Combined inhibition of MAP kinase and KIT signaling synergistically destabilizes ETV1 and suppresses GIST tumour growth

Abstract

Gastrointestinal stromal tumour (GIST), originating from the interstitial cells of Cajal (ICCs), is characterized by frequent activating mutations of the KIT receptor tyrosine kinase. Despite the clinical success of imatinib that targets KIT, most advanced GIST patients develop resistance and eventually die of the disease. The ETS family transcription factor, ETV1, is a master regulator of the ICC lineage. Using mouse models of Kit activation and Etv1 ablation, we demonstrate that Etv1 is required for GIST initiation and proliferation in vivo, validating it as a therapeutic target. We further uncover a positive feedback circuit where MAP kinase activation downstream of KIT stabilizes the ETV1 protein and ETV1 positively regulates KIT expression. Combined targeting of ETV1 stability by imatinib and MEK162 resulted in increased growth suppression in vitro and complete tumour regression in vivo. The combination strategy to target ETV1 may provide an effective therapeutic strategy in GIST clinical management.

Introduction

Gastrointestinal stromal tumour (GIST) represents one of the most common subtypes of human sarcomas with approximately 5,000 cases a year in the US. GIST arises from the interstitial cells of Cajal (ICCs) that depend on high level KIT expression for lineage specification and survival (1, 2). Families with germline activating KIT mutations develop diffuse hyperplasia of ICCs that progress to GIST (3-6). The majority of sporadic GISTs harbor activating mutations in KIT and to a lesser extent in PDGFRA and BRAF (2, 7-9). These mutations are thought to function as oncogenic “drivers” required for growth and survival of GISTs. These observations have provided the scientific rationale for clinically targeting these mutations in GIST.

Imatinib mesylate (Gleevec®), a multi-targeted tyrosine kinase inhibitor (TKI) that targets KIT/PDGFR, is the standard first line therapy in advanced GIST with radiographic response rate of approximately 50%, and disease stabilization in another 25-30% (10-13). Despite the early clinical success, the median progression free survival is only 20 to 24 months and the majority of patients develop resistance to imatinib within 2 years of treatment (11-14). Second and third line TKIs that target subsets of imatinib-resistant KIT mutations have only limited efficacy and advanced GIST patients eventually die of their disease (14-18). Imatinib resistance remains the greatest challenge in the management of advanced GISTs. Due to the vast heterogeneity of resistance mechanisms both between patients and within individual patient, it is challenging to develop next generation therapies that can address the majority if not all resistance mechanisms (17, 19, 20).

Clinically, complete responses with first line imatinib therapy are rare. The residual disease represents a significant repertoire that can adapt, evolve and eventually breakthrough imatinib therapy through a variety of resistance mechanisms. Moreover, the potential existence of a KIT-low and intrinsically imatinib-resistant GIST stem/progenitor population (20) makes it conceivably impossible to eradicate the disease with imatinib alone. We reason that one of the strategies to overcome imatinib-resistance is to develop novel therapeutics that are more effective than imatinib alone and can potentially target the GIST stem/progenitor population and therefore prevent the development of imatinib resistance.

We have previously uncovered that ETV1, an ETS family transcription factor, is a master regulator of the normal lineage specification and development of the GIST precursor ICCs. ETV1 is highly expressed in GISTs and is required for the growth and survival of imatinib-sensitive and imatinib-resistant GIST cell lines. ETV1 is a highly unstable protein and its stability is enhanced by active MAP kinase signaling, and represents an essential effector of mutant KIT/PDGFRA-mediated pathogenesis in GIST (21). These observations point to ETV1 as a novel therapeutic target. However, the in vivo requirement of ETV1 in GIST pathogenesis has not been defined. More importantly, an effective therapeutic strategy to target ETV1, a transcription factor, has not been developed. Here, using genetically engineered mouse models, we demonstrate that Etv1 is required for GIST tumour initiation and proliferation in the physiological in vivo context. Taking advantage of the unique regulation of ETV1 protein stability, we further describe an effective therapeutic strategy to target ETV1.

