or PFW samples. The average V. cholerae O1 cell counts for plankton and PFW samples ranged from 8 × 103 to 45 × 103 cells/ml and from 5 × 103 to 10 × 103 cells/ml, respectively (Table 3). The percentage of positive sampling rounds per year varied from 6.3 to 42.6%. The proportion of positive samples was higher for water samples than for plankton in the Chester River, a result which was the reverse of that for Tangier Sound, where V. cholerae O1-positive samples were detected mainly in plankton samples. Furthermore, an increased frequency of V. cholerae O1-positive samples was observed during the summer months (May to August) of 2010 and 2012 in Tangier Sound.
TABLE 3.
Number of rounds in which V. cholerae O1-positive samples were detected by DFA analysis and average V. cholerae O1 cell counts by year for the entire studya
| Yr | Tangier Sound |
Chester River |
||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Total no. of sampling rounds | No. of positive sampling rounds (% of total rounds) |
No. of cells/ml (103) |
Total no. of sampling rounds | No. of positive sampling rounds (% of total rounds) |
No. of cells/ml (103) |
|||||
| P | PFW | P | PFW | P | PFW | P | PFW | |||
| 2009 | 13 | 1 (7.7) | 3 (23.1) | 45.00 | 8.33 | 14 | 5 (35.7) | 6 (42.6) | 8 | 8.75 |
| 2010 | 15 | 5 (33.3) | 5 (33.3) | 11 | 25 | 16 | 5 (31.3) | 1 (6.3) | 20 | 5 |
| 2012 | 11 | 3 (27.3) | 4 (36.4) | 15 | 6.25 | 11 | 4 (36.4) | 2 (18.2) | 16.25 | 10 |
Samples were negative for V. cholerae O1 by DFA analysis for all rounds during 2011. P, plankton; PFW, plankton-free water.
Non-O1/non-O139 V. cholerae antibiotic resistance.
Antimicrobial susceptibility testing was carried out by using a disk diffusion assay for 11 antibiotics (Fig. 2) on a selection of non-O1/non-O139 V. cholerae isolates obtained in this study (n = 307) and selected for analysis according to the site and date of isolation (∼78% of the total set of isolates). No significant difference between isolates from the Chester River and those from the Tangier Sound was observed, nor was there a significant difference according to sample type (oysters, plankton, water, or sediment). Multidrug-resistant isolates were not detected. All of the V. cholerae isolates were sensitive to chloramphenicol, ciprofloxacin, kanamycin, nalidixic acid, spectinomycin, streptomycin, sulfamethoxazole-trimethoprim, and tetracycline. Of the 307 V. cholerae environmental isolates, 13% showed resistance to one or two of the antibiotics tested: 20 showed resistance to both ampicillin and penicillin (oysters, water, and PFW), 17 showed resistance to penicillin (plankton and water), 1 showed resistance to penicillin and erythromycin (water sample from Tangier Sound), and 1 showed resistance to ampicillin (oysters in the Chester River). Intermediate resistance to kanamycin (11% of isolates), spectinomycin (7%), and streptomycin (8%) was detected. Interestingly, 71% of all the isolates showed intermediate susceptibility to erythromycin. MICs were determined for a selected set of strains showing intermediate resistance (n = 110), and all strains showed an MIC of ≤4 μg/ml.
FIG 2.
Percentages of antibiotic-resistant environmental non-O1/non-O139V. cholerae isolates. R, resistant; I, intermediate; S, sensitive; AM, ampicillin; CIP, ciprofloxacin; C, chloramphenicol; E, erythromycin; K, kanamycin; NA, nalidixic acid; P, penicillin; SPT, spectinomycin; S, streptomycin; SXT, sulfamethoxazole-trimethoprim; T, tetracycline.
Twenty-one ampicillin-resistant isolates were also tested for resistance to monobactam, carbapenem, and second-, third-, and fourth-generation cephalosporins. Two isolates from water samples collected from the Chester River were resistant to ceftriaxone, whereas three isolates from water samples collected in Tangier Sound were resistant to aztreonam. None of the AmpC (MOX, CMY, FOX, LAT, ACC, MIR, and DHA) and β-lactamase (blaOXA, blaSHV, blaCTX, blaTEM, and blaIMP) gene determinants were detected in the Chesapeake Bay V. cholerae isolates, nor were class 1 integrons or SXT/R391 integrative conjugative element integrases detected (data not shown).
