Abstract
Anhydrobiotic animals can survive the loss of both free and bound water from their cells. While in this state they are also resistant to freezing. This physiology adapts anhydrobiotes to harsh environments and it aids their dispersal. Panagrolaimus davidi, a bacterial feeding anhydrobiotic nematode isolated from Ross Island Antarctica, can survive intracellular ice formation when fully hydrated. A capacity to survive freezing while fully hydrated has also been observed in some other Antarctic nematodes. We experimentally determined the anhydrobiotic and freezing-tolerance phenotypes of 24 Panagrolaimus strains from tropical, temperate, continental and polar habitats and we analysed their phylogenetic relationships. We found that several other Panagrolaimus isolates can also survive freezing when fully hydrated and that tissue extracts from these freezing-tolerant nematodes can inhibit the growth of ice crystals. We show that P. davidi belongs to a clade of anhydrobiotic and freezing-tolerant panagrolaimids containing strains from temperate and continental regions and that P. superbus, an early colonizer at Surtsey island, Iceland after its volcanic formation, is closely related to a species from Pennsylvania, USA. Ancestral state reconstructions show that anhydrobiosis evolved deep in the phylogeny of Panagrolaimus. The early-diverging Panagrolaimus lineages are strongly anhydrobiotic but weakly freezing-tolerant, suggesting that freezing tolerance is most likely a derived trait. The common ancestors of the davidi and the superbus clades were anhydrobiotic and also possessed robust freezing tolerance, along with a capacity to inhibit the growth and recrystallization of ice crystals. Unlike other endemic Antarctic nematodes, the life history traits of P. davidi do not show evidence of an evolved response to polar conditions. Thus we suggest that the colonization of Antarctica by P. davidi and of Surtsey by P. superbus may be examples of recent “ecological fitting” of freezing-tolerant anhydrobiotic propagules to the respective abiotic conditions in Ross Island and Surtsey.
Introduction
Anhydrobiosis is a term used to describe the prolonged, reversible, ametabolic state that some organisms can attain in order to survive conditions of extreme desiccation [1]. Anhydrobiotes are capable of losing between 95–99% of their body water during this process [1,2]. This physiology is adapted to drought-prone environments, and also aids the dispersal of desiccated anhydrobiotes [3]. Taxa that can enter anhydrobiosis at all life stages include some bacteria, lichens, mosses, ferns, angiosperm “resurrection plants”, free-living nematodes, rotifers and tardigrades [4,5,6]. In other taxa anhydrobiosis is stage-specific: spores of some bacteria and fungi; embryonic cysts of brine shrimps and some other microcrustaceans; larvae of some parasitic nematodes; larvae of the chironomid insect Polypedilum vanderplanki and many plant seeds and pollens [4,6,7]. During anhydrobiosis metabolism and life processes come to a halt, but they resume again upon rehydration. While in an anhydrobiotic state organisms are also resistant to freezing, because they lack the water necessary to form tissue-damaging ice crystals [8,9]. Anhydrobiotes synthesise a variety of molecules to protect their macromolecules and cellular structures during desiccation [6,10,11,12]. These include water replacement molecules such as trehalose or other sugars; antioxidants; molecular chaperones; LEA (= “late embryogenesis abundant) proteins, which stabilize cellular proteins and prevent their aggregation; and desaturases which adjust membrane fluidity. Most anhydrobiotic organisms need to be dehydrated slowly to allow time for these metabolic adjustments to occur, but some “fast-dehydration strategist” nematodes [13,14] and mosses [15] can survive rapid dehydration.
A link between desiccation tolerance and cold tolerance is evident in organisms capable of undergoing cryoprotective dehydration. When soil freezes, some freeze-avoiding invertebrates with high integumental water permeability dehydrate until the melting point of their body fluids equals that of the frozen soil [16]. Some Collembola from polar and subpolar regions are examples of such organisms [17]. To protect their tissues from the effects of dehydration these micro-invertebrates synthesize osmolytes, molecular chaperones and antioxidants [18]. Freeze-avoiding fish and insects rely on antifreeze ice-active proteins (IAPs) to lower the freezing temperature of their supercooled body fluids to a point below the temperature of the ambient environment [19,20]. IAPs are very diverse in sequence and structure [21,22,23]. They function by binding to ice crystal surfaces and inhibiting their growth [21]. Antifreeze IAPs inhibit the growth of ice crystals over a range of temperatures in supercooled body fluids without altering the melting point of ice [20,24], an activity known as thermal hysteresis (TH). The temperature at which the ice crystal eventually grows is called the thermal hysteresis freezing point (THP). Within the TH gap ice crystals do not grow or melt [24]. The TH gap (the difference between the THP and the melting point) of fish IAP solutions is in the range 0.5–1.0°C [25], whereas insect IAPs have more potent TH activity, being capable of depressing the freezing point of tissue fluids by 3.5–4°C [22,23,26]. Insect IAPs, in synergy with the synthesis of polyols such as glycerol and the removal/inhibition of ice nucleating agents, can prevent freezing to -30°C [20]. IAPs isolated from plants and microorganisms generally have low TH activity, their main function being to inhibit the growth and recrystallization of ice crystals and its associated tissue damage [27,28]. Panagrolaimus davidi from Ross Island Antarctica is the best characterized example of a nematode that is capable of surviving intracellular ice formation when fully hydrated [29] and this capacity is associated with the synthesis of an IAP which inhibits the growth of ice crystals but lacks TH activity [30].
Panagrolaimid nematodes are bacterivores, occupying niches ranging from polar, temperate and semi-arid soils to terrestrial mosses [14]. They have been isolated from several sites in Antarctica, where they are abundant in the bacteria-rich soil associated with bird nesting sites [31] and Panagrolaimus superbus was isolated in 1981 from a gull’s nest in Surtsey [32], an icelandic island formed during 1963 to 1967 by volcanic eruptions [33]. The occurrence of freezing-tolerant phenotypes in panagrolaimids other than P. davidi has not been investigated previously. In the present study we experimentally determined the anhydrobiotic and freezing tolerance phenotypes of 24 Panagrolaimus strains from tropical, temperate, continental and polar habitats and analysed their phylogenetic relationships. We found that several other Panagrolaimus isolates, in addition to P. davidi from Antartica, are able to survive freezing when fully hydrated and that tissue extracts from these freezing-tolerant nematodes can inhibit the growth of ice crystals. These isolates include P. superbus from Surtsey, Iceland, along with several anhydrobiotic strains from temperate regions. Using this dataset we addressed several questions concerning the biology and evolution of freezing and desiccation tolerance in panagrolaimid nematodes:
Is freezing tolerance in Panagrolaimus associated with TH effects?
Did the frozen nematodes undergo cryoprotective dehydration?
Are the freezing-tolerant and anhydrobiotic isolates of Panagrolaimus closely related phylogenetically, or do these phenotypes represent instances of convergent evolution?
Does the pattern of association between freezing-tolerance and desiccation-tolerance phenotypes in individual isolates across the phylogeny show evidence of correlated evolution?
Did the evolution of freezing tolerance in P. davidi predate its dispersal to Antarctica?
We found that tissue extracts from freezing-tolerant nematodes lack TH activity and that photomicrographs of frozen nematodes did not show evidence of cryoprotective dehydration. Phylogenetic signal for both the anhydrobiosis and the freezing-tolerance phenotypes was high—an indication that, with regard to these traits, related panagrolaimids resemble each other more closely than they resemble randomly sampled strains from the phylogeny [34]. Ancestral trait reconstructions indicate that the early-diverging lineages in this Panagrolaimus phylogeny were strongly anhydrobiotic but weakly freezing tolerant. These reconstructions also show that prior to the radiation of the P. davidi clade and the dispersal of P. davidi to Antarctica the common ancestor of this clade already possessed a potent freezing-tolerant phenotype, along with a capacity to inhibit the growth and recrystallization of ice.
Materials and Methods
Source and Culturing of Panagrolaimus Isolates
The sources and geographic origins of the 24 Panagrolaimus isolates are listed in S1 Table. The nematodes were cultured at 20°C in the dark on nematode growth medium (NGM) plates [35] containing a lawn of streptomycin-resistant Escherichia coli strain HB101 obtained from the Caenorhabditis Genetics Center (http://www.cbs.umn.edu/cgc). The NGM was supplemented with streptomycin sulfate (30 μg mL-1). Twelve new Panagrolaimus strains were isolated using the agar plate method described by Barrière and Félix [36]. Mixed-stage nematodes (i.e. containing a mixture of larvae and adult males and females) were harvested from the NGM plates using distilled water. The nematode suspension was transferred to 50 ml Falcon tubes and the nematodes were separated from their E. coli food source by sedimentation at room temperature (or at 10°C for the cold acclimated nematodes). The supernatant containing the E. coli was removed and fresh distilled water was added. This settling process was repeated a total of three times.
Desiccation Tolerance
Desiccation tolerance was determined using mixed-stage nematode populations. A 1 mL suspension of freshly-harvested nematodes in distilled water (concentration 2,000 nematodes mL-1) was vacuum filtered onto a 2.5 cm Supor-450 filter (Merk Millipore, Billerica, Ma, USA). The filters were then transferred to 3 cm Petri dishes without lids and placed in a 10.0 L desiccation chamber containing approximately 300 mL of saturated potassium dichromate (K2Cr2O7) which maintained a relative humidity (RH) of 98% [37]. Following different preconditioning treatments (0 h, 24 h, 48 h, 72 h or 96 h at 98% RH) the nematode dishes were placed in sealed plastic boxes containing freshly activated silica gel for 48 h. Then the desiccated nematodes were rehydrated by adding 1 mL of distilled water to each Petri dish. The dishes were incubated with shaking at 50 rpm, for 24 h at 20°C and post-rehydration survival was assessed by microscopic observation of nematode motility. Three biological replicates (i.e. separate Supor filters) were prepared for each treatment and nematode survival counts were obtained for four separate aliquots from each filter. For each aliquot a minimum of 80 nematodes was observed.
