Skip to main content
The American Journal of Tropical Medicine and Hygiene logoLink to The American Journal of Tropical Medicine and Hygiene
. 2015 Feb 4;92(2):405–410. doi: 10.4269/ajtmh.14-0606

Ledantevirus: A Proposed New Genus in the Rhabdoviridae Has A Strong Ecological Association with Bats

Kim R Blasdell 1,*, Hilda Guzman 1, Steven G Widen 1, Cadhla Firth 1, Thomas G Wood 1, Edward C Holmes 1, Robert B Tesh 1, Nikos Vasilakis 1, Peter J Walker 1
PMCID: PMC4347348  PMID: 25487727

Abstract

The Le Dantec serogroup of rhabdoviruses comprises Le Dantec virus from a human with encephalitis and Keuriliba virus from rodents, each isolated in Senegal. The Kern Canyon serogroup comprises a loosely connected set of rhabdoviruses many of which have been isolated from bats, including Kern Canyon virus from California, Nkolbisson virus from Cameroon, Central African Republic, and Cote d'Ivoire, Kolente virus from Guinea, Mount Elgon bat and Fikirini viruses from Kenya, and Oita virus from Japan. Fukuoka virus isolated from mosquitoes, midges, and cattle in Japan, Barur virus from a rodent in India and Nishimuro virus from pigs in Japan have also been linked genetically or serologically to this group. Here, we analyze the genome sequences and phylogenetic relationships of this set of viruses. We show that they form three subgroups within a monophyletic group, which we propose should constitute the new genus Ledantevirus.

Introduction

Le Dantec virus (LDV) was isolated in May 1965 at the Le Dantec University Hospital in Dakar, Senegal, from the blood of a 10-year-old girl who had an acute febrile illness with signs of hepatosplenomegaly and fever.1 The virus was subsequently identified morphologically as a rhabdovirus and found to cross-react solidly in complementation-fixation tests with Keuraliba virus (KEUV), which was isolated in 1968 from the liver of a gerbil (Tatera kempi) trapped in a millet and peanut plantation in Saboya, Senegal.1–3 Surveys of human sera in Senegal detected no other evidence of either LDV or KEUV infection but KEUV antibody was detected in ~1% of gerbils and other rodent species tested. However, LDV antibody was detected in a 47-year-old male in Wales who reported fever, headache, and delirium after being bitten in 1969 by an insect while unloading peanuts from a ship that had come from Nigeria.4 The patient subsequently developed neurological symptoms diagnosed as Parkinson's disease but a clear causal relationship with LDV was never established for either of the two human cases.

Although initial studies indicated that KEUV cross-reacts weakly in complement-fixation tests with several vesiculoviruses, phylogenetic analyses using partial L protein (RdRp) sequences suggest that LDV is more closely related to Fukuoka virus (FUKV), which has been assigned to the Kern Canyon serogroup of rhabdoviruses.5,6 The FUKV was first isolated in Japan in 1982 from mosquitoes (Culex tritaeniorhynchus) and biting midges (Culicoides punctatus), and subsequently from sentinel cattle with mild febrile illnesses and leukopenia resembling bovine ephemeral fever.7,8 The Kern Canyon serogroup also includes Kern Canyon virus (KCV), which was isolated in 1956 from a mouse-eared bat (Myotis yumanensis) in California; Nkolbisson virus (NKOV), which was isolated from mosquitoes (Eretmapodites, Aedes, and Culex spp.) in Cameroon and Cote d'Ivoire and a human in the Central African Republic, and Barur virus (BARV), which has been isolated from ticks and a rodent (Rattus rattus) in India, ticks, fleas and mosquitoes of several species in Kenya and ticks in Somalia.9–15 Phylogenetic analysis of partial N (nucleoprotein) protein sequences indicates that KCV is also related to several other viruses that have been isolated from bats in Africa and Asia.16,17 These include Mount Elgon bat virus (MEBV) isolated in 1964 from a horseshoe bat (Rhinolophus hildebrandtii) in Kenya, Oita virus (OITAV) isolated in 1972 also from a horseshoe bat (Rhinolophus cornutus) in Japan, Kolente virus (KOLEV) isolated in 1985 from a roundleaf bat (Hipposideros jonesi) and a pool of ticks (Amblyomma (Theileriella) variegatum) in Guinea, and Fikirini virus (FKRV) isolated in 2011 from a roundleaf bat (Hipposideros vittatus) in Kenya.17–20

Surprisingly, very little further characterization has been conducted on this interesting set of rhabdoviruses, which appear to have an ecological association with bats and some of which may be of clinical significance. Genome sequences have been reported only for FKRV and KOLEV viruses,17,20 and Nishimuro virus (NISV), which was isolated from a wild boar (Sus scrofa) in Japan and appears to be closely related to these viruses (Sakai and others, unpublished data, GenBank: AB609604).

