Corrigendum

In the article “Impaired fertility and FSH synthesis in gonadotrope-specific Foxl2 knockout mice” by Tran, Zhou, Lafleur, Calderon, Ellsworth, Kimmins, Boehm, Treier, Boerboom, and Bernard (Molecular Endocrinology 27(3):407–421, 2013; doi: 10.1210/me.2012-1286), the authors report the next technical error in the published article: There was a problem with the RT-qPCR primer set (listed in Supplemental Table 1) used to measure total follistatin (Fst) mRNA levels in Figure 5, B and C. The analyses were repeated with the next validated primer set: sense, TGCTGCTACTCTGCCAGTTC; antisense, TTGTCGTTCACATCCTCCTC. Similar to what was reported in the published article, Fst mRNA levels were reduced in pituitaries of Foxl2 conditional knockout mice relative to controls (see figure). The authors regret the error.