Distribution of virulence factors among non-O1/non-O139 V. cholerae isolates.
Virulence factors detected in the V. cholerae isolates obtained in this study are listed in Table 4. Almost all of the V. cholerae isolates carried the following virulence factors: the El Tor variant hemolysin gene hlyAET (83%), the hemagglutinin protease gene hap (83.3%), the actin cross-linking repeats in toxin gene rtxA (77.7%), and the T6SS genes vasAKH (77.7 to 90.4%). Approximately 19.7% of the isolates carried the neuraminidase gene nanH. The heat-stable toxin NAG-ST, encoded by stn (confirmed by amplicon sequencing [data not shown]), was found in 86 of the isolates (21.8%) from both sampling sites. Only 5% of the isolates carried T3SS genes (vcsC, vcsV, vcsN, and vspD). The ctxA, ace, and/or zot gene was absent in all but nine of the non-O1/non-O139 V. cholerae isolates (0.3 to 1%) from both the Chester River and Tangier Sound. None of these isolates carried any of the toxin-coregulated pilus genes (tcpA, tcpI, and tcpH).
Fifty-five profiles were obtained, showing up to 12 different virulence-associated genes in the V. cholerae isolates from both sampling sites. Representative genotypes are shown in Table 5. Fourteen of the isolates carried no virulence-associated factors, and 24 of the isolates each had unique profiles. In general, 83 of the V. cholerae isolates from Tangier Sound showed greater variability, with 35 different virulence profiles (D = 0.90), compared with the 45 profiles observed for 312 of the V. cholerae isolates from the Chester River (D = 0.81). Analysis of the different water fractions and samples showed the greatest variation in virulence among V. cholerae isolates from water samples (D = 0.88) and the lowest variation among V. cholerae isolates from sediment (D = 0.60).
TABLE 5.
Representative virulence genotypes of non-O1/non-O139 V. cholerae isolatesa
| Genotype | No. of isolates (location[s] of sampling) | Source(s) |
|---|---|---|
| hlyA hap rtxA vasA vasK vasH | 143 (CR, TS) | W, PFW, P, S, O |
| hlyA stn-sto hap rtxA vasA vasK vasH | 41 (CR) | W, PFW, P, S, O |
| hlyA hap rtxA nanH vasA vasK vasH | 24 (CR, TS) | W, PFW, P, O |
| hlyA hap vasA vasK vasH | 21 (CR, TS) | W, PFW, P, S, O |
| hlyA stn-sto hap rtxA nanH vasA vasK vasH | 16 (CR, TS) | W, PFW, O |
| hlyA hap rtxA nanH vcsC vspD vcsN vcsV vasA vasK vasH | 12 (CR, TS) | W, PFW, P |
| hlyA stn-sto hap vasA vasK vasH | 9 (CR) | W, PFW, P, S |
| hlyA hap nanH vasA vasK vasH | 5 (CR, TS) | W, PFW |
| hlyA hap rtxA vasA vasK | 5 (CR) | PFW, P |
| hlyA hap rtxA vcsC vspD vcsN vcsV vasA vasK vasH | 3 (CR, TS) | W, PFW, P |
| hlyA stn-sto rtxA nanH vasA vasK vasH | 3 (CR) | W |
| hlyA stn-sto hap rtxA nanH vcsC vspD vcsN vcsV vasA vasK vasH | 3 (CR) | W, P |
| hlyA stn-sto hap rtxA vcsC vspD vcsN vcsV vasA vasK vasH | 2 (TS, CR) | W |
| ctxA hlyA hap rtxA vasA vasK vasH | 2 (CR) | PFW, S |
| zot hlyA hap vasA vasK vasH | 1 (CR) | W |
| ctxA hlyA stn-sto nanH vasA vasK vasH | 1 (CR) | W |
| ace hlyA hap rtxA nanH vasA vasK vasH | 1 (CR) | P |
| ctxA hlyA hap rtxA nanH vasA vasK vasH | 1 (CR) | W |
| zot hlyA hap rtxA nanH vasA vasK vasH | 1 (CR) | W |
| zot hlyA rtxA vasA vasK vasH | 1 (TS) | W |
| zot rtxA vasA vasK | 1 (TS) | W |
CR, Chester River; TS, Tangier Sound; O, oyster; S, sediment; W, water; P, plankton; PFW, plankton-free water.