Freezing Tolerance
One mL suspensions of freshly-harvested mixed-stage nematodes (2,000 nematodes mL-1 in distilled water) were transferred to 1.5 mL Eppendorf tubes and placed in a 935 cm3 (volume) polystyrene box in a -80°C freezer which provided a cooling rate of 3.02°C min-1. A single freezing exotherm was detected at -4.6°C (S1 Fig.). The duration of this exotherm was 550 s and during the first 440 s of the exotherm the cooling rate decreased to 0.02°C min-1, thereafter the cooling rate increased rapidly towards its previous rate of ~ 3.02°C min-1. The cooling rate was measured using a National Semiconductor/Texas Instruments LM35A Precision Centrigade Temperature Sensor, range +150°C to -55°C (Dallas, Tx, USA). A customized LabVIEW (www.ni.com/labview/) data acquisition program interfaced with the thermocouple output through a National Instruments AT-MIO-16E-IO data acquisition board (www.ni.com). The nematodes were left in the -80°C freezer for 24 h. Then the 1 mL aliqots of frozen nematodes were thawed rapidly at 30°C, transferred to a 3 cm Petri dish and allowed to recover at 20°C for 24 h, with shaking at 50 rpm. Freezing survival was then assessed by microscopic observation of nematode movement. Four biological replicates were prepared for each experiment and nematode survival counts were obtained for four separate aliquots from each biological replicate. For each aliquot a minimum of 80 nematodes was observed.
A pilot experiment was set up to investigate the effect of cold acclimation on the freezing tolerance of P. superbus (S2 Fig.). The nematodes were grown at 20°C on NGM agar plates containing a lawn of E. coli until a mixed stage population had developed (~10 days). The nematodes were then acclimated (a) on the NGM agar plates at 4°C or 10°C for 4 or 10 days or (b) in 1 mL aliqots (2,000 nematodes mL-1 in distilled water in a 1.5 mL Eppendorf tube) at 4°C or 10°C for 6 h. Following acclimation the nematodes were frozen as described above. Twenty-four hours later the 1 mL aliqots of nematodes were thawed and their survival assessed after a 24 h recovery period at 20°C. Based on the data from the pilot experiment the assays used to assess freezing-tolerance phenotypes ulilized nematodes grown on NGM plates at 20°C (controls) or nematodes which had been acclimated on NGM plates at 10°C for 10 days (cold acclimated) prior to freezing.
Preparation of Panagrolaimus Tissue Extracts for Ice Growth and Thermal Hysteresis Measurements
Mixed-stage nematodes from twenty 9 cm NGM plates were harvested as described in the main text. The cleaned nematodes were resuspended in S buffer [0.1 M NaCl and 0.05 M potassium phosphate (pH 6.0) [35], and centrifuged at 4,000g in a Hermle Z 020060A bench centrifuge. The resulting ca. 500 μL pellet of packed nematodes was resuspended in 0.5x volume of ice cold S buffer and the nematode suspension was dripped into liquid nitrogen in an autoclaved mortar and ground to a fine powder using an autoclaved pestle. The extract was transferred to a sterile 1.5 ml Eppendorf tube containing 0.25 g of ice-cold glass beads (<106 microns, Cat. No. G 8893, Sigma-Aldrich, St. Louis, Mo, USA). The sample was then homogenised using a Mini-beadbeater (Biospec Products, Bartlesville, Ok, USA) on ice for three 30 sec pulses at high speed, with cooling on ice for 1 min between each pulse. The extract was then centrifuged at 17,700g at 4°C for ten min in an Eppendorf 5417R centrifuge and the supernatant solution was retained. The protein concentration of the supernatant was determined using a BCA (bicinchoninic acid) protein assay kit (Novagen, Merk Millipore, Billerica, Ma, USA) and the supernatant was aliquotted and stored at -80°C until used.
Ice-Crystal Growth Assays and Thermal Hysteresis Measurements
The ability of Panagrolaimus tissue extracts to inhibit the growth of a single seed ice crystal was determined using a freezing-point nanolitre osmometer (Otago Osmometers, Dunedin, NZ) following the protocols of Wharton et al. [30] and Ramløv et al. [38]. The protein concentration of the extracts was adjusted to 2 μg μL-1 with S buffer for use in these assays. The freezing point osmometer comprises a Peltier temperature-controlling device with an integrated microscope cryostage that was placed onto the viewing stage of an Olympus BX51 microscope. The cryostage was maintained at 0°C to load the samples. A drop of oil (Cargille’s A: Cargille Laboratories, Cedar Grove, NJ, USA) was placed into a micro well in an aluminium sample holder on the cryostage and the tissue extract (ca. 10 nL) was inserted into the oil drop using an elongated microcapillary tube. The extract was frozen by rapidly cooling the stage to -20°C. The cryostage temperature was increased until the ice began to melt, then the temperature was raised very slowly (0.01°C min-1) until the melting temperature (the temperature at which the last tiny ice crystal melted) was reached. The temperature was then decreased to refreeze the sample and it was increased again to melt the sample back to a single small ice crystal. The temperature was lowered very slowly (~ 0.01°C min-1) until discernable growth of the ice crystal occurred. The temperature at which ice growth recommences corresponds to the hysteresis freezing point. Thermal hysteresis (TH) was calculated as the difference between the melting temperatures of the tissue extract and its hysteresis freezing point. The morphology of the ice crystals upon growth at the hysteresis freezing point was noted and the crystals were photographed using the Olympus BX51 imaging system. TH measurements were obtained for tissue extracts from two Panagrolaimus strains prepared using three different buffer systems: (a) S buffer [35]; (b) 25 mM Tris HCl, pH 8.6 and (c) 0.1 M NH4HCO3 pH 7.9] (Table 1).
Table 1. Thermal hysteresis measurements for tissue extracts from two Panagrolaimus strains determined using three buffer systems.
Thermal Hysteresis (°C)* | |||
---|---|---|---|
25 mM Tris HCl, pH 8.6 | S buffer pH 6.0 † | 0.1 M NH4HCO3, pH 7.9 | |
Panagrolaimus sp. PS1159 | 0.01±0 | 0.01±0 | 0.02±0 |
Panagrolaimus sp. SN103 | 0.02±0 | 0.03±0.01 | 0.03±0.01 |
Buffer control | 0.02±0.01 | 0.03±0.01 | 0.02±0.01 |
* mean ± standard error, N = 3
† 0.1 M NaCl, 0.05 M potassium phosphate, pH 6.0 [35].
Recrystallization inhibition was tested using a splat freezing assay as described by Wharton et al. [30]. Ten μL of each test sample was dropped onto an aluminium block that had been cooled to -78°C by dry ice. A portion of the resulting thin layer of polycrystalline ice was transferred to a microscope cold stage and the temperature was raised to -8°C (ice recrystallization is more pronounced at high sub-zero temperatures because smaller ice crystals, which have higher melting temperatures, tend to melt and reanneal with larger crystals). The ice crystals were allowed to anneal for 30 min at -8°C and were then photographed between crossed Polaroid filters. The maximum diameter of the ten most prominent ice crystals in each photograph was measured using the public domain Image J program (http://rsbweb.nih.gov/ij/).
Microscopy of Thawed Nematodes
One mL suspensions of freshly-harvested mixed-stage nematodes (2,000 nematodes mL-1 in distilled water) were frozen as described above. After 24 h the frozen contents of a single Eppendorf tube were transferred to a Petri dish. When the ice began to melt emerging nematodes were immediately transferred, using an aspirator, to an air-dried 2% agarose pad on a cover slip. The cover slip was placed on the stage of an Olympus SZX16 microscope and the nematodes were photographed immediately. The agarose pads, which help to immobilize the nematodes, were prepared as described by Fire [39].
Principal Component Analysis
Principal component analysis was performed on the proportional desiccation and freezing data (five desiccation treatments and two freezing treatments-S2 Table), using the princomp function in R. The multivariate normality of the untransformed data was first confirmed (P<0.01) using the mshapiro.test function (Shapiro-Wilk test) in the R software package mvnormtest. Prior to PCA the proportional data were scaled by subtracting the mean from the standard deviation of each sample.
Phylogenetic and Evolutionary Analyses
(a) Phylogenetic reconstruction (tree building)
Nematode DNA was extracted using a DNeasy Blood and Tissue extraction Kit (Qiagen, N.V. Netherlands). The nematodes were harvested as described above and a 100–200 μL packed nematode pellet was ground in 200 μL of nematode lysis buffer [20 mM Tris HCl pH 7.5, 50 mM EDTA, 200 mM NaCl, 0.5% (w/v) SDS] in an autoclaved mortar and pestle using liquid nitrogen. The remainder of the extraction protocol followed the manufacturer’s instructions for animal tissues, including the RNase A digestion step. The 28S rDNA D3 expansion region was PCR amplified using the primers D3A 5’-GACCCGTCTTGAAACACGGA-3’ and D3B 5’ TCGGAAGGAACCAGCTACTA3’ [40] as previously described [14]. PCR amplicons were purified using a QIAquick PCR purification kit (Qiagen), cloned into the pJET1.2/blunt vector (Fermentas, Thermo Scientific, Waltham, Ma, USA) and transformed into E. coli TOP10 cells (Invitrogen), according to the manufacturers’ instructions. The plasmids were purified from E. coli cultures using a QIAprep Spin Miniprep kit (Qiagen) and the purified plasmids were sequenced by LGC Genomics (Berlin, Germany). For each nematode strain the inserts from at least two recombinant plasmids were sequenced in the forward and reverse directions. The GenBank accession numbers of these D3 sequences are presented in S3 Table.