Materials and Methods

We obtained the complete genome sequence for FUKV and near complete genome sequences for NKOV, BARV, KCV, LDV, KEUV, MEBV, and OITAV, lacking only near-terminal sequences of the 3′- and 5′-UTRs. These sequences were obtained by 50 base pair (bp) paired-end sequencing on the HiSeq2000 Illumina platform. Briefly, confluent monolayers of BHK-21 cells (T25 flask) were infected with the respective viruses and harvested 5–7 days later when extensive cytopathic effect (CPE) were present. Viral RNA was prepared and processed for sequencing as described previously.21 Between 0.4% and 70% of the sequence reads in the samples mapped to the corresponding viral contigs (data available on request). The published genome sequences of FKRV, KOLEV, and NISV were also included in our data set (Supplemental Table 1). Transcription profiling was performed using a previously described method and either primer LDV_U1 (CTAGTCATACCCTGTCTAATC) or KCV_U1 (GATGTCTGTCAAGGTGTCTTC) for the U1 ORFs of LDV and KCV, respectively.22

Results

The genomes ranged in size from 10,863 nt for FUKV (the smallest rhabdovirus genome yet reported) to > 11,528 nt for KCV, which is intermediate in length to those of vesiculoviruses and lyssaviruses. The genome organizations are shown in Figure 1A. Each genome contains open reading frames (ORFs) encoding the five canonical structural proteins in the order 3′-N-P-M-G-L-5′ (in negative polarity). The length of each ORF was observed to vary little between viruses with the exception of the P ORF, which ranges in size from 765 nt (BARV, FUKV, NISV) to 1,125 nt (OITAV). Major variations in the length of the P ORF are not unusual within rhabdoviruses. Additional short ORFs (U1) flanked by partially conserved transcription initiation (TI) and transcription termination/polyadenylation (TTP) consensus sequences are situated between the G and L genes in LDV (195 nt), KEUV (195 nt) and KCV (234 nt). Transcription profiling of LDV and KCV U1 proteins established that these genes are transcribed (Supplemental Figure 1). In some viruses, potential alternative ORFs (> 180 nt) are also present within the N (LDV, NISV), P (KEUV), M (FUKV), G (BARV, KEUV, FKRV), and L genes (BARV, OITAV, FKRV, KOLEV) but it is not known if these are expressed. Intergenic regions (IGRs) are generally very short (0–4 nt) with the exception of the [U1-L] IGR in KCV (16 nt), and in FKRV, KOLEV, MEBV and OITAV the M gene overlaps the P gene by 12–16 nt.

Figure 1.

Figure 1.

(A) Schematic representation of ledantevirus genome organizations showing the locations of all open reading frames (ORFs) > 180 nt, with dark gray denoting U1 ORFs, black Fukuoka virus (FUKV) Mx ORF, and pale gray with dashed outline other possible ORFs. (B) Alignment of the U1 proteins of Keuraliba virus (KEUV), Le Dantec virus (LDV), and Kern Canyon virus (KCV). (C) Sequence of the FUKV Mx protein and its predicted membrane topology (TMHMM; http://web.expasy.org).

In pairwise comparisons of the genomes in our data set, nucleotide sequence identities ranged from 44.8% (FKRV and LDV) to 79.5% (BARV and FUKV) (Table 1). Three distinct subgroups were identified: subgroup A (KCV, LDV and KEUV) with 55.0–69.2% sequence identities; subgroup B (FKRV, KOLEV, MEBV and OITAV) with 50.0–62.0% sequence identities; and subgroup C (BARV, FUKV, NISV and NKOV) with 59.2–79.5% sequence identities. The assignment of these subgroups is supported by pairwise comparisons of amino acid (aa) sequence identities of the most highly conserved proteins (Supplemental Table 2). The BARV and FUKV consistently showed the highest pairwise aa sequence identities for all individual proteins (N = 96.4%; P = 81.1%; M = 95.7%; G = 84.4%; L = 92.2%).

Table 1.

