Role of Drosophila retinoblastoma protein instability element in cell growth and proliferation

Abstract

The RB tumor suppressor, a regulator of the cell cycle, apoptosis, senescence, and differentiation, is frequently mutated in human cancers. We recently described an evolutionarily conserved C-terminal “instability element” (IE) of the Drosophila Rbf1 retinoblastoma protein that regulates its turnover. Misexpression of wild-type or non-phosphorylatable forms of the Rbf1 protein leads to repression of cell cycle genes. In contrast, overexpression of a defective form of Rbf1 lacking the IE (ΔIE), a stabilized but transcriptionally less active form of the protein, induced ectopic S phase in cell culture. To determine how mutations in the Rbf1 IE may induce dominant effects in a developmental context, we assessed the impact of in vivo expression of mutant Rbf1 proteins on wing development. ΔIE expression resulted in overgrowth of larval wing imaginal discs and larger adult wings containing larger cells. In contrast, a point mutation in a conserved lysine of the IE (K774A) generated severely disrupted, reduced wings. These contrasting effects appear to correlate with control of apoptosis; expression of the pro-apoptotic reaper gene and DNA fragmentation measured by acridine orange stain increased in flies expressing the K774A isoform and was suppressed by expression of Rbf1ΔIE. Intriguingly, cancer associated mutations affecting RB homologs p130 and p107 may similarly induce dominant phenotypes.

Introduction

The retinoblastoma (Rb) protein functions as a regulator of cell cycle in multicellular eukaryotes, enabling progression of mitosis in a seamless manner. Rb is also key to the unfolding of developmental programs through its effects on differentiation and apoptosis. In light of its role in these central cellular processes, it is not surprising that the Rb gene or its regulatory pathway is disrupted in most human cancers.¹ The activity of the Rb protein is tightly regulated during the cell cycle. Hyper-phosphorylation of Rb during the late G1 phase by the activity of CDK/cyclin enzymes results in its inactivation throughout S, G2, and M phases.^2,3 Mammalian Rb and the homologous family members p130 and p107 are also subject to regulated protein turnover by proteasome dependent and independent pathways, a property shared by the Drosophila Rbf1 homolog.^4,5

We previously showed that the Drosophila Rbf1 protein is protected from turnover by the COP9 regulatory complex, and that a C-terminal instability element (IE) of the protein mediates turnover of the protein.⁶ Deletion of or point mutations in the IE stabilize Rbf1, and recent studies indicate that the IE is a conserved feature in mammalian Rb family proteins (Sengupta et al. (communicated)). At the same time, the IE appears to be critical for the transcriptional activity of Rbf1; removal of the entire IE inhibits Rbf1 activity on some but not all target genes in cell culture, while mutations that eliminate phosphorylation targets, or a conserved lysine 774, can exhibit marked hypermorphic effects.^5,7,8 We were particularly interested in 2 classes of mutation; that which eliminated the IE entirely, and mutations affecting K774. The ΔIE mutant protein induces ectopic cell cycles when expressed in cultured cells, and similar forms of proteins may be produced in cancer cells with nonsense mutations that eliminate the C-termini of Rb family proteins. Mutations affecting K774 did not significantly impact transcriptional activity in cell culture, but the mutant protein has dramatically disruptive effects on eye development in the fly.⁵ Interestingly, mutations in human p130 residue K1083 (homologous to K774 in Rbf1) have been reported in human lung cancer,⁹ although the frequency of occurrence of this lesion is not known. Because of the potential relevance of IE mutations to cancer, we assessed the developmental importance of both of these classes of mutation to Rbf1 in the wing, a highly sensitive system for quantitative assessment of morphological impacts and molecular effects on gene expression.

Results

Phenotypes induced by expression of mutant RBF1 proteins

To understand the functional consequence of mutations affecting the Rbf1 IE in a physiological setting, we overexpressed Rbf1, Rbf1ΔIE and K774R/A in larval wing imaginal discs using a pendulin GAL4 driver (Fig. 1A). Flies expressing Rbf1 appeared to have slightly smaller wings and had notches along the wing margins as previously noted.¹⁰ Expression of K774A and K774R had a much more severe effect, inducing significant size reduction and disruption of wing morphology, similar to its dramatic effect on eye development⁷ (Fig. 1B). Expression of Rbf1ΔIE did not induce gross disruption of wing development, but adult wings (Fig. 1B) and wing imaginal discs (Fig. 1C) dissected from third instar larvae expressing Rbf1ΔIE appeared to be slightly larger than those expressing wild-type Rbf1 or a control GFP protein. Discs from crosses expressing K774A were significantly smaller with perturbed tissue architecture (Fig. 1C).