Multiple sequence alignments were created using ClustalW2 [41] as implemented in Mega 5.1 [42]. Phylogenetic trees were constructed using maximum likelihood [43] and Bayesian methods [44]. The best-fit evolutionary model was determined using the Find Best-Fit Substitution Model (ML) in MEGA 5.1. For the Bayesian analyses the Tamura 3-parameter substitution model with gamma-distributed rate variation across all sites (T92+G) was used [45]. Four Markov chains were run and the chains were sampled every 100th generation. To ensure convergence, replicate generations were run until the standard deviation of split frequencies fell below 0.05. The first 25% of the trees generated was discarded as burnin and trees that had not converged (split frequencies >0.05) were removed. Results of the analyses were summarized using a majority rule consensus tree, where support values represent nodal posterior probabilities.
(b) Ancestral character state reconstructions
We performed ancestral character state reconstructions in Mesquite 2.75 [46] under maximum likelihood, using the symmetrical Mk1 (one-parameter Markov k-state) model [47]. The Panagrolaimus phylogeny used for this analysis was a Bayesian 50% majority rule consensus tree (S3 Fig.). We further tested our results in Mesquite under maximum parsimony. The results were consistent with those obtained using the MK1 model and are not presented. Anhydrobiotic survival data were converted to binary characters as follows: survival following preconditioning for 72 h at 98% RH > 50% = 1; survival following preconditioning for 72 h at 98% RH < 50% = 0. These criteria were selected because the anhydrobiotic phenotypes of majority of strains had stabilized following 72 h preconditioning (S4 Fig.) and the phylogenetic signal at this time point was strong (Table 2). The three isolates coded 0 were P. paetzoldi (0% survival); P. sp. JU765 (0% survival) and P. sp. JU765 (20.1% survival); these three isolates are the sole members of PCA group 1. The freezing survival data for both cold acclimated and non acclimated nematodes were converted to binary characters as follows: percentage survival < 20% = 0; percentage survival > 20% = 1.
Table 2. Estimation of phylogenetic signal in Panagrolaimius freezing-tolerance and anhydrobiosis phenotypes, based on fit to a Brownian motion model of trait evolution estimated using Pagel’s λ metric [43] and the caper package [48].
Trait | λ | 95% Confidence Interval | Likelihood Ratio Tests | |
---|---|---|---|---|
λ = 0 | λ = 1 | |||
Freezing Tolerance | ||||
Not acclimated | 0.80 | (0.47–0.94) | <0.001 | <0.001 |
Cold acclimated (10°C, 10d) | 0.88 | (0.47–0.97) | <0.01 | <0.001 |
Anhydrobiosis | ||||
Preconditioning (98% RH, 0h) | 0.63 | (0.16–0.92) | <0.01 | <0.001 |
Preconditioning (98% RH, 24h) | 0.78 | (0.44–0.93) | <0.001 | <0.001 |
Preconditioning (98% RH, 48h) | 0.82 | (0.51–0.95) | <0.001 | <0.001 |
Preconditioning (98% RH, 72h) | 0.82 | (0.51–0.95) | <0.001 | <0.001 |
Preconditioning (98% RH, 96h) | 0.99 | (0.97–1.0) | <0.001 | N.S. |
(c) Phylogenetic signal
The extent to which the anhydrobiosis and cryotolerance phenotypes of the panagrolaimid taxa accorded with the topology and branch lengths of the rDNA D3 phylogeny (Fig. 1; S3 Fig.) was investigated using Pagel’s λ phylogenetic signal statistic [48]. Under a Brownian motion (BM) model of evolution, trait variance among species increases in direct proportion to their time of independent evolution, which is measured by the length of the branches separating them in a phylogeny [49]. Thus the phenotypes of members of lineages that have recently diverged tend to be more similar to each other than to members of more distantly related lineages. For a given phylogenetic tree and associated trait data the λ phylogenetic signal statistic is estimated from a phylogenetic variance co-variance matrix (i.e. the expected trait value in a given species is proportional to the total length of the tree, while the trait co-variance for each pair of species in the phylogeny is proportional to their shared evolutionary history which is given by the sum of their shared branch lengths) [50]. A maximum likelihood approach is then used to find the value of λ that best explains the variation for a continuous trait among the taxa at the tips of a phylogeny [48]. Pagel’s λ varies continuously from 0 to 1 with a λ value of 1 indicative of strong phylogenetic signal, i.e. the specified tree and a BM model of evolution fit the data well, while λ = 0 indicates a lack of phylogenetic signal, i.e. the traits under consideration are best represented by a “star” phylogeny where all species are equally distantly related to each other. Several evolutionary processes approximate a BM model [51,52]. These include genetic drift (neutral evolution), directional selection, fluctuating directional selection (where the optimal value is changed) and punctuated change. Scenarios which give rise to low phylogenetic signal are when a trait varies randomly across a phylogeny, or when distantly related species converge on a similar trait value (convergent evolution), or closely related species exhibit notably different trait values (adaptive radiation) or when the phenotype is influenced by the environment. To mitigate possible environmental effects, all the panagrolaimaid strains in our study were cultured and assayed under standard conditions. We estimated λ using the plgs function in the caper package [53]. The caper package calculates confidence intervals of the ML estimate and it incorporates log likelihood ratio tests of the significance of the estimated value of λ under the hypothesis λ = 0 and under the hypothesis λ = 1, with df = 1.
Fig 1. The phylogenetic relationships, anhydrobiotic and freezing tolerance phenotypes of 24 Panagrolaimus taxa.
(a). Bayesian 50% majority rule consensus tree derived from sequences from the rDNA D3 expansion region (see S3 Fig. for branch lengths for the phylogeny). (b). Freezing tolerance phenotypes. Unacclimated nematodes were cultured at 20°C, acclimated nematodes were cultured at 10°C for 10 d prior to freezing. Data are the means ± SEM of four biological replicates. Strains whose unacclimated tissue extracts inhibit ice crystal growth are indicated by +; those whose tissue extracts did not inhibit ice crystal growth are indicated by-. (c). The effect of preconditioning at 98% RH for 0, 24 or 72h on anhydrobiotic survival (see S4 Fig. for additional preconditioning time-points). Data are the means ± SEM of three biological replicates.
(d) Correlation analyses
The relationship between the survival of the cold acclimated nematodes and those that survived desiccation (preconditioning: 98% RH, 96 h) was investigated using Spearman’s non-parametric correlation test using the GraphPad Prism statistical package. To consider the impact of phylogeny on trait correlations within the PCA groups 3 and 4 from temperate and polar regions we generated an rDNA D3 phylogeny for these PCA Groups using a ClustalW2 multiple sequence alignment [41] and Bayesian phylogeny reconstruction methods [43], as described above. We then used a Phylogenetic Generalised Least Squares (PGLS) approach which simultaneously estimates Pagel’s λ along with the regression parameters to provide the necessary correction for trait covariance based on the phylogenetic signal of the data [50]. This analysis was carried out using the plgs function in the caper package [53] using the default scaling parameters as estimated by the program.
Results and Discussion
Anhydrobiotic and Freezing-Tolerance Phenotypes Occur Widely in Panagrolaimus Species and Strains
We previously reported on the anhydrobiotic capacity of 11 strains of Panagrolaimus [14,54]. Here we present survival data for 24 Panagrolaimus strains, 18 of which were not included in previous studies. Among these are newly isolated strains from Ireland, southern India, La Réunion, Cape Verde and California (See S1 Table for strain provenances). Some isolates are from relatively exposed sites—moss on a building roof (Panagrolaimus sp. AS03); a roof rain-gutter (sp. AS01); the surface of a rotting tree stump (sp. SN103); others were recovered from soil, or leaf litter or from rotting fruit at the soil surface, while Panagrolaimus sp. PS443 from Armenia was isolated from dry soil after 8 years storage in the laboratory [55]. The phylogenetic relationships of these strains are presented in Fig. 1(a) and S3 Fig. The effect of preconditioning the nematodes at 98% RH for 0, 24 or 72h on their subsequent anhydrobiotic survival, when exposed to freshly activated silica gel for 48 h, is presented in Fig. 1(c). Data for additional preconditioning time-points at 98% RH are shown in S4 Fig. These data show that a capacity to tolerate extreme desiccation over activated silica gel is widespread among Panagrolaimus strains and species.
When 24 unacclimated strains of Panagrolaimus were frozen at a cooling rate of 3.02°C min-1 and stored at -80°C for 24 h prior to thawing, their freezing-tolerance phenotypes appear to form a continuum [Fig. 1(b)], with survival values ranging from 0% to 56%. Eight strains are excellent survivors of freezing, with 39% or higher of the unacclimated nematodes surviving. This group includes P. davidi from Antarctica whose freezing capacity has previously been documented [29,30,56], as well as P. superbus from Iceland, but it also includes isolates from temperate regions. These results show that freezing tolerance phenotypes comparable, or superior, to that of P. davidi are common among panagrolamids. Surprisingly several of the strains from the tropics and subtropics were also able to survive freezing, having unacclimated survival values ranging from 2.3% (Panagrolaimus sp. JU1365, Tamil Nadu, India) to 23.8% (sp. JU1371, Pondicherry, India). Cold acclimation at 10°C for 10 days improves the freezing tolerance of the majority of the strains tested, most notably those with poor freezing tolerance when unacclimated [Fig. 1(b)].