The genotype most frequently detected (143 out of 395 isolates) was hlyA hap rtxA vasA vasK vasH. Seven variants of this profile, lacking rtxA and/or hap, with stn-sto and/or nanH were observed among 130 isolates (Table 5). Nine isolates were characterized by ctxA, ace, or zot and virulence genes (hlyA, hap, stn-sto, rtxA, nanH, vasA, vasK, or vasH) but not the toxin-coregulated pilus-related genes. These were mainly unique virulence profiles (Table 5). Twenty-one isolates had both type 3 (vcsN, vcsV, vcsC, and vspD) and type 6 (vasA, vasK, and vasH) secretion systems, in different combinations with hlyA, hap, rtxA, and stn-sto (Table 5).
DISCUSSION
The present study was aimed at gaining an understanding of the presence, virulence, and antibiotic resistance profiles of V. cholerae in the Chesapeake Bay. These bacteria are widely distributed in the aquatic environment and are readily isolated in culture, whereas V. cholerae O1 is difficult to isolate, even in areas where cholera is endemic (31). However, V. cholerae O1 was detected by DFA analysis, as was reported previously by investigators carrying out such studies in the Chesapeake Bay (20, 21). Attempts to isolate V. cholerae O1 in culture were not successful. It has been concluded that V. cholerae O1 is present in the Chesapeake Bay and can be detected by DFA analysis but in very low numbers. The limit of detection might also depend on V. cholerae O1 being outnumbered by non-O1/non-O139 V. cholerae as well as the former being in a viable but nonculturable (VBNC) state (32); both hypotheses are consistent with previous findings in areas of the world where cholera is endemic and in areas where cholera is not endemic (31, 33).
Our results indicate, in terms of both the percentage of positive rounds of sampling and the number of isolates, that V. cholerae was detected more frequently at the northern site (CR) than at the southern site (TS) in the Chesapeake Bay, which is likely linked to the lower salinity registered in the Chester River than in Tangier Sound, where the highest salinity points were registered over the entire study period. These findings are in agreement with previous studies conducted in the Chesapeake Bay (20, 21) indicating that a salinity range of between 4 and 14 ppt is optimal for V. cholerae.
Bacteria resistant to antibiotics have been reported to be present in aquatic environments (22). The intensive use of antibiotics in medicine and in animal farming has been suggested to be the source of such resistance (34, 35), and V. cholerae strains isolated from seawater have been shown to be antibiotic resistant (23, 24). The data presented here provide the first report of antimicrobial susceptibility for non-O1/non-O139 V. cholerae from the Chesapeake Bay. A very narrow resistance profile was found, with neither the transfer of resistance from industrial or clinical strains nor an intrinsic “resistome” of naturally occurring isolates being significant for this V. cholerae population.
Compared to other Vibrio spp. isolated from the Chesapeake Bay (36), the non-O1/non-O139 V. cholerae isolates in this study showed lower levels of resistance to ampicillin and penicillin (9 to 20%) than those of V. parahaemolyticus (53 to 68%) and showed intermediate resistance to streptomycin compared to V. vulnificus (36). Penicillin resistance, almost ubiquitous in both clinical and environmental V. cholerae isolates worldwide (23, 25), is likely associated with mutations of penicillin binding proteins 1 and/or 2, as observed for several sequenced V. cholerae strains (i.e., N16961, MJ-1236, and MO10). Ampicillin resistance has been reported for clinical non-O1/non-O139 V. cholerae and V. parahaemolyticus strains isolated in Maryland as early as 1984 (37). Our data suggest that mechanisms other than AmpC and β-lactamase genes may be responsible for ampicillin resistance, such as variations in cellular impermeability or efflux pump activity, but this will require further investigation to resolve.
Erythromycin is frequently used as a growth promoter in food animal production (38), and the possible release of this antibiotic with wastewater into the Chesapeake Bay may explain the widespread intermediate resistance observed for the non-O1/non-O139 V. cholerae isolates obtained in this study. No data are available for erythromycin resistance of V. parahaemolyticus and V. vulnificus isolates from the Chesapeake Bay. Although antibiotic treatment with third-generation cephalosporins is recommended only for severe infections and septicemia (17), the detection of ceftriaxone-resistant isolates of non-O1/non-O139 V. cholerae should raise concern, but reassuringly, all isolates were susceptible to ciprofloxacin, which is also recommended for clinical treatment by the CDC (17).