Figure 1.

Mutant Rbf1 IE isoforms induce dominant and contrasting phenotypes. (A) Schematic diagram of wild type and mutant Rbf1 proteins. The E2F binding domain is shown in black and the instability element in gray. The instability element was excised in the mutant labeled ΔIE. Residue 774 was mutated to either a non-conservative alanine or a conservative arginine in 2 additional mutant proteins. (B) Wing phenotypes of adult flies expressing mutant isoforms. Representative images show the observed phenotype for each of the overexpressed proteins. The line bearing the PenGal4 alone showed no observable phenotype. The PenGal4 > UAS Rbf1 WT flies exhibited a notched phenotype, while the PenGal4 > UAS Rbf1ΔIE exhibited a slight increase in wing size. Wings from crosses expressing Rbf1K774A or K774R exhibited dramatic decreases in size among other defects. All images were taken at 4× magnification and in each case more than 30 wings were examined. (C) Third instar larval wing imaginal discs of Rbf1 mutants showing distinct growth response. The wing discs of the mutant flies were dissected from third instar larvae and photographed. The control PenGal4 > UAS GFP flies had discs that were indistinguishable from wild-type wing discs. Discs expressing wild-type Rbf1 appeared to be slightly reduced in size but showed no obvious defects in gross morphology. The PenGal4 > UAS Rbf1ΔIE discs were noticeably larger in size compared to wild-type discs, while discs expressing Rbf1K774A were much smaller than wild type and showed dramatic morphological defects. Shown are the most commonly observed phenotypes for each transgenic line, representing approximately 75% of at least 100 discs observed for each genotype.

Previous studies with the Rbf1ΔIE mutant had not identified a biological activity of this protein when expressed in developing eyes, but our recent observations that the protein induces S phase entry in cultured cells, together with the transcriptional repression activity on certain promoters led us to quantitatively examine the effect on wing development. We used the WINGMACHINE tool¹¹ to measure controls and wings in which Rbf1ΔIE had been overexpressed. We observed a statistically significant ∼4% increase in the wing size of both males and females with expression of Rbf1ΔIE (Fig. 2A, B, and Table 1). Patterning of the wings was unaffected. Similar increases in wing size were noted when Rbf1ΔIE was expressed with a wing-specific beadex driver (not shown).

Figure 2.

Rbf1ΔIE expression causes an increase in wing and cell size (A) Representative wing images were chosen from the test and parental lines. (a,b,c) Representative images for the 2 parental lines and the test line. (d) Composite images of the parental lines. No significant size difference was noticed between the 2 parental lines. (e,f) The composite image of the test line and the parental lines revealed a significant increase in both length and width of the test line compared to the parental lines. (B) Surface area was measured using WINGMACHINE software. Males and females were evaluated separately due to sex-specific differences in wing size. Only right wings were measured. Both females and males show very significant (***P < 0.001, n = 22 to 25 wings) increases in surface area compared to both parental strains. (C) Cell size was measured using Fijiwings. Cell size was calculated using reported values for area measured and number of trichomes counted (n = 21 to 52 wings were used). The males showed greater increase in cell size compared to the females. Error bars represent standard deviation.

Table 1.

Tabulated results for wing and cell size measurements from crosses expressing Rbf1ΔIE. Mean surface area and cell size were tabulated with standard deviations. The increase in surface area was approximately 4% in both females and males, compared to those of the parental lines. Total wing area was deduced from 22-25 wings and 21-52 for cell size measurements. There was a 16% increase in cell size for males and 12% in females within the area measured

	♀			♂
Genotype	UAS Rbf1ΔIE	PenGal4	PenGal4 UAS Rbf1ΔIE	UAS Rbf1ΔIE	PenGal4	PenGal4 UAS Rbf1ΔIE
N	25	24	22	24	23	22
Mean surface area (mM2)	4.74 ± 0.14	4.69 ± 0.08	4.90 ± 0.05	4.00 ± 0.09	4.01 ± 0.08	4.18 ± 0.07
Percent increase in surface area		4.0%			4.4%
N	42	52	50	26	23	21
Mean cell size (pixels/trichome)	53.9 ± 2.6	54.7 ± 2.8	61.1 ± 2.3	46.2 ± 2.3	49.4 ± 2.7	57.3 ± 2.3
Percent increase in cell size			12%			16%

Expression of Rbf1ΔIE increases cell size

To determine whether the increase in wing size was due to increase in cell number, size or both, we measured the numbers of trichomes in a defined area of the wing. Single trichomes are produced by individual cells in adult wings. The number of trichomes and area calculations provides a basis to determine cell size and density. Measured cell size was significantly larger in wings of both males and females expressing Rbf1ΔIE (Fig. 2C, Table 1) and Rbf1 (data not shown). The stronger effect in the male may reflect the X-chromosomal location of the endogenous rbf1 gene; the hemizygosity of the males may lead to stronger perturbations of the Rbf1 regulon upon misexpression of the transgene.