Principal Component Analysis of Combined Anhydrobiotic and Freezing-Tolerance Datasets Reveals Four Phenotypic Groups
Principal component analysis (PCA) showed that two components explained 82.2% of the variability of the combined desiccation and freezing-tolerance phenotypes (S2 Table). These two components discriminated between four Groups (Fig. 2; S3 Fig.). The three strains in PCA Group 1 are desiccation sensitive and are freezing sensitive when unacclimated. Group 2 comprises Panagrolaimus sp. AS01 from Ireland, along with nine Panagrolaimus isolates with JU designations (from regions as different and distant as, for example, Southern India and Cape Verde in the Atlantic ocean). These nematodes have excellent “slow-dehydration” phenotypes, with maximal desiccation tolerance being achieved following preconditioning at 98% RH for 72–96 h. The survival values of 96 h preconditioned Group 2 nematodes range from 74.6% for JU1365 (from Tamil Nadu), to 95.7% for JU1361 (Kerala), but their freezing tolerance is moderate [Fig. 1(b)], ranging from 2.4% (JU1367, Tamil Nadu) to 24.9% (JU1371, Pondicherry) for non-acclimated nematodes and from 14.5% (JU1361) to 43.7% (JU1369, Tamil Nadu) for cold acclimated nematodes. PCA Group 3 contains slow-dehydration strategist nematodes with robust desiccation and freezing tolerances. Their maximal preconditioned desiccation survival values range from 67.1% (PS443 Byurakan, Armenia) to 92.6% (PS6470, Mid Mojave Desert, Ca, USA) and their cold-acclimated freezing survival values range from 44.7% (PS443) to 82.6% (PS1579, Botanic Gardens. San Mario, Ca). Group 4 strains (P. superbus, Surtsey, Iceland; P. davidi, Antarctica and Panagrolaimus sp. SN103 from a tree stump in the Cascade Mountains, Ca, USA) can withstand immediate exposure to extreme desiccation over activated silica gel and also have excellent freezing tolerance, with freezing survival values ranging from 64.1% survival (SN103) to 82.1% (P. superbus) for cold-acclimated nematodes.
Fig 2. Principal component analysis of the desiccation and freezing survival data for 24 Panagrolaimus strains.
The distribution of the strains in the plane formed by Principal Component 1 and Principal Component 2 is shown. These components, which correspond respectively to 57.34% and 24.86% of the variance, discriminated between four phenotypic groupings.
Freezing Tolerance in Panagrolaimus is Associated with a Capacity to Inhibit Ice Growth and Recrystallization, but not with Thermal Hysteresis.
Tissue extracts from several Panagrolaimus spp. can inhibit the growth of ice crystals
Extracts from P. davidi contain an ice-active protein (IAP) which inhibits the growth and recrystallization ice crystals [30]. Using freezing-point nanolitre osmometry, we tested the ability of tissue extracts from 24 unacclimated Panagrolaimus strains, including P. davidi, to inhibit the growth of a single seed ice crystal [Fig. 3(a); S5 Fig.]. In water or buffer, ice normally grows on the prism planes (along the horizontal a axes) of the crystal lattice, with little perpendicular growth on the basal plane (along the c axis), so that the ice crystals have the appearance of flat, round or irregular discs [27]. The majority of IAPs preferentially bind to the prism plane (S6 Fig.), inhibiting the growth of ice along the a axes and creating hexagonal discs [27]. When assayed at a protein concentration of 2 μg μL-1 the ice crystals formed from extracts of P. davidi and ten other Panagrolaimus strains were hexagonal in shape and inhibition of ice growth on the a axes of these crystals was evident from their truncated pyramidal growth patterns. Ice crystals formed from extracts from the remaining strains had the appearance of flat, round discs, indicative of unrestricted ice growth along the a axes. Fig. 1 (b) shows that the strains whose unacclimated tissue extracts inhibit ice-crystal growth have robust freezing tolerance (>20% survival following exposure to -80°C for 24 h) and that extracts from all members of the clade that contains P. davidi are able to inhibit the growth of ice crystals.
Fig 3. The effect of tissue extracts from unacclimated Panagrolaimus strains on the growth, morphology and recrystallization of ice crystals.
Panel (a). Crystals formed in the presence of extracts from freezing-tolerant strains (a-c) have a distinct faceted morphology characteristic of the activity of ice-active proteins; ice crystals formed in the presence of extracts from a freezing sensitive strains (d, e) and in buffer controls (f) are cylindrical, indicating an uninhibited growth of the crystals. a: P. davidi; b: P. superbus; c: Panagrolaimus sp. PS1159; d: Panagrolaimus sp. JU765; e: Panagrolaimus sp. JU1367; f: S buffer (0.1 M NaCl, 0.05 M potassium phosphate, pH 6.0). Scale bar = 25 μM). Panel (b). Splat frozen samples of a: Tris buffer (25 mM Tris HCl, pH 8.6) and tissue extracts from b: Panagrolaimus sp. PS1159 and c: Panagrolaimus sp. SN103 following annealing at -8°C for 30 min. Scale bar = 100μM.
Ice recrystallization (the annealing of small crystals with larger ones) is thermodynamically favoured [57] and the large ice crystals which result cause mechanical damage to frozen cells and tissues. Recrystallization inhibition assays for extracts from two freezing-tolerant strains from the P. davidi clade (Panagrolaimus sp. SN103 and sp. PS1159) show that, similar to P. davidi, these extracts also possess recrystallization inhibition activity [Fig. 3(b)], consistent with our nanolitre osmometer results on the inhibition of ice crystal growth. The mean crystal diameters were as follows: buffer controls, 125.6±2.3 μM; Panagrolaimus sp. 1159, 38.2±1.3 μM and Panagrolaimus sp. SN103, 97.1±3.8 μM (one way ANOVA: F = 285.8, p<0.001).
Freezing tolerant Panagrolaimus spp. lack thermal hysteresis activity
Some fish and freeze-avoiding insects rely on antifreeze IAPs to lower the freezing temperature of their supercooled body fluids to a point below the temperature of the ambient environment [19,20], an activity known as thermal hysteresis (TH). In contrast, the ice-active proteins that occur in freezing-tolerant plants [27] and arthropods [58,59], as well as in P. davidi [30], lack significant TH activity. In these freezing-tolerant organisms the IAPs function to inhibit the growth and recrystallization of ice crystals [27,59], but they do not affect the freezing point of the tissue fluids. When monitoring the growth and melting of ice crystals from Panagrolaimus tissue extracts using nanolitre osmometry, no evidence of a significant TH effect was apparent for extracts from any of the 24 strains tested. TH measurements for extracts from two freezing-tolerant strains from the P. davidi clade (Panagrolaimus sp. SN103 and sp. PS1159) prepared using three buffer systems are presented in Table 1. The TH activity measured for the buffer controls (0.02–0.03°C) was in the same range as that of the tissue extracts, as has previously been observed by Wharton et al. for P. davidi [30]. Thus, lacking TH activity to lower the freezing point of their tissue fluids, the ability of unacclimated freezing-tolerant Panagrolaimus to inhibit the growth and recrystallization of ice during freezing and thawing is likely to be an important adaptation in protecting their tissues against freezing-related tissue damage.
Cryoprotective Dehydration Versus Intracellular Freezing in Panagrolaimus
When the ambient aqueous medium freezes P. davidi may undergo either cryoprotective dehydration or intracellular freezing. The outcome depends on the ice nucleation temperature and the cooling and freezing rates of the ambient medium [56]. If the external medium freezes at high subzero temperatures (-1 to -2°C) P. davidi undergoes cryoprotective dehydration, losing water from its tissues because the vapour pressure of the external ice is lower than that of supercooled water at the same temperature [16]. When the ambient medium freezes at lower temperatures (-5°C or lower) ice propagation through P. davidi is rapid, both extracellular and intracellular compartments becoming frozen [56]. Similarly Convey and Worland [60] found that seven species of Antarctic nematodes were sensitive to exogenous ice nucleation, the nematodes freezing at high subzero temperatures (-2 to -5°C), which were above the supercooling points of their body fluids. In our study it also seems likely that ice nucleation of the ambient medium at -4.6°C (S1 Fig.) would cause the nematodes to undergo rapid inoculative freezing. The water loss that occurs during cryoprotective dehydration in nematodes and Collembola is associated with body shrinkage [18,56,61,62]. However photomicrographs of frozen Panagrolaimus taken immediately following thawing show no evidence of shrinkage in either the freezing-tolerant or freezing-sensitive strains (S7 Fig.), a strong indication that the tested Panagrolaimus strains did not undergo cryoprotective dehydration.