Full genome pairwise nucleotide sequence identities for all proposed ledanteviruses

NKOV NISHV BARV FUKAV OITV MEBV FIKV KOLEV KCV LEDV KEUV
NKOV
NISHV 59.2
BARV 59.3 75.2
FUKAV 59.8 76.2 79.5
OITV 45.4 46.8 46.5 47.1
MEBV 47.2 49 49.3 49.3 50
FIKV 46.6 47.2 46.7 47 53 50.5
KOLEV 46.7 47.8 47.4 47.8 53.3 50.8 62
KCV 47.6 48.9 48.8 49.3 45.4 46.8 45.1 45.5
LEDV 48.2 49.2 49.4 49.4 45.8 47.6 44.8 46.1 55.6
KEUV 48.1 48.9 48.6 49.7 45.7 47.3 45.8 45.8 55 69.2

The viruses assigned to subgroup A (LDV, KEUV and KCV) were the only three viruses to contain an additional gene (U1). The PSI-Blast and HHblits homology searches revealed no significant similarity between the U1 proteins and any previously identified protein sequences, and none of the proteins displayed any striking structural characteristics. The U1 proteins of LDV (7.4 kDa) and KEUV (7.3 kDa) were each predicted to be mildly acidic and a pairwise alignment indicated they are closely related (56.3% aa identity). The KCV U1 protein (8.8 kDa) is mildly basic and did not align convincingly with those of LDV and KEUV (Figure 1B). Of the alternative ORFs in the structural protein genes, only the 10.4 kDa protein encoded in the alternative ORF in the FUKV M gene (Mx protein) displayed remarkable structural characteristics with a predicted double-membrane spanning topology and a highly basic central ectodomain (Figure 1C). Like many other rhabdovirus accessory proteins, the functions of the U1 and Mx proteins remain unknown.

Maximum likelihood phylogenetic trees were generated from multiple sequence alignments of the deduced aa sequences of the N and L proteins for all viruses in the data set along with select animal rhabdoviruses. Amino acid sequences were aligned using MUSCLE23 and ambiguously aligned regions were removed using the Gblocks program for the L protein only.24 This resulted in alignments of 1,071 aa and 62 taxa for the L protein and 449 aa and 27 taxa for the N protein. Trees were estimated assuming the WAG+Γ model of aa substitution in the program PhyML 3.0, utilizing subtree pruning and regrafting (SPR) branch-swapping.25 The phylogenetic robustness of each node was determined using 1,000 bootstrap replicates and nearest-neighbor branch-swapping. Analysis of each protein indicated that all viruses in our primary data set clustered within the larger dimarhabdovirus (“dipteran-mammal associated rhabdovirus”) supergroup in a strongly supported monophyletic group in the L protein phylogeny (bootstrap support [BSP] = 100), hereafter referred to as the ledantevirus clade (Figure 2).6 The ledantevirus clade comprised three subgroups that corresponded to those identified above based on pair-wise identities of genome nucleotide sequences. Each subgroup was strongly supported in both the L and N protein analyses (BSP = 100 in both N and L trees); however, the relationships between these subgroups were not well resolved (BSP = 79 in the L tree, BSP < 70 in the N tree) (Figure 2).

Figure 2.

Figure 2.