Results

Etv1 is required for tumour initiation and proliferation

To assess whether Etv1 is required for GIST initiation in vivo, we crossed the germline Kit^Δ558V/+ knock-in mouse model that develops ICC hyperplasia throughout the gastrointestinal tract and GIST-like tumours in the cecum (22, 23) with the Etv1^−/− knockout mouse model (24) that is defective in ICC development (21). Since the Etv1^−/− mice die at postnatal day10-14 (P10-P14) (24), we examined the GI tract of Etv1^−/−;Kit^Δ558V/+ and Etv1^+/+;Kit^Δ558V/+ littermates at day P10. Consistent with prior observations, all three Etv1^+/+;Kit^Δ558V/+ mice developed GIST-like masses in the cecum that stain positively for Kit and Etv1 (Fig. 1A, B) and diffuse ICC hyperplasia in the stomach and large intestines (Fig.1C, D). In contrast, one of the three Etv1^−/−;Kit^Δ558V/+ mice developed ICC hyperplasia in the cecum and none developed cecal GIST-like tumours or ICC hyperplasia of the stomach or large intestine (Fig. 1A-C, E). In addition, immunohistochemistry against ICC makers, Kit and Ano1, showed that Etv1^−/−;Kit^Δ558V/+ mice exhibited loss of the intramuscular ICCs (ICC-IM) and myenteric ICCs (ICC-MY) with preservation of the submucosal ICCs (ICC-SMP) (Fig. 1B, Supplementary Fig. 1), phenocopying the ICC loss in Etv1^−/− mice(21). These observations suggest that Etv1 is required for GIST tumour initiation in vivo through its direct regulation of the lineage specification and development of the GIST precursor ICCs.

Figure 1. Etv1 is required for GIST tumour initiation in vivo.

(A) Representative H&E staining of the cecal mass and the cecum of Etv1^+/+;Kit^Δ558V/+ and Etv1^−/−;Kit^Δ558/+ mice respectively showing that Etv1 is required for formation of GIST-like cecal tumour (yellow arrow point to malignant cells in tumour). M: mucosa; CM: circular muscle; LM: longitudinal muscle. Scale bar: 100μm.

(B) Representative immunofluorescence (IF) of KIT (red), ETV1 (green) and DAPI (blue) of the cecal tumour or cecum of Etv1^+/+;Kit^Δ558V/+ and Etv1^−/−;Kit^Δ558/+ mice respectively. Yellow arrows point to the preserved submucosal ICCs (ICC-SMP) with positive KIT immunostaining. Scale bar: 50μm.

(C) Summary of the histological findings in Etv1^+/+;Kit^Δ558V/+ and Etv1^−/−;Kit^Δ558/+ cecum examined at 10 days postnatal.

(D) Representative H&E and Kit immunohistochemistry (IHC) images of the large intestine and stomach in Etv1^+/+;Kit^V558Δ/+ mice, demonstrating hyperplasia of the interstitial cells of Cajal (ICC) (yellow arrow pointing to Kit-positive ICC hyperplasia) in large intestine and stomach. Scale bar, 50μm.

(E) Representative H&E and Kit immunohistochemistry (IHC) images of the large intestine and stomach in Etv1^−/−;Kit^V558Δ/+ mice, demonstrating the lack of Kit-positive ICC layer between the longitudinal muscle (LM) and the circular muscle (CM) layer in Etv1^−/−;Kit^V558Δ/+ mice. Scale bar, 50μm.