Phylogenetic Signal
The phylogenetic signal for the anhydrobiosis and freezing-tolerance phenotypes was high (Table 2), an indication of congruence between these phenotypes and the topology and branch lengths of the rDNA D3 phylogeny (S3 Fig.). The signal for the anhydrobiosis phenotypes increased with the length of preconditioning time spent at 98% RH, ranging from λ = 0.63 for control nematodes to λ = 0.99 for nematodes which had been preconditioned at 98% RH for 96h. The large 95% confidence interval for non-preconditioned control nematodes most probably reflects the low survival values obtained for many panagrolaimid taxa in the absence of preconditioning at 98% RH. High phylogenetic signal was obtained for freezing-tolerance phenotypes in both cold-acclimated and non-acclimated nematodes, indicating that closely-related species exhibit similar trait values, a trend that is also evident from Fig. 1. Two large-scale studies of phylogenetic signal in a variety of vertebrate and invertebrate taxa have shown that the traits that exhibited the highest signals were body size and morphology followed by life history and physiology, with behaviour traits having the lowest phylogenetic signals [50,63]. Thus low phylogenetic signal is often equated with evolutionary lability and strong signal with evolutionary conservatism [63,64]. Among invertebrates, Kellermann et al. [65] recorded high phylogenetic signals for cold-tolerance phenotypes in Drosophila (Pagel’s λ = 0.76 for females and λ = 0.83 for males), and in NW European land snails λ values of 0.96–1.0 were obtained for traits associated with cold-hardiness, including the temperature of crystallization (spontaneous freezing) of the snails [66]. By contrast Kellermann et al. [65] found that the phylogenetic signal for desiccation resistance in Drosophila (scored as survival time (h) in dry air at 20°C) was low (λ = 0.17 for females and λ = 0.19 for males), which the authors interpret as suggesting that in Drosophila “desiccation resistance evolves rapidly and free from phylogenetic restrictions”. Although a high phylogenetic signal does not yield information about the evolutionary process (selection, stasis or drift) that shaped the anhydrobiosis and freezing tolerance phenotypes in Panagrolaimus, the general congruence between these phenotypes with the topology and branch lengths of the rDNA D3 phylogeny is indicative of the phylogenetic stability of these traits, particularly for anhydrobiotic survival in strains preconditioned at 98% RH for 72–96 h. Phylogenetic stability of “slow-dehydration” anhydrobiosis phenotypes in Panagrolaimius may have resulted from stabilizing selection of an adaptively optimum phenotype and/or from phylogenetic niche conservatism [67,68], where diverging lineages retain similar niche-related traits following dispersal to new habitats.
Is There a Correlation between Freezing-Tolerance and Anhydrobiosis in Panagrolaimus?
A correlation between freezing-tolerance and anhydrobiotic phenotypes might occur in Panagrolaimus because of an overlap in the biochemical protection responses of the nematodes to desiccation and freezing; or because of their shared phylogeny; or because they occupy an environment where correlated selection for freezing-tolerance and anhydrobiosis may occur. Studies in insects that overwinter in temperate and polar environments frequently show evidence of cross-tolerance between the physiological responses to cold stress and desiccation stress, where the mechanisms that protect against one of these stresses also provide protection against the other (reviewed by Sinclair et al. [69]). Correlation analysis [Fig. 4(a)] shows that the freezing and anhydrobiotic phenotypes of all 24 Panagrolaimus strains are not correlated (Spearman’s r = 0.0033, p = 0.99), indicating that the biochemical and physiological responses of these nematodes to desiccation and freezing are unlikely to provide cross-tolerance. It is noteworthy that the nematodes in PCA Group 2 that possess the highest desiccation tolerance have substantially weaker freezing tolerance than PCA Group 3 and 4 nematodes [Fig. 4(a)]. PCA Group 2 nematodes are tropical and sub-tropical in origin, whereas the isolates from PCA Groups 3 and 4 were isolated in temperate and polar regions (with the exception of JB051 from Senegal). It is unlikely that the tropical and sub-tropical Panagrolaimus isolates have been exposed to correlated selection for freezing-tolerance and anhydrobiosis in their recent evolutionary history, however the isolates from temperate and polar regions are more likely to experience such correlated selection. PCA Groups 3 and 4 strains show a strong positive relationship between their freezing-tolerance and anhydrobiotic phenotypes [Fig. 4(b)], (Spearman’s r = 0.718, p = 0.016*). To assess whether this correlation may be the result of correlated selection for these traits, we generated an rDNA D3 phylogeny for PCA Groups 3 and 4 and we used a PGLS approach which estimates Pagel’s λ simultaneously with the regression parameters to provide a correction of trait covariance based on the phylogenetic signal of the data [50]. The results obtained (PGLS Adjusted R 2 = 0.5568, p = 0.005**, λ = 0) also show that freezing-tolerance and anhydrobiosis are correlated traits in the Panagrolaimus strains from PCA Groups 3 and 4. However these results need to be interpreted conservatively because, given the estimated λ = 0 value for these traits in the PCA Group 3 and 4 phylogeny, the PGLS correlation was estimated under the assumption that all the panagrolaimid isolates in PCA Groups 3 and 4 are equally distantly related to each other.
Fig 4. Correlation between freezing-tolerance and anhydrobiosis in Panagrolaimus.
(a) Spearman rank correlation between freezing-tolerance and anhydrobiosis in all 24 Panagrolaimus strains (r = 0.0033, N.S.). (b) Spearman rank correlation between freezing-tolerance and anhydrobiosis in Panagrolaimus PCA Group 3 and Group 4 strains (Spearman’s r = 0.718, p < 0.05). The data points are shaded as follows: PCA Group 1, purple; Group 2, red; Group 3 blue; Group 4 green.
Ancestral Character State Reconstruction of the Freezing-Survival and Anhydrobiotic Phenotypes during Panagrolaimus Evolution
Nematodes are essentially aquatic animals that need to be fully hydrated and covered in a water film for normal activity. Thus a large majority of nematode species are highly sensitive to desiccation and osmotic stress [10]. Ancestral character state reconstructions [Fig. 5(a)] show that an anhydrobiotic phenotype evolved deep in the phylogeny of Panagrolaimus. The probability that the ancestor of the clade containing Panagrolaimus spp. AS01, JU1367 and JU1369 was anhydrobiotic is significant (p = 0.96). A lower, but still relatively high (p = 0.64), probability exists that the more basal ancestor of the clade containing also Panagrolaimus spp. JU765 and JU1365 was also anhydrobiotic. Thus the lack of anhydrobiosis in Panagrolaimus sp. PS5056 most likely represents a secondary loss. The anhydrobiotic strains located in the early-diverging Panagrolaimius lineages have potent slow-dehydration phenotypes (PCA Group 2), indicating that the ancestral nematodes required gradual environmental desiccation to induce the molecular changes necessary for successful entry into anhydrobiosis. From these early anhydrobiotes a capacity to respond to more rapid desiccation emerged.
Fig 5. Maximum likelihood ancestral state reconstructions of anhydrobiotic (a) and ice-growth inhibition phenotypes (b) in Panagrolaimus under the assumption that all transition rates are equal and branch lengths are proportional to time.
At each node a pie chart represents the proportional (0–1) likelihood of each ancestral character state, coloured as in the key. Anhydrobiotic survival data were converted to binary characters as follows: survival following preconditioning at 72 h > 50% = 1; survival following preconditioning at 72 h < 50% = 0.
The evolution of robust freezing tolerance (survival > 20%), along with a capacity to inhibit the growth and recrystallization of ice crystals, arose relatively recently in Panagrolaimus phylogeny [Fig. 1; Fig. 5(b)]. In the most unparsimonious reconstruction, a capacity to inhibit ice-crystal growth emerged three times independently: in the davidi group, in the superbus group and in Panagrolaimus sp. PS6470. However, an intriguing possibility is that Panagrolaimus sp. PS5056 might have lost the ability to inhibit the growth of ice crystals secondarily, as this taxon has also secondarily lost anhydrobiosis [Fig. 5(a)] and its sister taxon is both anhydrobiotic and freezing tolerant. Under this scenario, a capacity to inhibit ice-crystal growth would have evolved only once in the common ancestor of the davidi, superbus and Panagrolaimus spp. PS6470/PS5056 clades. This reconstruction would also imply that the ice growth-inhibiting phenotype was secondarily lost in the five JU strains that form sister clade of the superbus group. These five JU strains were isolated in the tropics (southern India, La Réunion and Cape Verde, S1 Table), however they possess intermediate levels of freezing tolerance, which may represent a relict of a more potent freezing-tolerant ancestral state.
Freezing survival data [Fig. 1(b)] were converted to binary characters as follows: a) non-acclimated nematodes—survival < 20% = 0, n = 14, survival ranges 0–19.6%; survival > 20% = 1, n = 10, survival ranges 23.8–56.3%; b) cold-acclimated nematodes—survival < 20% = 0, n = 8, survival ranges 2.29–18.0%; survival > 20% = 1, n = 16 survival ranges 24.9–82.7%. We consider that the ten nematode isolates whose non-acclimated freezing survival exceeds 20% show evidence of robust freezing tolerance, with eight of these isolates having survival values in the range 35%- 56%. Included in this group are P. davidi from Antarctica (35% non-acclimated survival) and P. superbus from Iceland (56% non-acclimated survival). Ancestral character state reconstructions of the freezing-tolerant phenotypes of unacclimated Panagrolaimus [Fig. 6(a)] is congruent with the evolutionary history of the ice growth-inhibition phenotype postulated above. Cold acclimation improves the freezing tolerance of the majority of Panagrolaimus strains, and it has a marked effect on the survival of some strains from the early-stemming lineages that are freezing sensitive when unacclimated. Reconstructions of the ancestral character state of the freezing-tolerant phenotypes of cold-acclimated nematodes reveal a complex evolutionary pattern [Fig. 6(b)], suggesting that inducible proto-cryobiotic phenotypes may have evolved as independent lineage-specific events in several of the early-diverging Panagrolaimus species. In addition, this latter dataset provides further support (p = 0.77) for the hypothesis that the ancestor of the davidi, superbus and JU Cape Verde clades was freezing tolerant.