Rbf1 isoforms induce contrasting apoptotic responses

Proliferation of imaginal disc tissue reflects a delicate balance of signaling processes that involve developmentally-regulated cell division and apoptosis. The Rbf1 protein and the mutant forms used in this study have been tested previously for protein expression and stability. Our studies show that transfected S2 cell cultures express Rbf1 and K774A isoforms at comparable levels, and exhibit similar protein stability. In contrast the Rbf1ΔIE protein is expressed at higher levels and has a longer half-life.^5,7 The opposing effects on proliferation noted for the Rbf1ΔIE and K774A/R alleles of Rbf1 therefore may reflect different impacts on apoptosis. We stained wing discs with the vital dye acridine orange, which is a particularly useful tool in identifying apoptotic bodies in the live tissue.^12,13 Wild-type wing discs in late third instar larvae show low levels of apoptosis, usually restricted to the notum-wing boundary area. In discs with expression of extra wild-type Rbf1, we observed increased acridine orange staining in the wing pouch, consistent with an earlier report¹⁰ (Fig. 3A). These levels were dramatically higher in discs where the K774A isoform was expressed, while discs with Rbf1ΔIE overexpression showed little apoptosis, similar to wild-type wing discs. Consistent with these observations, the pro-apoptotic gene reaper was found to be strongly induced in discs expressing the K774A mutant protein, and suppressed in discs expressing the Rbf1ΔIE protein (Fig. 3B). p53, a likely regulator of this gene, was similarly expressed at lowest levels in the Rbf1ΔIE background, and possibly modestly up regulated in the K774A discs. The expression of other pro-apoptotic genes, including hid, grim and sickle, did not show any significant changes (data not shown for grim and sickle, their levels were found to be extremely low in all samples; >14 fold lower than PCNA). RpL37a control ribosomal protein gene, showed no significant changes in expression, while 2 canonical Rbf1 cell-cycle related genes, PCNA and polα, were down regulated in response to all forms of the protein. Thus, the specific effects of overexpression of each form of Rbf1 appear to be associated with differential apoptotic responses.

Figure 3.

Differing apoptotic response to overexpression of Rbf1 isoforms. (A) Visualization of apoptosis in third instar larval wing imaginal discs. Wing discs were stained with acridine orange to examine apoptotic activity. No acridine-positive cells were observed in wild-type discs expressing only Gal4 or Rbf1ΔIE. Discs from flies expressing Rbf1 and Rbf1K774A showed numerous brightly stained spots, indicating increased apoptosis. Apoptosis was centralized in the wing pouch of flies expressing Rbf1 while the flies expressing Rbf1 K774A showed significant apoptosis throughout the wing disc. In each case 10 wings were stained and analyzed. (B) Distinct changes in the transcript levels of reaper in larval wing imaginal discs. reaper transcripts were reduced in discs from Rbf1ΔIE expressing flies, and strongly elevated in discs from Rbf1K774A expressing flies. hid transcript levels were not significantly different in any of the tested backgrounds; the higher variability reflects the very low expression level of this gene. Rbf1ΔIE expressing discs had significantly lower levels of p53 transcript levels, while changes in levels were not significantly different in other backgrounds. Levels of PCNA and Polα were reduced with expression of all isoforms. RpL37a showed no significant change in expression among the different lines. Transcript levels were normalized to those measured in discs with PenGal4 > GFP. Values represent averages of 5 biological replicates (*P < 0.05; **P < 0.01; ***P < 0.001) and error bars represent standard deviation.