Toxigenic non-O1/non-O139 V. cholerae strains appear to be frequently isolated from both clinical and environmental samples worldwide and are reported to be highly diverse (39, 40). Variability among the isolates of this study was observed, with 55 profiles comprising up to 12 virulence factors (Table 5). From the sequenced genomes of non-O1/non-O139 V. cholerae strains available to date, it is clear that these strains are genetically divergent from each other and from V. cholerae O1 and O139 strains. Most of the virulence genes (nanH, hlyA, hap, rtxA, and stn) can be located on both chromosomes and can also be associated with pathogenicity islands (T3SS) or harbored by different gene clusters on two separate chromosomes (T6SS). This creates a number of different gene combinations that are virtually impossible to predict and cannot be explained by the acquisition of multiple clustered genes in one transfer event without further analysis.
Genetic diversity was not associated with sampling location, and identical profiles were observed for isolates from both sampling sites. Some virulence genotypes were associated with strains isolated at the same time of sampling. Rigorous phylogenetic analysis of the isolates was not done, and further investigation in this direction is required. Nevertheless, the same virulence genotypes may represent a clonal population of V. cholerae. Interestingly, no association between isolates and location was observed. Furthermore, the genetic profiles within a given sampling round varied among the isolates. For example, 34 and 11 isolates were isolated from sampling rounds CR037 and CR023, respectively, but these isolates from both sampling rounds yielded five different genotypes, whereas sampling rounds CR021 and TS017 yielded 13 and 16 isolates, respectively, with eight different genotypes recorded.
The ctxA, ace, or zot genes were present in only nine isolates, and these isolates were from both the Chester River and Tangier Sound. Other investigators have reported that environmental non-O1/non-O139 V. cholerae isolates generally do not produce cholera toxin (40, 41), even though V. cholerae O1 and O139 strains isolated from the aquatic environment have been found to produce toxin (12). The transfer of cholera toxin genes to non-O1/non-O139 strains in the aquatic environment can be mediated by generalized transduction via CTXΦ (42), and environmental vibriophages have been demonstrated to transfer toxin genes from CTXΦ-positive strains to environmental non-O1/non-O139 V. cholerae isolates (43). V. cholerae O1 strains isolated in the Chesapeake Bay (19) and detected in this study by DFA analysis can perhaps be considered a source of toxin genes.
Previous studies have shown that nontoxigenic non-O1/non-O139 V. cholerae isolates have been associated with disease (7). The hlyA and hapA genes code for a hemolysin that exhibits vacuolating activity (5) and a protease that affects epithelial tight-junction-associated proteins (6), respectively. In some cases, these factors are accompanied by rtxA cytotoxic activity, causing mammalian cells to detach and round up (7). In our analysis, hlyA, hap, and rtxA were common virulence factors, with frequencies similar to those reported by environmental surveillance studies in Argentina (15), Iceland (19), Italy (23), Bangladesh (20), and China (13). Almost ubiquitous in this study was the V. cholerae type 6 secretion system, with 76% of the isolates carrying all three genes (vasAKH). The gene variability observed for the T3SS and T6SS might be a consequence of gene absence or amplification failure due to single nucleotide polymorphisms (SNPs). It has been reported that the T6SS contributes to pathogenesis in humans and to fitness for the bacterium, protecting V. cholerae against other Gram-negative bacteria both in the human intestine and in the environment (10).
Almost one-quarter of the isolates of this study harbored the heat-stable toxin (NAG-ST) and/or the sialidase-encoding gene nanH (8). Our findings differ from the relatively rare detection of these two putative virulence factors in environmental isolates worldwide (13, 44). Given the role of NAG-ST in severe diarrheal disease in human volunteers reported previously by Morris et al. (9), the widespread distribution of this pathogenic factor in non-O1/non-O139 V. cholerae in the Chesapeake Bay should be noted by public health authorities.
The observation that only 5% of non-O1/non-O139 V. cholerae isolates, mostly from the Chester River, possessed a type 3 secretion system similar to the T3SS2 of V. parahaemolyticus is very interesting. The T3SS was found in three isolates with a composite genotype of hlyA stn-sto hap rtxA nanH vcsC vspD vcsN vcsV vasA vasK vasH. T3SS-dependent virulence has been demonstrated in the infant rabbit model, where non-O1/non-O139 V. cholerae was able to colonize the intestine, induce pathological changes, and elicit diarrhea (11). A T3SS was documented for V. cholerae O75, a strain isolated from oysters harvested from Apalachicola Bay, Florida, and responsible for a local cholera outbreak in 2010 (45).