To evaluate whether Etv1 is required for GIST tumour proliferation, we crossed the Etv1^flox conditional knockout mouse model where Etv1 exon 11 that encodes the DNA binding domain has been placed between LoxP sites (25) with the Rosa26^CreERT2 mouse that ubiquitously expresses the tamoxifen-activated CreERT2 to generate a genetically engineered mouse (GEM) model where Etv1 can be temporally ablated in adult tissues by tamoxifen treatment. Tamoxifen administration in adult Etv1^flox/flox;Rosa26^{CreERT2/CreERT2} mice caused no observable phenotype, suggesting that the degree of Etv1 ablation achieved is compatible with animal survival (data not shown). We next generated Etv1^flox/flox; Kit^Δ558V/+;Rosa26^{CreERT2/CreERT2} mice and compared the effect of tamoxifen and vehicle (corn oil) treatment in 2 month-old adult mice. In mice treated with tamoxifen, genomic DNA PCR of cecal tumour samples confirmed significant but incomplete excision of Etv1 exon 11 (Supplementary Fig. 2A). Vehicle treated mice exhibited an identical phenotype to the Kit^Δ558V/+ mice, with highly proliferative GIST-like tumours of the cecum and ICC-hyperplasia of the large intestine and the stomach (Fig. 2AC). In contrast, tamoxifen treated mice exhibited significant reduction of cell proliferation by Ki67 IHC in cecal tumours and ICC hyperplasia (Fig. 2A-C). This level of Ki67 reduction is reminiscent of the imatinib treatment in Kit^Δ558V/+ mice (26). Further, Etv1 ablation by tamoxifen treatment induced significant fibrosis indicated by Masson's trichrome stain in the cecal tumours similar to imatinib treatment (27) (Fig. 2D). These observations demonstrate that Etv1 is required for GIST tumour proliferation in vivo.

Figure 2. Etv1 is required for GIST tumour proliferation in vivo.

(A) Representative images of Ki67 IHC of the cecal tumour of 8-9 weeks old, Etv1^flox/flox;Kit^Δ558V/+;Rosa26^{CreERT2/CreERT2} mice treated with either corn oil or tamoxifen, demonstrating a significant reduction of Ki67 in the tamoxifen treated (Etv1-ablated) tissues. Scale bar: 50μm.

(B) Quantification of Ki67 percentage in cecal tumours of 8-9 weeks old Etv1^flox/flox;Kit^Δ558V/+;Rosa26^{CreERT2/CreERT2} mice treated with either corn oil or tamoxifen. n=3, Mean ± SEM; two-tailed unpaired t test (p=0.0005).

(C) Representative images of Ki67 IHC of the large intestine showing a significant reduction of the Ki67 in the large intestine of the Etv1^f/f;Kit^V558Δ/+;Rosa26^CreERT2/+ treated with tamoxifen compared to corn oil control. Scale bar: 50μm.

(D) Representative images of trichrome stains of cecal mass of Etv1^flox/flox;Kit^Δ558V/+;Rosa26^{CreERT2/CreERT2} mice treated with either corn oil or tamoxifen, demonstrating an increase in fibrosis in the tamoxifen treated cohort. Scale bar: 50μm.

ETV1 and KIT form a positive-feedback circuit to regulate target genes

We next examined the Etv1-regulated transcriptome by comparing transcriptional profiles between tamoxifen and vehicle treatment of Etv1^flox/flox;Kit^V558Δ/+;Rosa26^{CreERT2/CreERT2} cecal tumours. The RNA-seq profile of Etv1 transcript shows that tamoxifen treated tumours had a ~3.4-fold decrease in the floxed exon 11 count, implying a 3.4-fold decrease in full-length, functional Etv1 transcript (Supplementary Fig. 2B, C). This decrease is due to 1) 1.7-fold decrease in Etv1 overall transcript level and 2) ~50% of the remaining transcripts showing aberrant splicing from exon 10 to 12 skipping the floxed exon 11. The reduction of the overall transcript level with Etv1 genetic ablation suggests that Etv1 positively regulates its own transcription. Immunoblot analyses confirmed a decrease in Etv1 protein levels in tamoxifen treated tumours compared to controls (Supplementary Fig. 2D).