Fig 6. Maximum likelihood ancestral state reconstructions of freezing-tolerant phenotypes of (a) non-acclimated and (b) cold-acclimated Panagrolaimus species and strains, under the assumption that all transition rates are equal and branch lengths are proportional to time.
At each node a pie chart represents the proportional (0–1) likelihood of each ancestral character state, coloured as in the key. Survival data were converted to binary characters as follows: freezing survival > 20% = 1; freezing survival < 20% = 0. The nematodes were cold acclimated on nematode growth medium (NGM) plates at 10°C for 10 days.
The branch lengths subtending the terminal taxa in the phylogenetic tree derived from sequences from the rDNA D3 expansion region (S3 Fig.) indicate that several of the early-stemming lineages are quite divergent from the davidi, superbus and Cape Verde clades. Gaining a better insight into the evolution of freezing tolerance and acclimation phenotypes in the early-diverging Panagrolaimus species will necessitate the isolation and characterization of additional Panagrolaimus isolates from the early-stemming lineages of the phylogeny, as well as the testing of outgroups from the 24 currently accepted genera within the family Panagrolaimidae [70]. Although our ancestral state reconstructions do not provide a clear insight into the evolution of freezing tolerance in the early-diverging Panagrolaimus species, our ancestral character state reconstructions clearly show that the evolution of freezing tolerance in the davidi and superbus lineages arose in an anhydrobiotic ancestor and that the common ancestor of the davidi clade possessed a robust freezing tolerance and an ability to inhibit the growth and recrystallization of ice crystals prior to the lineage-splitting and radiation of this clade and the dispersal of P. davidi to Antarctica.
The Colonization of Antarctica by P. davidi and of Surtsey by P. superbus—Examples of “Ecological Fitting”?
Ancestral character state reconstructions show that the common ancestor of the P. davidi lineage and of the P. superbus lineage were freezing tolerant and also had the capacity to inhibit ice-crystal growth (Fig. 5). P. superbus, an early colonizer in a gull’s nest at Surtsey after the volcanic formation of this island, was most likely transported to the island as an anhydrobiotic propagule. The nematodes in the freezing-tolerant P. davidi clade are self-fertile, while the remaining nematodes in the phylogeny, with the exception of Panagrolaimus sp. JU765, are dioecious (S1 Table). A self-fertile mode of reproduction would facilitate the establishment of nematode populations following anhydrobiotic dispersal to new habitats. All members of the P. davidi clade have strong freezing-tolerance and anhydrobiosis phenotypes, along with the capacity to inhibit the growth of ice crystals. This combination of reproductive, anhydrobiotic and freezing-tolerant phenotypes is likely to have contributed to the wide geographic dispersal of the members of this clade and facilitated colonization of Antarctica by P. davidi. The Antarctic-specialist nematode Scottnema lindsayae, the sole member of a monotypic genus, is abundant and widespread where suitable ice-free soil occurs. In the laboratory its optimal growth temperature is 10°C [71], its reproductive cycle takes 218 days and its reproductive capacity declines if grown at higher temperatures [72]. By contrast, the optimal growth temperatures for P. davidi and P. superbus is ~25°C [73,74], and their life cycles are ~8 days at optimal temperature. These physiological and life-history traits do not show evidence of an evolved response to the polar environment and are more consistent with those of nematodes from a more seasonal temperate climate. The term “ecological fitting” was coined by Janzen [75] to describe the range expansion that may occur when a population acquires a robust genotype. In ecological fitting an organism interacts with its environment in a way that appears to indicate a shared evolutionary history, when the traits relevant to the interaction actually evolved elsewhere in response to different environmental conditions [76]. Our ancestral character state reconstructions suggest that the colonization of Antarctica by P. davidi and of Surtsey by P. superbus may be examples of the “ecological fitting” of pre-evolved freezing-tolerant phenotypes, together with a pre-evolved capacity to inhibit ice growth, to the prevailing abiotic conditions in these locations.
Conclusions
Panagrolaimus nematodes evolved an anhydrobiotic phenotype at an early stage in their evolutionary history. The anhydrobiotic early-diverging lineages were slow-dehydration strategists, requiring gradual environmental desiccation for entry into anhydrobiosis. Robust freezing-tolerant phenotypes, along with the capacity to inhibit ice crystal growth arose more recently in Panagrolaimus phylogeny. Since all the early-stemming lineages and the majority of the tropical isolates have weak freezing tolerance phenotypes, the correlation between freezing tolerance and anhydrobiosis across the Panagrolaimus phylogeny is weak. The stronger correlation between freezing-tolerant and anhydrobiotic phenotypes observed in nematodes from temperate and polar regions is suggestive of correlated selection for these traits in these environments. Cold acclimation improves the freezing tolerance of the majority of Panagrolaimus strains and it has a marked effect on the survival of some of the early-stemming strains that are freezing sensitive when unacclimated. This phenotypic plasticity in a slow-dehydration anhydrobiote ancestor may have provided a suitable milieu for the evolution of more potent freezing tolerance in nematodes occupying freezing-prone environments. The acquisition of a mechanism to inhibit intracellular ice growth is likely to have been important step in the evolution of freezing tolerance in these proto-cryobiotic ancestors.
The common ancestors of the davidi and the superbus clades were anhydrobiotic and also possessed robust freezing tolerance, along with a capacity to inhibit the growth and recrystallization of ice crystals. P. superbus was an early colonizer at Surtsey after the volcanic formation of this island. Unlike other endemic Antarctic nematodes, the life history traits of P. davidi do not show evidence of an evolved response to polar conditions and are more consistent with those of nematodes from a more seasonal temperate climate. Thus we suggest that the colonization of Antarctica by P. davidi and of Surtsey by P. superbus is an example of a contingent effect resulting from the ecological fitting of two freezing-tolerant nematode species to polar abiotic conditions.
Several of the early-stemming lineages in the rDNA D3 phylogeny are quite divergent from the davidi, superbus and Cape Verde clades. Gaining a better insight into the evolution of freezing-tolerance and acclimation phenotypes in the early-diverging Panagrolaimus species will require the isolation and characterization of additional Panagrolaimus isolates from the early-diverging lineages of the phylogeny, as well as the testing of outgroups from the 24 currently accepted genera within the family Panagrolaimidae. Better resolution of the polytomy in the clade containing P. davidi can be achieved incorporating sequence data from additional genes, and further insight into the evolution of the P. superbus clade would benefit from the isolation and characterization of Panagrolaimus strains from Iceland and adjacent countries, such as Norway and Scotland. Overall, the data presented here show that panagrolaimid nematodes are an excellent model system to study the evolution of anhydrobiosis and freezing tolerance. They are also ideally suited for comparative high-throughput transcriptomic and genomic studies which would provide molecular insights into the molecular mechanisms involved in anhydrobiosis and freezing tolerance.
Supporting Information
(PDF)
The nematodes were acclimated (a) on NGM agar plates containing a lawn of E. coli for different times and temperatures or (b) in water at different temperatures for 6 h prior to exposure in water to -80°C, at a cooling rate of 3.02°C min-1. After 24 h the nematodes were thawed and allowed to recover at 20°C for 24 h before their survival was determined. Survival values are the mean ± SEM of four biological replicates (* = p<0.05, ANOVA).
(PDF)
Bayesian 50% majority rule consensus tree obtained using Tamura 3-parameter model of evolution, with gamma-distributed rate variation across all sites (T92+G) [45]. Branch supports (Bayesian posterior probabilities) are shown. The colour groupings correspond to PCA groups 1–4 (Fig. 2): Group 1, purple; Group 2, red; Group 3 blue; Group 4 green.
(PNG)
The nematodes were preconditioned at 98% RH for 0, 24, 48, 72 or 96 h, desiccated for 48 h over activated silica gel, rehydrated in distilled water for 24 h before survival was determined. Data are the means ± SEM of three biological replicates. The groupings distinguished by PCA of the combined freezing and anhydrobiosis phenotypes are indicated.
(PDF)
The strains are A: AS03; B: P. rigidus AF36; C: SN103; D: JB115; E: PS1579; F: JB051; G: PS443; H: PS6470; I: P. paetzoldi; J: AS01; K: PS5056; L: JU1361; M: JU1365; N: JU1366; O: JU1369; P: JU1371; Q: JU1387; R: JU1645; S: JU1646; T: Caenorhabditis elegans. See S1 Table for the sources and geographic origins of the Panagrolaimus strains. Tissue extracts from unacclimated nematodes of PCA Groups 3 and 4 can inhibit ice crystal growth, while this capacity was not detected in any of the strains from PCA Groups 1 and 2. (scale bar 25 μm).
(DOCX)
The majority of ice active proteins preferentially bind to the prism planes, inhibiting the growth of ice along these planes and creating hexagonal discs. Continued ice growth on the basal planes and continued binding to prism faces results in the formation of truncated bipyrimidal ice crystals. Figure adapted from Davies and Hew [25].
(PDF)
The nematodes are: Panagrolaimus davidi (Antarctica) and P. superbus (Surtsey, Iceland), both freezing tolerant species; Panagrolaimus sp. JU1646 (Cape Verde), a strain with weak freezing tolerance and P. paetzoldi (Netherlands), a freezing sensitive species. Scale bar: strains a, c and g, 500 μm; strains b, d, e, f and h, 200 μm.
(PDF)
(DOCX)
(DOCX)
(DOCX)
Acknowledgments
This project was funded by Science Foundation Ireland (Projects 08/RFP/EOB166 and 09/RFP/EOB2506).
Data Availability
All relevant data are within the paper and its Supporting Information files. The GenBank accession numbers of the rDNA sequences generated in this project are presented in S2 Table.