Maximum likelihood phylogenetic trees of the ledanteviruses (boxed) and select members of the Rhabdoviridae based on L (a) and N (b) protein alignments. Sequences generated in this study are shown in bold, and subgroups A, B, and C are indicated above the respective nodes. Bootstrap support values > 70% are indicated below each node; for clarity these values are given for major clades in the L tree only. Rhabdoviruses included in these analyses comprised: Ikoma virus (IKOV), West Caucasian bat virus (WCBV), Shimoni bat virus (SBV), Mokola virus (MOKV), Lagos bat virus (LBV), Ozernoe virus (OZEV), Duvenhage virus (DUVV), European bat lyssavirus 1 (EBLV-1) and 2 (EBLV-2), Rabies virus (RABV), Aravan virus (ARAV) Khujand virus (KHUV), Australian bat lyssavirus (ABLV), Arboretum virus (ABTV), Puerto Almendras virus (PTAMV), North Creek virus (NORCV), Drosophila melanogaster sigmavirus (DMelSV), Drosophila obscura sigmavirus (DObSV), Durham virus (DURV), Tupai virus (TUPV), Niakha virus (NIAV), Oak vale rhabdovirus (OVRV), Sunguru virus (SUNV), Wongabel virus (WONV), Ngaingan virus (NGAV), Flanders virus (FLAV), Hart Park virus (HPV), Coastal Plains virus (CPV), Tibrogargan virus (TIBV), kotonkon virus (KOTV), Adelaide River virus (ARV), Obodhiang virus (OBOV), Kimberley virus (KIMV), bovine ephemeral fever virus (BEFV), Berrimah virus (BRMV), Nkolbisson virus (NKOV), Nishimuro virus (NISV), Barur virus (BARV), Fukuoka virus (FUKV), Kern Canyon virus (KCV), Keuraliba virus (KEUV), Le Dantec virus (LDV), Mount Elgon bat virus (MEBV), Oita virus (OITAV), Fikirini virus (FKRV), Kolente virus (KOLEV), Siniperca chuatsi rhabdovirus (SCRV), Eel virus X (EVEX), Perch rhabdovirus (PRV), Pike fry rhabdovirus (PFRV), spring viremia of carp virus (SVCV), Perinet virus (PERV), Chandipura virus (CHNV), Malpais Spring virus (MSPV), Isfahan virus (ISFV), vesicular stomatitis virus New Jersey (VSNJV), Indiana (VSIV) and Alagoas (VSAV), Maraba virus (MARAV), Cocal virus (COCV), Radi virus (RADIV), Jurona virus (JURV), Morreton virus (MORV).

Discussion

The Rhabdoviridae currently contains 11 approved genera (Vesiculovirus, Lyssavirus, Ephemerovirus, Tibrovirus, Novirhabdovirus, Perhabdovirus, Sigmavirus, Sprivivirus, Tupavirus, Cytorhabdovirus, and Nucleorhabdovirus) and four unassigned species.26–28 The data presented here provide a strong case for the creation of a new genus Ledantevirus to which the 11 viruses included in this study can be assigned. Phylogenies of the N and L proteins clearly show the monophyletic nature of this group. The full genome nt sequence identities between the members vary from 44.8% to 79.5% and L protein aa identities vary from 46.7% to 92.2%, falling well within the range seen for other genera in the Rhabdoviridae.29 The genome organizations of the viruses are also similar, comprising five ORFs encoding the structural proteins, concise intergenic regions and a small additional ORF between the G and L in only three of the viruses. This relatively simple genome organization is similar to that of vesiculoviruses.30

Based on the N and L phylogenies and full genome nt sequence pairwise comparisons, the ledanteviruses can be further subdivided into three subgroups. This is partially supported by the complement fixation tests reported previously, although strong serological cross-reactions were generally only observed between closely related viruses (BARV and FUKV; KEUV, and LEDV); NISV and FKRV were not included in this study.20 Although this previous study also included Gossas virus, which had previously been identified as a rhabdovirus, subsequent sequence analysis of the source material indicated that the virus used was actually NKOV and that Gossas virus is not a rhabdovirus (data not shown). Some differences in genome organization were also observed between the three subgroups, with an additional ORF between the G and L ORFs in all subgroup A viruses, whereas subgroup B viruses contained a considerably longer P ORF than that found in the other subgroups. Based on the isolation data available for each virus, there are indications that there may also be differences in the ecology of viruses associated with each of these subgroups.

Species demarcation criteria for the Rhabdoviridae vary among different genera, complicated by differences in inter-species genetic diversities that are likely to be associated with different rates of evolution and/or periods of speciation. However, intra-species sequence diversities have been reported previously for several rhabdoviruses. Diversity analysis of the P proteins of 77 isolates of rabies virus from China identified a minimum aa identity of 85%, whereas intra-species (intra-genotype) P protein variation among 128 lyssavirus isolates identified aa identities of ≥ 73.5% and inter-species identities of ≤ 65.9%.31,32 Full genome analysis of nine virus isolates of vesicular stomatitis New Jersey virus from throughout the known geographic range of the virus identified minimum aa identities of ≥ 91.5% for all proteins except P for which the minimum identity was 82.8%.33 Analysis of the ephemeroviruses bovine ephemeral fever virus (BEFV) and Kimberley virus showed minimum intra-species aa sequence identities of 79.1% for the partial P protein and 94.9% for the partial G protein, whereas maximum inter-species identities between BEFV and the closely related Berrimah virus were 44.9% and 90.8% for the partial P and G proteins, respectively.34 In the current study, aa sequence identities were < 81% for L and N, < 70.0% for M and G, and ≤ 57% for all viruses except BARV, FUKV, and NISV. Amino acid sequence identities between BARV and FUKV were > 90% for the N, M, and L proteins and > 80% when compared with NISV. Amino acid sequence identities of P and G proteins were lower but were still 81.1% and 84.4%, respectively, between BARV and FUKV, and > 70% for NISV. Although identities for most proteins are similar to those observed previously for intra-species diversity of other rhabdovirus species, sequence identity of the G protein is much lower. Sequences analysis of further isolates would be required to ascertain the intra-species sequence diversity for the ledanteviruses and to establish if BARV, FUKV, and NISV should be considered as separate species or genotypes of a single species.