Six non-O1/non-O139 V. cholerae strains were isolated from oysters in June and August 2011, when water temperatures were elevated and bacterial concentrations were usually high. Their virulence genotype comprised T6SS, hlyA, and hapA, in some cases accompanied by rtxA and/or nanH. The combined action of these virulence factors in non-O1/non-O139 V. cholerae can be interpreted as enabling the bacterium to induce acute gastroenteritis if present in raw or undercooked seafood that is consumed.
In summary, based on the non-O1/non-O139 V. cholerae virulence determinant and antibiotic resistance profiles for isolates from the Chesapeake Bay, we confirm the presence of potentially pathogenic forms of non-O1/non-O139 V. cholerae and support the view that estuarine and marine bacteria comprise a significant reservoir of virulence and fitness genes. These findings reinforce the connection between environmental reservoirs and human infection and confirm the value of monitoring V. cholerae within the context of public health.
ACKNOWLEDGMENTS
This research was supported by National Science Foundation grant no. 0813066 and National Institutes of Health grant no. 2RO1A1039129-11A2.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
We are grateful to Mitch Tarnowski and David White (Department of Natural Resources, USA) and to Kathy Brohawn, Sarah Harvey, Rusty McKay, and Steve Hiner (Maryland Department of the Environment, USA) for their valuable and much appreciated assistance during sampling.
REFERENCES
- 1.Kaper JB, Morris JG Jr, Levine MM. 1995. Cholera. Clin Microbiol Rev 8:48–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Centers for Disease Control and Prevention. 2012. National Enteric Disease Surveillance: COVIS annual summary, 2012. US Department of Health and Human Services, Atlanta, GA. [Google Scholar]
- 3.Schirmeister F, Dieckmann R, Bechlars S, Bier N, Faruque SM, Strauch E. 2014. Genetic and phenotypic analysis of Vibrio cholerae non-O1, non-O139 isolated from German and Austrian patients. Eur J Clin Microbiol Infect Dis 33:767–778. doi: 10.1007/s10096-013-2011-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Trubiano JA, Lee JYH, Valcanis M, Gregory J, Sutton BA, Holmes NE. 2014. Non-O1, non-O139 Vibrio cholerae bacteraemia in an Australian population. Intern Med J 44:508–511. doi: 10.1111/imj.12409. [DOI] [PubMed] [Google Scholar]
- 5.Figueroa-Arredondo P, Heuser JE, Akopyants NS, Morisaki JH, Giono-Cerezo S, Enríquez-Rincón F, Berg DE. 2001. Cell vacuolation caused by Vibrio cholerae hemolysin. Infect Immun 69:1613–1624. doi: 10.1128/IAI.69.3.1613-1624.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Wu Z, Nybom P, Magnusson K-E. 2000. Distinct effects of Vibrio cholerae haemagglutinin/protease on the structure and localization of the tight junction-associated proteins occludin and ZO-1. Cell Microbiol 2:11–17. doi: 10.1046/j.1462-5822.2000.00025.x. [DOI] [PubMed] [Google Scholar]
- 7.Lin W, Fullner KJ, Clayton R, Sexton JA, Rogers MB, Calia KE, Calderwood SB, Fraser C, Mekalanos JJ. 1999. Identification of a Vibrio cholerae RTX toxin gene cluster that is tightly linked to the cholera toxin prophage. Proc Natl Acad Sci U S A 96:1071–1076. doi: 10.1073/pnas.96.3.1071. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Almagro-Moreno S, Boyd EF. 2009. Sialic acid catabolism confers a competitive advantage to pathogenic Vibrio cholerae in the mouse intestine. Infect Immun 77:3807–3816. doi: 10.1128/IAI.00279-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Morris JJ, Takeda T, Tall B, Losonsky G, Bhattacharya S, Forrest B, Kay B, Nishibuchi M. 1990. Experimental non-O group 1 Vibrio cholerae gastroenteritis in humans. J Clin Invest 85:697–705. doi: 10.1172/JCI114494. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Unterweger D, Kitaoka M, Miyata ST, Bachmann V, Brooks TM, Moloney J, Sosa O, Silva D, Duran-Gonzalez J, Provenzano D, Pukatzki S. 2012. Constitutive type VI secretion system expression gives Vibrio cholerae intra- and interspecific competitive advantages. PLoS One 7:e48320. doi: 10.1371/journal.pone.0048320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Shin OS, Tam VC, Suzuki M, Ritchie JM, Bronson RT, Waldor MK, Mekalanos JJ. 2011. Type III secretion is essential for the rapidly fatal diarrheal disease caused by non-O1, non-O139 Vibrio cholerae. mBio 2(3):e00106-11. doi: 10.1128/mBio.00106-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Hasan NA, Ceccarelli D, Grim CJ, Taviani E, Choi J, Sadique A, Alam M, Siddique AK, Sack RB, Huq A, Colwell RR. 2013. Distribution of virulence genes in clinical and environmental Vibrio cholerae strains in Bangladesh. Appl Environ Microbiol 79:5782–5785. doi: 10.1128/AEM.01113-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Li F, Du P, Li B, Ke C, Chen A, Chen J, Zhou H, Li J, Morris JG, Kan B, Wang D. 2014. Distribution of virulence-associated genes and genetic relationships in non-O1/O139 Vibrio cholerae aquatic isolates from China. Appl Environ Microbiol 80:4987–4992. doi: 10.1128/AEM.01021-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Tobin-D'Angelo M, Smith AR, Bulens SN, Thomas S, Hodel M, Izumiya H, Arakawa E, Morita M, Watanabe H, Marin C, Parsons MB, Greene K, Cooper K, Haydel D, Bopp C, Yu P, Mintz E. 2008. Severe diarrhea caused by cholera toxin-producing Vibrio cholerae serogroup O75 infections acquired in the southeastern United States. Clin Infect Dis 47:1035–1040. doi: 10.1086/591973. [DOI] [PubMed] [Google Scholar]
- 15.Jones EH, Feldman KA, Palmer A, Butler E, Blythe D, Mitchell CS. 2013. Vibrio infections and surveillance in Maryland, 2002–2008. Public Health Rep 128:537–545. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Newton A, Kendall M, Vugia DJ, Henao OL, Mahon BE. 2012. Increasing rates of vibriosis in the United States, 1996–2010: review of surveillance data from 2 systems. Clin Infect Dis 54:S391–S395. doi: 10.1093/cid/cis243. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Daniels NA, Shafaie A. 2000. A review of pathogenic Vibrio infections for clinicians. Infect Med 17:665–685. [Google Scholar]
- 18.Colwell RR, Kaper J, Joseph SW. 1977. Vibrio cholerae, Vibrio parahaemolyticus, and other vibrios: occurrence and distribution in Chesapeake Bay. Science 198:394–396. doi: 10.1126/science.910135. [DOI] [PubMed] [Google Scholar]
- 19.Colwell RR, Seidler RJ, Kaper J, Joseph SW, Garges S, Lockman H, Maneval D, Bradford H, Roberts N, Remmers E, Huq I, Huq A. 1981. Occurrence of Vibrio cholerae serotype O1 in Maryland and Louisiana estuaries. Appl Environ Microbiol 41:555–558. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Louis VR, Russek-Cohen E, Choopun N, Rivera ING, Gangle B, Jiang SC, Rubin A, Patz JA, Huq A, Colwell RR. 2003. Predictability of Vibrio cholerae in Chesapeake Bay. Appl Environ Microbiol 69:2773–2785. doi: 10.1128/AEM.69.5.2773-2785.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Jiang SC, Louis V, Choopun N, Sharma A, Huq A, Colwell RR. 2000. Genetic diversity of Vibrio cholerae in Chesapeake Bay determined by amplified fragment length polymorphism fingerprinting. Appl Environ Microbiol 66:140–147. doi: 10.1128/AEM.66.1.140-147.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Baquero F, Martínez J-L, Cantón R. 2008. Antibiotics and antibiotic resistance in water environments. Curr Opin Biotechnol 19:260–265. doi: 10.1016/j.copbio.2008.05.006. [DOI] [PubMed] [Google Scholar]