Despite the incomplete ablation of Etv1, tamoxifen treatment induced robust transcriptional changes as seen by hierarchical clustering (Fig. 3A, Supplementary Table 1). The RNA transcripts of known Etv1 transcriptional targets including Dusp6, Gpr20 and Edn3 (21) were significantly reduced (Fig. 3B). Interestingly, the Kit RNA transcript level was reduced by 1.7-fold with Etv1 ablation (Fig. 3B). Immunoblot, immunofluorescence and IHC analyses showed a consistent decrease in Kit protein levels in tamoxifen-treated cecal tumours (Supplementary Fig. 2D and Fig. 3C-D). The ICC hyperplasia of the large intestine and stomach also showed a reduction in Kit protein levels with tamoxifen treatment (Fig. 3D, Supplementary Fig. 3).

Figure 3. Etv1 positively regulates Kit expression in murine GISTs.

(A) Heatmap of significantly differentially expressed genes between corn oil control and tamoxifen-treated murine GIST tumours identified by RNA-seq. Clustering was based on most differentially expressed 228 genes with FDR <0.05 and fold-change >2.0. Samples are color coded based on treatment status, pink: Corn Oil-treated; orange: Tamoxifen-treated. Scale bar, mean normalized fold change by log2.

(B) RNA-seq gene expression quantification (FPKM: Fragments per kilobase mapped) of Kit and a representative group of Etv1-transcriptional targets in tamoxifen-treated vs. corn oil-treated murine GISTs.

(C) Representative immunofluorescence (IF) images of Etv1 (green) and Kit (red) protein in cecal tumours from Etv1^flox/flox;Kit^V558Δ/+; Rosa26^{CreERT2/CreERT2} mice treated with tamoxifen or corn oil, demonstrating Etv1 ablation and decreased Kit protein level. Nuclei (DAPI, blue). Scale bars: 50μm.

(D) Representative Kit IHC images of the cecal tumours and ICC hyperplasia in the large intestines of mice treated as in (c). Scale bars: 50μm.

(E) GSEA plots of the ranked list of the differentially expressed genes between tamoxifen-treated vs. corn oil-treated murine GIST tumour samples, using two gene sets, Imatinib UP (imatinib upregulated) and imatinib DN (imatinib downregulated).

(F) GSEA plots of the ranked list of the differentially expressed genes between tamoxifen-treated vs. corn oil-treated murine GIST tumour samples, using the ISHIDA_E2F_TARGETS gene set.

To determine the biological processes perturbed by Etv1 ablation, we performed Gene Set Enrichment Analysis (GSEA) comparing tamoxifen and corn oil treated tumours (28). Remarkably, the set of genes most down-regulated by imatinib in Kit^V558Δ/+ mice (Imatinib DN) (23) is the most enriched gene set among those downregulated by tamoxifen treatment (Fig. 3E, Supplementary Table 2 and 3). Likewise, the set of genes most up-regulated by imatinib is highly enriched among those upregulated by tamoxifen treatment, suggesting that Etv1 and Kit regulate a common set of core transcriptional program. This is consistent with the model that Etv1 is a major downstream effector of Kit, and also that Etv1 regulates Kit expression, which in turn, regulates Kit-dependent genes. In addition, multiple cell-cycle related gene sets, including one of E2F target genes are enriched in those downregulated by tamoxifen treatment (Fig. 3F, Supplementary Table 2). These data are consistent with the decrease in Ki67 staining after tamoxifen treatment and suggest that Etv1 is required for tumour proliferation and growth in vivo.

To determine whether ETV1 regulates KIT transcription in human GIST, we knocked down ETV1 with shRNA in three GIST cell lines: GIST48, GIST882 and GIST-T1. In each line, there was a modest decrease in KIT transcript levels after ETV1 knockdown (Fig. 4A). CRISPR/Cas9-mediated knockout of ETV1 in GIST48 cells also resulted in decrease in both KIT transcript and protein levels (Supplementary Fig. 4A, B). We next retrovirally overexpressed ETV1 in GIST882 and GIST-T1 cells and found a modest upregulation in KIT transcript level (Fig. 4B). We performed GSEA of ETV1 knockdown in each of the three cell lines and for each cell line, the genes most downregulated by imatinib was the most enriched gene set among downregulated genes by ETV1 knockdown while genes most upregulated by imatinib was the most enriched gene set among unregulated genes by ETV1 knockdown (Fig. 4C), consistent with our observation in mouse tissues (Fig. 3).