Several of the genera within the Rhabdoviridae show associations with a dominant group of vertebrate hosts. Ephemeroviruses and tibroviruses appear to be hosted by cattle, with many members of each genus isolated either from cattle and/or from mosquitoes or biting midges that feed on cattle.35,36 Lyssaviruses circulate in bats, whereas novirhabdoviruses, spriviviruses, and perhabdoviruses are associated with fish.37–39 There is a strong ecological association of the proposed genus Ledantevirus with infection of bats, including all proposed species in subgroup B (FKRV, KOLEV, MEBV, and OITAV) and two of the three viruses in subgroup A (KCV and LDV). There is also some suggestion that the viruses in these two subgroups are each associated with a different subgroup of microchiropteran bats. Subgroup A viruses have been detected in bats from the family Vespertilionidae within the Yangochiroptera subgroup of bats, whereas subgroup B viruses have been found in the sister families Rhinolophidae and Hipposideridae in the other sub-group of bats, the Rhinolophoidea, with the two viruses isolated from Hipposideros bat species (FKRV and KOLEV) showing the greatest identities.40 The detection of various other ledanteviruses in ungulates, rodents and humans may suggest broader natural host specificity or may have been caused by spillover events from a natural reservoir. Possible host switching events have previously been identified in at least two genera of rhabdoviruses.41,42 However, sampling of more viruses from each of these subgroups is required before firm conclusions on natural host range can be drawn. Furthermore, although some ledanteviruses have been isolated from arthropods and the clade sits within the dimarhabdovirus supergroup, it is not clear at this time if vector-borne transmission is a common characteristic of all viruses in the proposed new genus.6,7,10,11,13

Collectively, the data show that the 11 viruses analyzed here form a monophyletic group within the Rhabdoviridae, which we propose should be assigned as the novel genus Ledantevirus. Although little is known about the ecology of most of these viruses, two subgroups appear to be hosted predominantly by bats, whereas a third subgroup contains several viruses suspected of being vectored by arthropods. Further studies are needed to assess the genetic diversity, ecology, and pathogenicity of these viruses and to better define the risks they may pose to human and animal health.

Supplementary Material

Supplemental Datas.

SD7.pdf (447KB, pdf)

Footnotes

Financial support: This work was supported in part by a grant from the Institute for Human Infections and Immunity, University of Texas Medical Branch (NV), NIH contract HHSN272201000040I/HHSN27200004/D04 (RBT, NV). ECH is supported by an NHMRC Australia Fellowship.

Authors' addresses: Kim R. Blasdell, Cadhla Firth, and Peter J. Walker, CSIRO Biosecurity, Australian Animal Health Laboratory, Geelong, Victoria 3220, Australia, E-mails: kim.blasdell@csiro.au, cadhla.firth@csiro.au, and peter.walker@csiro,au. Hilda Guzman, Robert B. Tesh, and Nikos Vasilakis, Center for Biodefense and Emerging Infectious Diseases and Department of Pathology, Center for Tropical Diseases, and Institute for Human Infections and Immunity, The University of Texas Medical Branch, Galveston, TX, E-mails: hguzman@utmb.edu, rtesh@utmb.edu, and nivasila@utmb.edu. Steven G. Widen and Thomas G. Wood, Department of Biochemistry and Molecular Biology, The University of Texas Medical Branch, Galveston, TX, E-mails: sgwiden@utmb.edu and tgwood@utmb.edu. Edward C. Holmes, Marie Bashir Institute for Infectious Diseases and Biosecurity, School of Biological Sciences and Sydney Medical School, Charles Perkins Centre, The University of Sydney, Camperdown, New South Wales 2006, Australia, E-mail: edward.holmes@sydney.edu.au.