Expression of Rbf1 or Rbf1 ΔIE increases disc cell size with no effect on cell cycle phasing

To examine the effect of Rbf1 or Rbf1ΔIE overexpression on cell cycle phasing, we dissociated wing imaginal discs from late third instar larvae overexpressing Rbf1 or Rbf1 ΔIE and measured DNA content and cell size by fluorescence activated cell sorting (FACS) (Fig. 4) Misexpression of Rbf1 or Rbf1ΔIE increased cell size as seen by the rightward shift in the mean of the histogram, indicating larger cell size, while the percentages of cells in each phase of the cell cycle were unaffected in both when compared to control discs. These effects on cell cycle and cell size are similar to previous observations for Rbf1 overexpression.^14,15

Figure 4.

Overexpression of Rbf1 and Rbf1ΔIE increases wing imaginal disc cell size with no effect on cell cycle phasing. (A) FACS analysis of Rbf1 and Rbf1ΔIE wing disc cells shows no significant change in cell cycle phasing compared to cells from control discs. Numbers represent the percentage of cells in each phase. A typical cell cycle profile is represented here (n = 3). (B) Cell size as measured by forward scatter (FSC). FSC analyses indicate that misexpression of Rbf1 (Mean = 1.24) and Rbf1ΔIE (Mean = 1.21) increases cell size as observed by the rightward shift in the mean of scatter intensity when compared to control (n = 2). Mean value is obtained by taking the ratio of forward scatter intensity value of Rbf or RbfΔIE to that of the control.

Discussion

Role of Rb/E2F in apoptosis

Although many mutations affecting RB in human cancer are thought to constitute a loss of function, there are specific cases in which elevated RB protein levels positively correlate with disease severity.¹⁶ Additionally, certain types of mutations in RB, p130, and p107 may not be inactivating, but rather generate hypo- or neomorphic forms of the proteins whose activities may contribute to cellular transformation. Indeed, mutations in Drosophila Rbf1 can generate a proliferative phenotype in cell culture.¹⁷ Our studies show that the Drosophila Rbf1 protein C-terminal IE domain affects protein stability and activity, generating gene-specific regulatory effects. This regulation through C-terminal IE-like domains is highly conserved in vertebrate RB family proteins (Sengupta et al., (communicated)), thus we determined here how changes to IE function impact Rbf-mediated developmental processes.

One of the most striking findings was the opposing effects on apoptosis produced by different lesions in Rbf1; the removal of the IE in its entirety suppressed apoptosis, while the point mutation K774A dramatically enhanced levels of this response. These functional differences are unlikely to be solely due to an overexpression artifact because gene expression analysis shows that all 3 isoforms repress pcna, and other canonical target genes in a similar manner. Rbf1 and its binding partner E2F1 have been previously linked to induction of apoptosis in Drosophila. Elevated levels of E2F1 induces pro-apoptotic genes such as p53, Ark/Apaf1, hid, and reaper.^18-20 While hid appears to be responsible for apoptosis in the eye discs, loss of Rbf1 also causes apoptosis in wing imaginal discs.^21-23 At the same time, expression of Rbf1 can also induce apoptosis in proliferating cells, an effect that is suppressed by ectopic E2F.¹⁸ The “threshold” model of E2F activation poses that a precise balance of Rbf1 to E2F1 may be essential to avoid induction of this response.²⁴ In our case, the most striking effects on apoptosis were those produced by mutant forms of Rbf1, both of which are competent for transcriptional regulation. Rbf1ΔIE, a protein entirely lacking the IE regulatory domain, may suppress apoptosis because this stabilized protein may continue to repress pro-apoptotic genes under circumstances where the wild-type protein is destroyed. Note that the differential impact on reaper, a pro-apoptotic gene, is likely to be indirect, as this gene is not found to be bound by Rbf1 in ChIP-Seq experiments.²⁵ The suppression of p53 expression may be important in this context, as p53 is an activator of reaper.²⁶

The strong pro-apoptotic effect of Rbf1K774A requires a different explanation; this protein was somewhat less effective in repression of PCNA, polα, and p53, thus it is possible that weaker effects on a broad range of target genes may induce an apoptotic response. One likely candidate would again be the p53 gene, which appears to be differentially regulated by Rbf1K774A compared to the effects of wild-type Rbf1 overexpression. Alternatively, or in addition, Rbf1K774A may displace endogenous Rbf1 but fail to effectively repress specific pro-apoptotic genes. Another possibility is that this protein may activate pro-apoptotic genes, similar to the activating role that Rb has on pro-apoptotic genes under conditions of DNA damage.²⁷