Figure 4. ETV1 positively regulates KIT expression through direct binding to KIT enhancers in human GIST cells and forms a positive feedback circuit in GIST oncogenesis.

(A) mRNA expression of KIT in human GIST882, GIST48 and GIST-T1 cells with ETV1-specific shRNA. n=3, Mean ± SEM. Two-tailed unpaired t test: *p<0.05; ** p<0.01; ***p<0.01.

(B) mRNA expression of KIT in GIST882 and GIST-T1 cells 48 hours after retroviral transduction of ETV1 expression vector or empty vector control. n=3, Mean ± SEM. Two-tailed unpaired t test: *p<0.05; ** p<0.05.

(C) GSEA plots of the ranked list of the shETV1 downregulated genes in human GIST cells, using the Imatinib DN (imatinib downregulated) gene set.

(D) Representative of ChIP-seq reads of ETV1, H3K4me1 and H3K4me3 at the KIT transcription start site (H3K4me3) and enhancer regions (H3K4me1 and ETV1) in human GIST48 cells. Pink, read, and yellow color represent regions selected for ChIP-qPCR studies.

(E) ChIP-qPCR of ETV1 at the KIT enhancer loci as indicated by color code as in (g) with siRNA-mediated suppression of ETV1 (siETV1) vs. scrambled control siRNA (siSCR) in GIST882 cells. n=3, Mean ± SD.

(F) ChIP-qPCR of ETV1 at the KIT enhancer 2 (red mark in D) in GIST48 cells. n=3, Mean ± SD. (G) ChIP-qPCR of ETV1 at the KIT enhancer 2 (red mark in D) in GIST-T1 cells. n=3, Mean ± SD.

To determine whether KIT is a direct transcriptional target of ETV1, we analyzed ChIP-seq of ETV1 in human GIST cells. We found multiple binding sites of ETV1 at the KIT enhancer regions characterized by high H3K4me1 and low H3K4me3 marks in human GIST cells (Fig. 4D). The direct and specific binding of ETV1 to the enhancer regions of the KIT locus was confirmed by ChIP-qPCR with siRNA-mediated suppression of ETV1 in all three GIST cell lines (Fig. 4E-G).These observations suggest that in addition to the regulation of ETV1 protein stability by MAP kinase signaling downstream of mutant KIT signaling, ETV1 directly and positively regulates KIT expression and therefore, it cooperates with mutant KIT by forming a positive feedback circuit to promote GIST tumourigenesis.

Combined inhibition of the KIT and MAP kinase signaling represents an effective strategy to target ETV1 and suppress GIST tumour growth