References

  • 1.Karabatsos N, editor. International Catalogue of Arboviruses Including Certain Other Viruses of Vertebrates. Third edition. San Antonio, TX: American Society for Tropical Medicine and Hygiene; 1985. [DOI] [PubMed] [Google Scholar]
  • 2.Cropp CB, Prange WC, Monath TP. Le Dantec virus: identification as a rhabdovirus associated with human infection and formation of a new serogroup. J Gen Virol. 1985;66:2749–2754. doi: 10.1099/0022-1317-66-12-2749. [DOI] [PubMed] [Google Scholar]
  • 3.Calisher CH, Karabatsos N, Zeller H, Digoutte J-P, Tesh RB, Shope RE, Travassos da Rosa AP, St. George TD. Antigenic relationships among rhabdoviruses from vertebrates and hematophagous arthropods. Intervirology. 1989;30:241–257. doi: 10.1159/000150100. [DOI] [PubMed] [Google Scholar]
  • 4.Woodruff AW, Ansdell VE, Bowen ET. Le Dantec virus infection in a patient who had not been to West Africa. BMJ. 1977;2:1632–1633. doi: 10.1136/bmj.2.6103.1632-a. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Tesh RB, Travassos da Rosa AP, Travassos da Rosa JS. Antigenic relationship among rhabdoviruses infecting terrestrial vertebrates. J Gen Virol. 1983;64:169–176. doi: 10.1099/0022-1317-64-1-169. [DOI] [PubMed] [Google Scholar]
  • 6.Bourhy H, Cowley JA, Larrous F, Holmes EC, Walker PJ. Phylogenetic relationships among rhabdoviruses inferred using the L polymerase gene. J Gen Virol. 2005;86:2849–2858. doi: 10.1099/vir.0.81128-0. [DOI] [PubMed] [Google Scholar]
  • 7.Kaneko N, Inaba Y, Akashi H, Miura Y, Shorthose J, Kurashige K. Isolation of a new bovine ephemeral fever group virus. Aust Vet J. 1986;63:29. doi: 10.1111/j.1751-0813.1986.tb02870.x. [DOI] [PubMed] [Google Scholar]
  • 8.Noda M, Inaba Y, Banjo M, Kubo M. Isolation of Fukuoka virus, a member of the Kern Canyon serogroup viruses of the family Rhabdoviridae, from cattle. Vet Microbiol. 1992;32:267–271. doi: 10.1016/0378-1135(92)90149-n. [DOI] [PubMed] [Google Scholar]
  • 9.Johnson HN. Disease derived from wildlife. Calif Health. 1965;23:35–39. [Google Scholar]
  • 10.Ndiaye M, Saluzzo JF, Digoutte JP, Mattei X. Identification du virus Nkolbisson par microscopie electronique. Ann Inst Pasteur Virol. 1987;138:517–521. [Google Scholar]
  • 11.Salaun JJ, Rickenbach A, Bres P, Brottes H, Germain M, Eouzan JP, Ferrara L. The Nkolbisson virus (YM 31-65), a new prototype of arbovirus isolated in Cameroun. Ann Inst Pasteur (Paris) 1969;116:254–260. [PubMed] [Google Scholar]
  • 12.Berge TO. International Catalogue of Arbovirus Including Certain Other Viruses of Vertebrates. Issue 8301 of DHEW publication. edition 2 Volume 75. Atlanta, GA: Public Health Service (CDC); 1975. [Google Scholar]
  • 13.Johnson BK, Shockley P, Chanas AC, Squires EJ, Gardner P, Wallace C, Simpson DI, Bowen ET, Platt GS, Way H, Chandler JA, Highton RB, Hill MN. Arbovirus isolations from mosquitoes: Kano Plain, Kenya. Trans R Soc Trop Med Hyg. 1977;71:518–521. doi: 10.1016/0035-9203(77)90147-x. [DOI] [PubMed] [Google Scholar]
  • 14.Sang R, Onyango C, Gachoya J, Mabinda E, Konongoi S, Ofula V, Dunster L, Okoth F, Coldren R, Tesh R, da Rossa AT, Finkbeiner S, Wang D, Crabtree M, Miller B. Tick-borne arbovirus surveillance in market livestock, Nairobi, Kenya. Emerg Infect Dis. 2006;12:1074–1080. doi: 10.3201/eid1207.060253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Butenko AM, Gromashevsky VL, L'Vov DK, Popov VF. First isolations of Barur virus (Rhabdoviridae) from ticks (Acari: Ixodidae) in Africa. J Med Entomol. 1981;18:232–234. doi: 10.1093/jmedent/18.3.232. [DOI] [PubMed] [Google Scholar]