Funding Statement
This project was funded by Science Foundation Ireland (Projects 08/RFP/EOB166 and 09/RFP/EOB2506).
References
- 1. Clegg JS (2001) Cryptobiosis—a peculiar state of biological organization. Comp Biochem Physiol B: Biochem Mol Biol 128: 613–624. [DOI] [PubMed] [Google Scholar]
- 2. Crowe JH, Hoekstra FA, Crowe LM (1992) Anhydrobiosis. Annu Rev Physiol 54: 579–599. [DOI] [PubMed] [Google Scholar]
- 3. Nkem JN, Wall DH, Virginia RA, Barrett JE, Broos EJ, et al. (2006) Wind dispersal of soil invertebrates in the McMurdo Dry valleys, Antarctica. Polar Biol 29: 346–352. [Google Scholar]
- 4. Clegg JS (2001) Cryptobiosis—a peculiar state of biological organization. Comp Biochem Physiol B 128: 613–624. [DOI] [PubMed] [Google Scholar]
- 5. Crowe JH, Hoekstra FA, Crowe LM (1992) Anhydrobiosis. Ann Rev Physiol 54: 579–599. [DOI] [PubMed] [Google Scholar]
- 6. Farrant JM, Moore JP (2011) Programming desiccation-tolerance: from plants to seeds to resurrection plants. Curr Opin Plant Biol 14: 340–345. 10.1016/j.pbi.2011.03.018 [DOI] [PubMed] [Google Scholar]
- 7. Alpert P (2006) Constraints of tolerance: why are desiccation-tolerant organisms so small or rare? J Exp Biol 209: 1575–1584. [DOI] [PubMed] [Google Scholar]
- 8. O’Dell SJ, Crowe JH (1979) Freezing in nematodes—effects of variable water contents. Cryobiology 16: 534–541. [DOI] [PubMed] [Google Scholar]
- 9. Crowe JH, Crowe LM, O’Dell SJ (1981) Ice formation during freezing of Artemia cysts of variable water contents. Mol Physiol 1: 145–152. [Google Scholar]
- 10. Burnell AM, Tunnacliffe A (2011) Gene induction and desiccation stress in nematodes In: Perry RN, Wharton DA, editors. Molecular and Physiological Basis of Nematode Survival. Wallingford, Oxfordshire, UK.: CAB International; pp. 125–156. [Google Scholar]
- 11. Cornette R, Kikawada T (2011) The induction of anhydrobiosis in the sleeping chironomid: current status of our knowledge. IUBMB Life 63: 419–429. 10.1002/iub.463 [DOI] [PubMed] [Google Scholar]
- 12. Hand SC, Menze MA, Toner M, Boswell L, Moore D (2011) LEA proteins during water stress: not just for plants anymore. 73: 115–134. 10.1146/annurev-physiol-012110-142203 [DOI] [PubMed] [Google Scholar]
- 13. Womersley CZ (1987) A reevaluation of the strategies employed by nematode anhydrobiotes in relation to their natural environment In: Veech J, Dickson DW, editors. Vistas on Nematology. Hyattsville, MD, USA: Society of Nematologists. [Google Scholar]
- 14. Shannon AJ, Browne JA, Boyd J, Fitzpatrick DA, Burnell AM (2005) The anhydrobiotic potential and molecular phylogenetics of species and strains of Panagrolaimus (Nematoda, Panagrolaimidae). J Exp Biol 208: 2433–2445. [DOI] [PubMed] [Google Scholar]
- 15. Proctor MCF, Oliver MJ, Wood AJ, Alpert P, Stark LR, et al. (2007) Desiccation-tolerance in bryophytes: a review. Bryologist 110: 595–621. [Google Scholar]
- 16. Holmstrup M, Bayley M, Ramløv H (2002) Supercool or dehydrate? An experimental analysis of overwintering strategies in small permeable arctic invertebrates. Proc Natl Acad Sci USA 99: 5716–5720. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Sorensen JG, Holmstrup M (2011) Cryoprotective dehydration is widespread in Arctic springtails. J Insect Physiol 57: 1147–1153. 10.1016/j.jinsphys.2011.03.001 [DOI] [PubMed] [Google Scholar]
- 18. Clark MS, Thorne MAS, Purac J, Burns G, Hillyard G, et al. (2009) Surviving the cold: molecular analyses of insect cryoprotective dehydration in the Arctic springtail Megaphorura arctica (Tullberg). BMC Genomics 10: Artn 328. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Fletcher GL, Hew CL, Davies PL (2001) Antifreeze proteins of teleost fishes. Annu Rev Physiol 63: 359–390. [DOI] [PubMed] [Google Scholar]
- 20. Duman JG (2001) Antifreeze and ice nucleator proteins in terrestrial arthropods. Annu Rev Physiol 63: 327–357. [DOI] [PubMed] [Google Scholar]
- 21. Davies PL, Baardsnes J, Kuiper MJ, Walker VK (2002) Structure and function of antifreeze proteins. Philos T Roy Soc B 357: 927–933. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Liou YC, Daley ME, Graham LA, Kay CM, Walker VK, et al. (2000) Folding and structural characterization of highly disulfide-bonded beetle antifreeze protein produced in bacteria. Protein Expr Purif 19: 148–157. [DOI] [PubMed] [Google Scholar]
- 23. Graham LA, Davies PL (2005) Glycine-rich antifreeze proteins from snow fleas. Science 310: 461–461. [DOI] [PubMed] [Google Scholar]
- 24. Knight CA, DeVries AL, Oolman LD (1984) Fish antifreeze protein and the freezing and recrystallization of ice. Nature 308: 295–296. [DOI] [PubMed] [Google Scholar]
- 25. Davies PL, Hew CL (1990) Biochemistry of fish antifreeze proteins. FASEB J 4: 2460–2468. [DOI] [PubMed] [Google Scholar]
- 26. Tyshenko MG, Doucet D, Davies PL, Walker VK (1997) The antifreeze potential of the spruce budworm thermal hysteresis protein. Nat Biotechnol 15: 887–890. [DOI] [PubMed] [Google Scholar]
- 27. Griffith M, Yaish MWF (2004) Antifreeze proteins in overwintering plants: a tale of two activities. Trends Plant Sci 9: 399–405. [DOI] [PubMed] [Google Scholar]
- 28. Christner BC (2010) Bioprospecting for microbial products that affect ice crystal formation and growth. Appl Microbiol Biotechnol 85: 481–489. 10.1007/s00253-009-2291-2 [DOI] [PubMed] [Google Scholar]
- 29. Wharton DA, Ferns DJ (1995) Survival of intracellular freezing by the Antarctic nematode Panagrolaimus davidi . J Exp Biol 198: 1381–1387. [DOI] [PubMed] [Google Scholar]
- 30. Wharton DA, Barrett J, Goodall G, Marshall CJ, Ramløv H (2005) Ice-active proteins from the Antarctic nematode Panagrolaimus davidi . Cryobiology 51: 198–207. [DOI] [PubMed] [Google Scholar]
- 31. Swart A, Harris JM (1996) Panagrolaimus magnivulvatus Bostrom, 1995 in nest material, algae and soils from inland nunataks in western Dronning Maud Land, Antarctica. S Afr J Zool 31: 15–22. [Google Scholar]
- 32. Boström S (1988) Descriptions and morphological variability of three populations of Panagrolaimus Fuchs, 1930 (Nematoda, Panagrolaimidae). Nematologica 34: 144–155. [Google Scholar]
- 33. Bladursson S, Ingadóttir Á, (Eds.) (2007) Nomination of Surtsey for the UNESCO world heritage list. Reykjavík: Icelandic Institute of Natural History. [Google Scholar]
- 34. Blomberg SP, Garland T (2002) Tempo and mode in evolution: phylogenetic inertia, adaptation and comparative methods. J Evolution Biol 15: 899–910. [Google Scholar]
- 35. Brenner S (1974) The genetics of Caenorhabditis elegans . Genetics 77: 71–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Barrière A, Félix M-A (2006) Isolation of C elegans and related nematodes WormBook (ed The C elegans Research Community): 10.1895/wormbook.1.115.1).
- 37. Winston PW, Bates DH (1960) Saturated solutions for the control of humidity in biological research. Ecology 41: 232–237. [Google Scholar]
- 38. Ramløv H, Wharton DA, Wilson PW (1996) Recrystallization in a freezing tolerant Antarctic nematode, Panagrolaimus davidi, and an alpine weta, Hemideina maori (Orthoptera: Stenopelmatidae). Cryobiology 33: 607–613. [DOI] [PubMed] [Google Scholar]
- 39. Fire A (1986) Integrative transformation of Caenorhabditis elegans . EMBO J 5: 2673–2680. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Nunn GB, Theisen BF, Christensen B, Arctander P (1996) Simplicity-correlated size growth of the nuclear 28S ribosomal RNA D3 expansion segment in the crustacean order Isopoda. J Mol Evol 42: 211–223. [DOI] [PubMed] [Google Scholar]
- 41. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007) Clustal W and clustal X version 2.0. Bioinformatics 23: 2947–2948. [DOI] [PubMed] [Google Scholar]
- 42. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, et al. (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731–2739. 10.1093/molbev/msr121 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Goldman N (1990) Maximum likelihood inference of phylogenetic trees, with special reference to a Poisson process model of DNA substitution and to parsimony analyses. Syst Zool 39: 345–361. [Google Scholar]
- 44. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, et al. (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61: 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Galtier N, Gouoy M (1998) Inferring the pattern and process: maximum-likelihood implementation of a nonhomogeneous model of DNA sequence evolution for phylogenetic analysis. Mol Biol Evol 15: 871–879. [DOI] [PubMed] [Google Scholar]
- 46.Maddison WP, Maddison DR (2007) Mesquite: a modular system for evolutionary analysis. Version 2.75. Available: http://mesquiteproject.org.