The notion that gene-specific readouts may reflect contributions of different portions of Rbf1, in this case the regulatory IE domain, is supported by structural analysis of the human Rb protein. The mammalian Rb protein makes different types of contacts with members of the E2F family; certain interactions mediated by the Rb pocket domain appear to involve all E2F family members, while other interactions provide discrimination between E2F family members.^28-30 An illustration of how specific interactions can control apoptotic responses stems from analysis of mutant Rb proteins in cell culture, where disruption of C-terminal interactions does not eliminate repression of cell cycle promoters such as p107 and cyclin E1, but it does abrogate apoptosis. Other mutations in the pocket and the C-terminal domains have an enhanced ability to repress apoptosis.³¹ Specific interactions between Rb and E2F proteins appear to be conserved. Residues in the C terminus of mammalian Rb make specific contacts with E2F; alanine substitutions in M851A, and V852A, which is conserved in the Drosophila IE ((Sengupta et al., (communicated)), abolish interaction with E2f1.^28,29 Thus mutations in the IE are likely to alter E2F interactions, preferentially affecting a subset of Rbf1 targets, with consequent effect on apoptosis. Genome-wide approaches will be helpful to identify such targets.

Consistent with our observations about the effects of Rbf1 overexpression, previous studies have shown that such perturbations increase cell size and cell doubling time.¹⁴ The slow progression through the cell cycle may permit increased accumulation of cell mass, leading to larger cells. Strikingly, only in the case of Rbf1ΔIE overexpression does this result in larger wings presumably because of this protein's anti-apoptotic activity. Increased apoptosis in the case of Rbf overexpression leads to smaller, notched adult wings, despite the larger cell size.

During development, activities of complex signaling pathways normally render imaginal disc growth resistant to perturbation. For instance, experimentally induced apoptosis during early stages of wing development is compensated by increased proliferation, resulting in discs of normal size.³² Besides cell cycle control programs, a variety of signaling mechanisms including the ecdysone, insulin, Wnt, Dpp, Notch, and Hippo pathways are responsible for coordinated growth rates between and within imaginal discs.^33-40 Expression of Rbf1ΔIE appears to override such controls, resulting in significantly larger cells and measurably larger wings. One possible molecular mechanism may involve changes to Hippo signaling, as the Yorkie effector of this pathway has been demonstrated to co-regulate a number of promoters with E2F1 in Drosophila.⁴¹ We previously reported that removal of the IE domain has promoter-specific effects, which may differentially impact signaling pathway genes.⁸ Interestingly, the connection between Rb family proteins and Hippo signaling is evolutionarily conserved, as proliferative controls in mouse hepatocytes are dependent on both E2F/Rb family and Hippo signaling, and may be both affected in hepatocarcinomas.⁴²

Despite the tremendous progress in our understanding of Rb's role beyond cell cycle,⁴³ a major question regarding the function of specific Rb mutations particularly in disease such as cancer remains obscure. Our study argues that lesions affecting Rb family proteins may contribute to cancer in ways beyond simple loss of function. Cancer sequencing projects⁴⁴ have identified a number of mutations in p107 and p130 that result in truncation of the C-terminal regions of these proteins and subsequent loss of the conserved IE domains. The molecular activities of Rbf1ΔIE are consistent with this hypothesis, as a dominant, proliferative, anti-apoptotic activity would presumably be selected for in the development of tumors. Additional studies are required to determine whether such mutations can induce similar phenotypes in vertebrates, and whether such activities may present interesting new targets in cancer therapy or diagnosis. Less obvious is the significance of the Rbf1K774A mutation to development of cancer; if this protein were to be expressed in a cell, it appears that its pro-apoptotic activity would be selected against, unless the perturbed signaling were different in the context of additional mutations accompanying cellular transformation. Determination of the mechanism by which this protein shifts cells to an apoptotic state may be useful for treatment tumors that express Rb family proteins, assuming that Rb, p107, or p130 are similarly affected by such mutations.

Materials and Methods

Fly genetics

The Rbf1 expression lines were constructed as described previously.^5,7 Driver lines w[1118] P{w[+mW.hs] = GawB}Bx[MS1096] (referred to as Bx) and y[*] w[*]; P{GawB}NP6333 / CyO,{UAS-lacZ.UW14}UW14 (referred to as Pen) were obtained from the Bloomington Stock Center. For each experiment, 2 independent crosses were made with 3 virgin females of each genotype with males of the same genotype or differing genotype. The UAS attB Rbf1δIE line was balanced over Sm2 marked with CyO. Homozygosity was confirmed in previous experiments for females of both driver lines (data not shown). These crosses resulted in offspring with one of the following genotypes: PenGal4, BxGal4, UAS Rbf1δIE, PenGal4 > UAS Rbf1δIE, and BxGal4 > UAS Rbf1δIE. All crosses were made in parallel and stored at 26°C and 33% humidity. Parent flies were discarded at 9 days after original cross. Adult flies were collected on days 10-19 daily or on alternate days to control population sizes, flies exhibiting the CyO phenotype were discarded. Flies were stored in 80% ethanol in separate vials based on sex and genotype.