  • 16.Kuzmin IV, Hughes GJ, Rupprecht CE. Phylogenetic relationships of seven previously unclassified viruses within the family Rhabdoviridae using partial nucleoprotein gene sequences. J Gen Virol. 2006;87:2323–2331. doi: 10.1099/vir.0.81879-0. [DOI] [PubMed] [Google Scholar]
  • 17.Kading RC, Gilbert AT, Mossel EC, Crabtree MB, Kuzmin IV, Niezgoda M, Agwanda B, Markotter W, Weil MR, Montgomery JM, Rupprecht CE, Miller BR. Isolation and molecular characterization of Fikirini rhabdovirus, a novel virus from a Kenyan bat. J Gen Virol. 2013;94:2393–2398. doi: 10.1099/vir.0.053983-0. [DOI] [PubMed] [Google Scholar]
  • 18.Metselaar D, Williams MC, Simpson DI, West R, Mutere FA. Mount Elgon bat virus: a hitherto undescribed virus from Rhinolophus hildebrandtii eloquens K. Anderson. Arch Gesamte Virusforsch. 1969;26:183–193. doi: 10.1007/BF01241186. [DOI] [PubMed] [Google Scholar]
  • 19.Iwasaki T, Inoue S, Tanaka K, Sato Y, Morikawa S, Hayasaka D, Moriyama M, Ono T, Kanai S, Yamada A, Kurata T. Characterization of Oita virus 296/1972 of Rhabdoviridae isolated from a horseshoe bat bearing characteristics of both lyssavirus and vesiculovirus. Arch Virol. 2004;149:1139–1154. doi: 10.1007/s00705-003-0271-x. [DOI] [PubMed] [Google Scholar]
  • 20.Ghedin E, Rogers MB, Widen SG, Guzman H, Travassos da Rosa AP, Wood TG, Fitch A, Popov V, Holmes EC, Walker PJ, Vasilakis N, Tesh RB. Kolente virus, a rhabdovirus species isolated from ticks and bats in the Republic of Guinea. J Gen Virol. 2013;94:2609–2615. doi: 10.1099/vir.0.055939-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Vasilakis N, Forrester NL, Palacios G, Nasar F, Savji N, Rossi SL, Guzman H, Wood TG, Popov V, Gorchakov R, Gonzalez AV, Haddow AD, Watts DM, da Rosa AP, Weaver SC, Lipkin WI, Tesh RB. Negevirus: a proposed new taxon of insect-specific viruses with wide geographic distribution. J Virol. 2013;87:2475–2488. doi: 10.1128/JVI.00776-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Blasdell KR, Voysey R, Bulach D, Joubert DA, Tesh RB, Boyle DB, Walker PJ. Kotonkan and Obodhiang viruses: African ephemeroviruses with large and complex genomes. Virology. 2012;425:143–153. doi: 10.1016/j.virol.2012.01.004. [DOI] [PubMed] [Google Scholar]
  • 23.Edgar RC. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics. 2004;5:113. doi: 10.1186/1471-2105-5-113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Talavera G, Castresana J. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst Biol. 2007;56:564–577. doi: 10.1080/10635150701472164. [DOI] [PubMed] [Google Scholar]
  • 25.Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol. 2010;59:307–321. doi: 10.1093/sysbio/syq010. [DOI] [PubMed] [Google Scholar]
  • 26.Dietzgen RG, Calisher CH, Kurath G, Kuzmin IV, Rodriguez LL, Stone DM, Tesh RB, Tordo N, Walker PJ, Wetzel T, Whitfield AE. In: Virus Taxonomy, Ninth Report of the International Committee on Taxonomy of Viruses. King A. M., Adams M. J., Carstens E. B., Lefkowitz E. J., editors. San Diego, CA: Elsevier; 2012. pp. 654–681. (Rhabdoviridae). [Google Scholar]
  • 27.Adams MJ, Carstens EB. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses, 2012. Arch Virol. 2012;157:1411–1422. doi: 10.1007/s00705-012-1299-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Adams MJ, King AM, Carstens EB. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses, 2013. Arch Virol. 2013;158:2023–2030. doi: 10.1007/s00705-013-1688-5. [DOI] [PubMed] [Google Scholar]