- 47. Lewis PO (2001) A likelihood approach to estimating phylogeny from discrete morphological character data. Syst Biol 50: 913–925. [DOI] [PubMed] [Google Scholar]
- 48. Pagel M (1999) Inferring the historical patterns of biological evolution. Nature 401: 877–884. [DOI] [PubMed] [Google Scholar]
- 49. Felsenstein J (1985) Phylogenies and the comparative method. Am Nat 125: 1–15. [Google Scholar]
- 50. Freckleton RP, Harvey PH, Pagel M (2002) Phylogenetic analysis and comparative data: A test and review of evidence. Am Nat 160: 712–726. 10.1086/343873 [DOI] [PubMed] [Google Scholar]
- 51. Hansen TF, Martins EP (1996) Translating between microevolutionary process and macroevolutionary patterns: The correlation structure of interspecific data. Evolution 50: 1404–1417. [DOI] [PubMed] [Google Scholar]
- 52. O’Meara BC, Ane C, Sanderson MJ, Wainwright PC (2006) Testing for different rates of continuous trait evolution using likelihood. Evolution 60: 922–933. [PubMed] [Google Scholar]
- 53.Orme CDL, Freckleton RP, Thomas GH, Petzoldt T, Fritz SA, et al. (2013) caper: Comparative Analyses of Phylogenetics and Evolution in R. Available: http://cranr-projectorg/web/packages/caper/indexhtml.
- 54. Wharton DA, Barclay S (1993) Anhydrobiosis in the free-living Antarctic nematode Panagrolaimus davidi (Nematoda, Rhabditida). Fund Appl Nematol 16: 17–22. [Google Scholar]
- 55. Aroian RV, Carta L, Kaloshian I, Sternberg PW (1993) A free-living Panagrolaimus sp. from Armenia can survive in anhydrobiosis for 8.7 years. J Nematol 25: 500–502. [PMC free article] [PubMed] [Google Scholar]
- 56. Wharton DA, Goodall G, Marshall CJ (2003) Freezing survival and cryoprotective dehydration as cold tolerance mechanisms in the Antarctic nematode Panagrolaimus davidi . J Exp Biol 206 215–221. [DOI] [PubMed] [Google Scholar]
- 57. Knight CA, Wen DY, Laursen RA (1995) Nonequilibrium antifreeze peptides and the recrystallization of ice. Cryobiology 32: 23–34. [DOI] [PubMed] [Google Scholar]
- 58. Duman JG, Bennett V, Sformo T, Hochstrasser R, Barnes BM (2004) Antifreeze proteins in Alaskan insects and spiders. J Insect Physiol 50: 259–266. [DOI] [PubMed] [Google Scholar]
- 59. Doucet D, Walker VK, Qin W (2009) The bugs that came in from the cold: molecular adaptations to low temperatures in insects. Cell Mol Life Sci CELL 66: 1404–1418. 10.1007/s00018-009-8320-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60. Convey P, Worland MR (2000) Survival of freezing by free-living Antarctic soil nematodes. Cryo-Lett 21: 327–332. [PubMed] [Google Scholar]
- 61. Forge TA, Macguidwin AE (1992) Effects of water potential and temperature on survival of the nematode Meloidogyne hapla in frozen soil. Can J Zool 70: 1553–1560. [Google Scholar]
- 62. Wharton DA, Downes MF, Goodall G, Marshall CJ (2005) Freezing and cryoprotective dehydration in an Antarctic nematode (Panagrolaimus davidi) visualised using a freeze substitution technique. Cryobiology 50: 21–28. [DOI] [PubMed] [Google Scholar]
- 63. Blomberg SP, Garland T, Ives AR (2003) Testing for phylogenetic signal in comparative data: Behavioral traits are more labile. Evolution 57: 717–745. [DOI] [PubMed] [Google Scholar]
- 64. Best RJ, Stachowicz JJ (2013) Phylogeny as a proxy for ecology in seagrass amphipods: which traits are most conserved? Plos One 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Kellermann V, Loeschcke V, Hoffmann AA, Kristensen TN, Flojgaard C, et al. (2012) Phylogenetic constraints in key functional traits behind species’ climate niches: patterns of desiccation and cold resistance across 95 Drosophila species. Evolution 66: 3377–3389. 10.1111/j.1558-5646.2012.01685.x [DOI] [PubMed] [Google Scholar]
- 66. Ansart A, Guiller A, Moine O, Martin MC, Madec L (2014) Is cold hardiness size-constrained? A comparative approach in land snails. Evolutionary Ecology 28: 471–493. [Google Scholar]
- 67. Losos JB (2008) Phylogenetic niche conservatism, phylogenetic signal and the relationship between phylogenetic relatedness and ecological similarity among species. Ecol Lett 11: 995–1003. 10.1111/j.1461-0248.2008.01229.x [DOI] [PubMed] [Google Scholar]
- 68. Crisp MD, Cook LG (2012) Phylogenetic niche conservatism: what are the underlying evolutionary and ecological causes? New Phytol 196: 681–694. 10.1111/j.1469-8137.2012.04298.x [DOI] [PubMed] [Google Scholar]
- 69. Sinclair BJ, Ferguson LV, Salehipour-shirazi G, MacMillan HA (2013) Cross-tolerance and cross-talk in the cold: relating low temperatures to desiccation and immune stress in insects. Integr Comp Biol 53: 545–556. 10.1093/icb/ict004 [DOI] [PubMed] [Google Scholar]
- 70.GBIF (2013) The Global Biodiversity Information Facility. Available: http://www.gbif.org/species. Accessed: 7 November 2013.
- 71. Caldwell (1981) The Signy Island terrestrial reference sites: XIII. Population dynamics of the nematode fauna. Br Antarct Surv Bull 54: 33–46. [Google Scholar]
- 72. Overhoff A, Freckman DW, Virginia RA (1993) Life-cycle of the microbivorous Antarctic dry valley nematode Scottnema lindsayae (Timm 1971). Polar Biol 13: 151–156. [Google Scholar]
- 73. Brown IM, Wharton DA, Millar RB (2004) The influence of temperature on the life history of the Antarctic nematode Panagrolaimus davidi . Nematology 6: 883–890. [Google Scholar]
- 74. Sohlenius B (1988) Interactions between two species of Panagrolaimus in agar cultures. Nematologica 34: 208–217. [Google Scholar]
- 75. Janzen D (1985) On ecological fitting. OIKOS 45: 308–310. [Google Scholar]
- 76. Agosta SJ, Klemens JA (2008) Ecological fitting by phenotypically flexible genotypes: implications for species associations, community assembly and evolution Ecology Letters 11: 1123–1134. 10.1111/j.1461-0248.2008.01237.x [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(PDF)
The nematodes were acclimated (a) on NGM agar plates containing a lawn of E. coli for different times and temperatures or (b) in water at different temperatures for 6 h prior to exposure in water to -80°C, at a cooling rate of 3.02°C min-1. After 24 h the nematodes were thawed and allowed to recover at 20°C for 24 h before their survival was determined. Survival values are the mean ± SEM of four biological replicates (* = p<0.05, ANOVA).
(PDF)
Bayesian 50% majority rule consensus tree obtained using Tamura 3-parameter model of evolution, with gamma-distributed rate variation across all sites (T92+G) [45]. Branch supports (Bayesian posterior probabilities) are shown. The colour groupings correspond to PCA groups 1–4 (Fig. 2): Group 1, purple; Group 2, red; Group 3 blue; Group 4 green.
(PNG)
The nematodes were preconditioned at 98% RH for 0, 24, 48, 72 or 96 h, desiccated for 48 h over activated silica gel, rehydrated in distilled water for 24 h before survival was determined. Data are the means ± SEM of three biological replicates. The groupings distinguished by PCA of the combined freezing and anhydrobiosis phenotypes are indicated.
(PDF)
The strains are A: AS03; B: P. rigidus AF36; C: SN103; D: JB115; E: PS1579; F: JB051; G: PS443; H: PS6470; I: P. paetzoldi; J: AS01; K: PS5056; L: JU1361; M: JU1365; N: JU1366; O: JU1369; P: JU1371; Q: JU1387; R: JU1645; S: JU1646; T: Caenorhabditis elegans. See S1 Table for the sources and geographic origins of the Panagrolaimus strains. Tissue extracts from unacclimated nematodes of PCA Groups 3 and 4 can inhibit ice crystal growth, while this capacity was not detected in any of the strains from PCA Groups 1 and 2. (scale bar 25 μm).
(DOCX)
The majority of ice active proteins preferentially bind to the prism planes, inhibiting the growth of ice along these planes and creating hexagonal discs. Continued ice growth on the basal planes and continued binding to prism faces results in the formation of truncated bipyrimidal ice crystals. Figure adapted from Davies and Hew [25].
(PDF)
The nematodes are: Panagrolaimus davidi (Antarctica) and P. superbus (Surtsey, Iceland), both freezing tolerant species; Panagrolaimus sp. JU1646 (Cape Verde), a strain with weak freezing tolerance and P. paetzoldi (Netherlands), a freezing sensitive species. Scale bar: strains a, c and g, 500 μm; strains b, d, e, f and h, 200 μm.
(PDF)
(DOCX)
(DOCX)
(DOCX)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files. The GenBank accession numbers of the rDNA sequences generated in this project are presented in S2 Table.