- 23.Campos L, Zahner V, Avelar KE, Alves RM, Pereira DS, Vital BJ, Freitas FS, Salles CA, Karaolis DK. 2004. Genetic diversity and antibiotic resistance of clinical and environmental Vibrio cholerae suggests that many serogroups are reservoirs of resistance. Epidemiol Infect 132:985–992. doi: 10.1017/S0950268804002705. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Thungapathra M, Amita Sinha KK, Chaudhuri SR, Garg P, Ramamurthy T, Nair GB, Ghosh A. 2002. Occurrence of antibiotic resistance gene cassettes aac(6′)-Ib, dfrA5, dfrA12, and ereA2 in class 1 integrons in non-O1, non-O139 Vibrio cholerae strains in India. Antimicrob Agents Chemother 46:2948–2955. doi: 10.1128/AAC.46.9.2948-2955.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Taviani E, Ceccarelli D, Lazaro N, Bani S, Cappuccinelli P, Colwell RR, Colombo MM. 2008. Environmental Vibrio spp., isolated in Mozambique, contain a polymorphic group of integrative conjugative elements and class 1 integrons. FEMS Microbiol Ecol 64:45–54. doi: 10.1111/j.1574-6941.2008.00455.x. [DOI] [PubMed] [Google Scholar]
- 26.Huq A, Haley BJ, Taviani E, Chen A, Hasan NA, Colwell RR. 2012. Detection, isolation, and identification of Vibrio cholerae from the environment. Curr Protoc Microbiol Chapter 6:Unit 6A.5. doi: 10.1002/9780471729259.mc06a05s26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. 1990. Current protocols in molecular biology. Green Publishing Associates and Wiley, New York, NY. [Google Scholar]
- 28.Hoshino K, Yamasaki S, Mukhopadhyay AK, Chakraborty S, Basu A, Bhattacharya SK, Nair GB, Shimada T, Takeda Y. 1998. Development and evaluation of a multiplex PCR assay for rapid detection of toxigenic Vibrio cholerae O1 and O139. FEMS Immunol Med Microbiol 20:201–207. doi: 10.1111/j.1574-695X.1998.tb01128.x. [DOI] [PubMed] [Google Scholar]
- 29.Clinical and Laboratory Standards Institute. 2010. Methods for antimicrobial dilution and disk susceptibility testing of infrequently isolated or fastidious bacteria; approved guideline, 2nd ed. CLSI document M45-A2. CLSI, Wayne, PA. [Google Scholar]
- 30.Clinical and Laboratory Standards Institute. 2010. Performance standards for antimicrobial susceptibility testing; twentieth informational supplement. CLSI document M100-S20. CLSI, Wayne, PA. [Google Scholar]
- 31.Alam M, Sultana M, Nair GB, Sack RB, Sack DA, Siddique AK, Ali A, Huq A, Colwell RR. 2006. Toxigenic Vibrio cholerae in the aquatic environment of Mathbaria, Bangladesh. Appl Environ Microbiol 72:2849–2855. doi: 10.1128/AEM.72.4.2849-2855.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Colwell RR. 2000. Viable but nonculturable bacteria: a survival strategy. J Infect Chemother 6:121–125. doi: 10.1007/PL00012151. [DOI] [PubMed] [Google Scholar]
- 33.Grim CJ, Jaiani E, Whitehouse CA, Janelidze N, Kokashvili T, Tediashvili M, Colwell RR, Huq A. 2010. Detection of toxigenic Vibrio cholerae O1 in freshwater lakes of the former Soviet Republic of Georgia. Environ Microbiol Rep 2:2–6. doi: 10.1111/j.1758-2229.2009.00073.x. [DOI] [PubMed] [Google Scholar]
- 34.Okoh A, Sibanda T, Nongogo V, Adefisoye M, Olayemi O, Nontongana N. 29 August 2014. Prevalence and characterisation of non-cholerae Vibrio spp. in final effluents of wastewater treatment facilities in two districts of the Eastern Cape Province of South Africa: implications for public health. Environ Sci Pollut Res Int doi: 10.1007/s11356-014-3461-z:1-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Biyela PT, Lin J, Bezuidenhout CC. 2004. The role of aquatic ecosystems as reservoirs of antibiotic resistant bacteria and antibiotic resistance genes. Water Sci Technol 50(1):45–50. [PubMed] [Google Scholar]
- 36.Shaw KS, Rosenberg Goldstein RE, He X, Jacobs JM, Crump BC, Sapkota AR. 2014. Antimicrobial susceptibility of Vibrio vulnificus and Vibrio parahaemolyticus recovered from recreational and commercial areas of Chesapeake Bay and Maryland coastal bays. PLoS One 9:e89616. doi: 10.1371/journal.pone.0089616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Hoge CW, Watsky D, Peeler RN, Libonati JP, Israel E, Morris JG. 1989. Epidemiology and spectrum of Vibrio infections in a Chesapeake Bay community. J Infect Dis 160:985–993. doi: 10.1093/infdis/160.6.985. [DOI] [PubMed] [Google Scholar]