  • 29.Longdon B, Obbard DJ, Jiggins FM. Sigma viruses from three species of Drosophila form a major new clade in the rhabdovirus phylogeny. Proc Biol Sci. 2010;277:35–44. doi: 10.1098/rspb.2009.1472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Pauszek SJ, Allende R, Rodriguez LL. Characterization of the full-length genomic sequences of vesicular stomatitis Cocal and Alagoas viruses. Arch Virol. 2008;153:1353–1357. doi: 10.1007/s00705-008-0113-y. [DOI] [PubMed] [Google Scholar]
  • 31.Wang L, Wu H, Tao X, Li H, Rayner S, Liang G, Tang Q. Genetic and evolutionary characterization of RABVs from China using the phosphoprotein gene. Virol J. 2013;10:14. doi: 10.1186/1743-422X-10-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Nadin-Davis SA, Abdel-Malik M, Armstrong J, Wandeler AI. Lyssavirus P gene characterization provides insights into the phylogeny of the genus and identifies structural similarities and diversity within the encoded phosphoprotein. Virology. 2002;298:286–305. doi: 10.1006/viro.2002.1492. [DOI] [PubMed] [Google Scholar]
  • 33.Pauszek SJ, Rodriguez LL. Full-length genome analysis of vesicular stomatitis New Jersey virus strains representing the phylogenetic and geographic diversity of the virus. Arch Virol. 2012;157:2247–2251. doi: 10.1007/s00705-012-1420-x. [DOI] [PubMed] [Google Scholar]
  • 34.Blasdell KR, Voysey R, Bulach DM, Trinidad L, Tesh RB, Boyle DB, Walker PJ. Malakal virus from Africa and Kimberley virus from Australia are geographic variants of a widely distributed ephemerovirus. Virology. 2012;433:236–244. doi: 10.1016/j.virol.2012.08.008. [DOI] [PubMed] [Google Scholar]
  • 35.Walker PJ. Bovine ephemeral fever in Australia and the world. Curr Top Microbiol Immunol. 2005;292:57–80. doi: 10.1007/3-540-27485-5_4. [DOI] [PubMed] [Google Scholar]
  • 36.Gubala A, Davis S, Weir R, Melville L, Cowled C, Boyle D. Tibrogargan and Coastal Plains rhabdoviruses: genomic characterization, evolution of novel genes and seroprevalence in Australian livestock. J Gen Virol. 2011;92:2160–2170. doi: 10.1099/vir.0.026120-0. [DOI] [PubMed] [Google Scholar]
  • 37.Rupprecht CE, Turmelle A, Kuzmin IV. A perspective on lyssavirus emergence and perpetuation. Curr Opin Virol. 2011;1:662–670. doi: 10.1016/j.coviro.2011.10.014. [DOI] [PubMed] [Google Scholar]
  • 38.Stone DM, Kerr RC, Hughes M, Radford AD, Darby AC. Characterization of the genomes of four putative vesiculoviruses: tench rhabdovirus, grass carp rhabdovirus, perch rhabdovirus and eel rhabdovirus European X. Arch Virol. 2013;158:2371–2377. doi: 10.1007/s00705-013-1711-x. [DOI] [PubMed] [Google Scholar]
  • 39.Hoffmann B, Beer M, Schutze H, Mettenleiter TC. Fish rhabdoviruses: Molecular epidemiology and evolution. Curr Top Microbiol. 2005;292:81–117. doi: 10.1007/3-540-27485-5_5. [DOI] [PubMed] [Google Scholar]
  • 40.Agnarsson I, Zambrana-Torrelio CM, Flores-Saldana NP, May-Collado LJ. A time-calibrated species-level phylogeny of bats (Chiroptera, Mammalia) PLoS Curr. 2011;3 doi: 10.1371/currents.RRN1212. RRN1212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Badrane H, Tordo N. Host switching in Lyssavirus history from the Chiroptera to the Carnivora orders. J Virol. 2001;75:8096–8104. doi: 10.1128/JVI.75.17.8096-8104.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Longdon B, Wilfert L, Osei-Poku J, Cagney H, Obbard DJ, Jiggins FM. Host-switching by a vertically transmitted rhabdovirus in Drosophila. Biol Lett. 2011;7:747–750. doi: 10.1098/rsbl.2011.0160. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Datas.

SD7.pdf (447KB, pdf)

Articles from The American Journal of Tropical Medicine and Hygiene are provided here courtesy of The American Society of Tropical Medicine and Hygiene

RESOURCES