Wing photography

Right wings were identified, removed, and washed in 1× PBS. They were then mounted onto slides with mounting solution (70% glycerol, 30% PBS), photographed with an Olympus DP30BW camera mounted on an Olympus BW51 microscope at the same magnification and software settings. Approximately 15 landmarks were identified using tpsDIG software¹¹ which was then used to measure the surface area of the wing. To count cells and calculate cell size, wings were photographed at higher resolution with trichomes in focus using an Olympus BX51 microscope with an Olympus DP30BW camera under the same magnification and settings for all genotypes. Cell density and total trichome number were calculated using the Fijiwings 150px density tool.⁴⁵ The total number of trichomes were measured in a 150 × 150 pixel area located between L4 and L5 veins and immediately distal to the cross vein. Total numbers of trichomes counted ranged from roughly 300-500 within the area measured. Additional measurements were also made in a 75 × 75 pixel area between L3 and L4 at an equal distance between the intersection of the cross veins, with identical results. ANOVA tests were performed followed by post-hoc T-tests with a Bonferroni correction in Microsoft Excel 2013 to determine statistical significance.

Acridine orange staining

Third instar larvae of similar age were dissected in PBS 1×. Wing imaginal discs were collected and incubated 3 min in 0.6 mg/ml acridine orange/PBS 1× solution. Wing discs (approximately 8 from each line) were then rinsed in PBS 1× and rapidly photographed for fluorescence.

qRTPCR

Wing imaginal discs were dissected from third-instar larvae, and total RNA was isolated according to the Kreitman⁴⁶ protocol using TRIzol (Invitrogen) followed by Rneasy Mini kit (Qiagen) for cleanup. 300 ng of total RNA was converted to cDNA using High Capacity cDNA Reverse Transcription kit (Applied Biosystems). The resulting cDNA was diluted 1:10 and 3 µl was used for PCR in a 20 µl reaction mixture using SYBR green PCR Master Mix (Applied Biosystems). qPCR was performed on 5 biological replicates for each Rbf1 isoform. The fold change in gene expression was calculated based on ΔCt analysis method and normalized to rp49 gene expression. Figure 3B represent data from 4 biological replicates. Primers used for gene analysis were as follows: RpL37a forward CCTTCACGGAC CAGTTGTAG, RpL37a reverse ACAATAAGACGCACA CCCTG, reaper forward CCACCGT CGTCCTGGAAAC, reaper reverse CCGGTCTTCGGATGACATG, p53 forward CCGTGG TCCGCTGTCAA, p53 reverse TGCGTTATTGGCCGTCAAA, PCNA forward TGCAG CGACTCCGGCATTCA, PCNA reverse CGGAACGCAGGGTCAGCGAG, polα forward TGCTCTCAGATGAATGGAAGG, polα reverse TGAAGTGCG AAAGATAGTCCC, RBF1 forward AAGCAGCTGAGCGCCTTCGG, RBF1 reverse GCAGCTTGGCTATTACCTC TTCGCC, hid forward CGAGGATGAGCGCGAGTAC, hid reverse CGCCAAACTCG TCCCAAGT, rp49 forward ATCGGTTACGGATCGAACAAGC, and rp49 reverse GTAAA CGCGGTTCTGCATGAGC.

Flow cytometry

40–50 Wing imaginal discs from 3rd instar larvae were dissected in PBS and were incubated for 15 min at room temperature in 200 µl of trypsin solution (trypsin-EDTA, Sigma T4299) containing 3 µg/ml of Hoechst (Hoechst 33342, trihydrochloride trihydrate H3570, Molecular Probes) with gentle agitation. Trypsin digestion was stopped by addition of 300 µl of 1% fetal bovine serum (HI FBS, Gibco) in PBS, and after centrifugation at 3500 rpm for 5 min at 4°C the cells were resuspended in 350 µl of 1% FBS.⁴⁷ The cell cycle profile was analyzed on a BD Influx Sorter. Three independent experiments for cell cycle profiles were analyzed using Winlist version8 software. Two independent experiments were used for the analysis of cell size.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Funding

This work was supported by NIH GM079098 to RWH and DNA.