- 38.Graham JP, Boland JJ, Silbergeld E. 2007. Growth promoting antibiotics in food animal production: an economic analysis. Public Health Rep 122:79–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Luo Y, Ye J, Jin D, Ding G, Zhang Z, Mei L, Octavia S, Lan R. 2013. Molecular analysis of non-O1/non-O139 Vibrio cholerae isolated from hospitalised patients in China. BMC Microbiol 13:52. doi: 10.1186/1471-2180-13-52. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Ottaviani D, Leoni F, Rocchegiani E, Santarelli S, Masini L, Di Trani V, Canonico C, Pianetti A, Tega L, Carraturo A. 2009. Prevalence and virulence properties of non-O1 non-O139 Vibrio cholerae strains from seafood and clinical samples collected in Italy. Int J Food Microbiol 132:47–53. doi: 10.1016/j.ijfoodmicro.2009.03.014. [DOI] [PubMed] [Google Scholar]
- 41.Bakhshi B, Mohammadi-Barzelighi H, Sharifnia A, Dashtbani-Roozbehani A, Rahbar M, Pourshafie MR. 2012. Presence of CTX gene cluster in environmental non-O1/O139 Vibrio cholerae and its potential clinical significance. Indian J Med Microbiol 30:285–289. doi: 10.4103/0255-0857.99487. [DOI] [PubMed] [Google Scholar]
- 42.Boyd FE, Waldor MK. 1999. Alternative mechanism of cholera toxin acquisition by Vibrio cholerae: generalized transduction of CTXΦ by bacteriophage CP-T1. Infect Immun 67:5898–5905. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Choi S, Dunams D, Jiang SC. 2010. Transfer of cholera toxin genes from O1 to non-O1/O139 strains by vibriophages from California coastal waters. J Appl Microbiol 108:1015–1022. doi: 10.1111/j.1365-2672.2009.04502.x. [DOI] [PubMed] [Google Scholar]
- 44.Haley BJ, Chen A, Grim CJ, Clark P, Diaz CM, Taviani E, Hasan NA, Sancomb E, Elnemr WM, Islam MA, Huq A, Colwell RR, Benediktsdóttir E. 2012. Vibrio cholerae in a historically cholera-free country. Environ Microbiol Rep 4:381–389. doi: 10.1111/j.1758-2229.2012.00332.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Haley BJ, Choi SY, Grim CJ, Onifade TJ, Cinar HN, Tall BD, Taviani E, Hasan NA, Abdullah AH, Carter L, Sahu SN, Kothary MH, Chen A, Baker R, Hutchinson R, Blackmore C, Cebula TA, Huq A, Colwell RR. 2014. Genomic and phenotypic characterization of Vibrio cholerae non-O1 isolates from a US Gulf Coast cholera outbreak. PLoS One 9:e86264. doi: 10.1371/journal.pone.0086264. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Bauer A, Rørvik LM. 2007. A novel multiplex PCR for the identification of Vibrio parahaemolyticus, Vibrio cholerae and Vibrio vulnificus. Lett Appl Microbiol 45:371–375. doi: 10.1111/j.1472-765X.2007.02195.x. [DOI] [PubMed] [Google Scholar]
- 47.Vora GJ, Meador CE, Bird MM, Bopp CA, Andreadis JD, Stenger DA. 2005. Microarray-based detection of genetic heterogeneity, antimicrobial resistance, and the viable but nonculturable state in human pathogenic Vibrio spp. Proc Natl Acad Sci U S A 102:19109–19114. doi: 10.1073/pnas.0505033102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Rivera ING, Chun J, Huq A, Sack RB, Colwell RR. 2001. Genotypes associated with virulence in environmental isolates of Vibrio cholerae. Appl Environ Microbiol 67:2421–2429. doi: 10.1128/AEM.67.6.2421-2429.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Kumar P, Peter WA, Thomas S. 2010. Rapid detection of virulence-associated genes in environmental strains of Vibrio cholerae by multiplex PCR. Curr Microbiol 60:199–202. doi: 10.1007/s00284-009-9524-6. [DOI] [PubMed] [Google Scholar]
- 50.O'Shea YA, Reen FJ, Quirke AM, Boyd EF. 2004. Evolutionary genetic analysis of the emergence of epidemic Vibrio cholerae isolates on the basis of comparative nucleotide sequence analysis and multilocus virulence gene profiles. J Clin Microbiol 42:4657–4671. doi: 10.1128/JCM.42.10.4657-4671.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]