The fact that the ETV1 protein stability requires active MAP kinase signaling downstream of active KIT signaling (21) has provided us with the rationale to target ETV1 protein stability by inhibiting the MAP kinase and the KIT signaling pathways. When we treated the imatinib-sensitive GIST882 and GIST-T1 cells with either imatinib (a KIT inhibitor) or MEK162 (a MEK inhibitor), we observed a rapid inhibition of the MAP kinase activity (assayed by pERK) accompanied by rapid loss of the ETV1 protein (Fig. 5A). This reduction of the total ETV1 protein level is associated with a reduction of ETV1 binding at the ETV1-regulated gene loci, e.g., DUSP6 and KIT (Fig. 5B) and a reduction of the DUSP6 and KIT transcripts by 8 hours of treatment (Supplementary Fig. 5 A-D). Notably, the ability of MEK162 to durably inhibit MAP kinase pathway and the ETV1 protein stability is cell line specific—GIST882 cells displayed sustained inhibition while GIST-T1 cells showed reactivation of the MAP kinase pathway and re-accumulation of ETV1 protein starting at 2 hours after treatment (Fig. 5A). We then evaluated the combined lineage inhibition using MEK162 and imatinib. In vitro, we observed additive effects on growth suppression across a range of doses of MEK162 and imatinib. A synergistic effect on growth suppression was best appreciated at lower doses of each drug, best seen when 0.5 μM MEK162 was combined with low dose imatinib (62.5 nM in GIST882 and 40 nM in GIST-T1) (Fig. 5C, D). To assess whether the synergistic effect is due to on-target effect of MEK162, we expressed wild-type MEK1/2 (WT) or MEK1/2 mutants (MEK1^L115P, MEK2^L119P) that are resistant to allosteric MEK inhibitors such as MEK162 due to reduced drug binding (29). GIST-T1 cells expressing either MEK1^L115P or MEK2^L119P were more resistant to MEK162 alone. Moreover, the combination of MEK162 to imatinib conferred less synergistic growth inhibition in the presence of MEK1^L115P or MEK2^L119P in GIST-T1 cells (Fig. 5E). This corresponded to a decreased ability of MEK162 to inhibit ERK phosphorylation and ETV1 protein stability (Fig. 5F). These data indicate that the synergistic effect of MEK162 and imatinib combination treatment is the result of on-target effect of MEK162.

Figure 5. Combined inhibition of the MAP kinase and KIT signaling destabilizes ETV1 protein and results in enhanced growth suppression of human GIST cells.

(A) Immunoblot of ETV1, pKIT and pERK levels in GIST882 and GIST-T1 cells treated with Imatinib (500 nM) or MEK162 (1 μM) for the indicated time points.

(B) ETV1 localization at the target gene loci (i.e. KIT, DUSP6) by ChIP-qPCR in GIST cells treated with Imatinib (1 μM) or MEK162 (500 nM) for 8 hours in GIST882, or Imatinib (80 nM) or MEK162 (500 nM) for 2 hours in GIST-T1 cells.

(C) Immunoblot of ETV1 and KIT, MAP kinase and AKT signaling pathways in GIST882 and GIST-T1 cells treated with various doses of Imatinib and MEK162 as indicated for 8 hours.

(D) Cell viability by Alamar Blue of GIST882 and GIST-T1 cells treated with various doses of Imatinib and MEK162 as indicated for 7 days. n=3, Mean ± SEM.

(E) Cell viability by Alarmar Blue of GIST-T1 cell expressing different MEK constructs treated with various doses of Imatinib and MEK162 as indicated for 7 days. n=3, Mean ± SEM.

(F) Immunoblot of ETV1, KIT and MAP Kinase signaling in GIST-T1 parental cells, GIST-T1 cells expressing MEK1^WT, MEK1^L115P, MEK2^WT and MEK2^L119P. Cells were treated for 1 hour as indicated. V: DMSO; I: Imatinib (500 nM); M: MEK162 (1000 nM).

Next, we tested the effect of combined MEK162 and imatinib in vivo. In the GIST882 xenograft model, single agent imatinib or MEK162 stabilized tumour growth at the maximum tolerated doses (Fig. 6A). Remarkably, the combination of imatinib and MEK162 treatment resulted in a dramatic reduction (>50%) of tumour size within 7 days and complete responses with prolonged treatment even at significantly reduced doses of MEK162 (10 mg/kg) or imatinib (50 mg/kg) (Fig. 6A, B). Combination therapy provided more potent and durable inhibition of MAP kinase signaling (Fig. 6C, Supplementary Fig. 6A). Importantly, the ETV1 protein levels was more potently and durably inhibited, which was associated with reduction of ETV1 transcriptional targets (e.g., DUSP6 and KIT) than either imatinib or MEK162 alone (Fig. 6C, Supplementary Fig. 6B). When GIST882 xenografted mice were treated from the same day of cell implantation, only the combination of imatinib and MEK162 successfully prevented xenograft tumour formation, suggesting that dual lineage inhibition could also inhibit GIST tumour formation in vivo (Supplementary Fig. 6C).

Figure 6. Combined inhibition of the MAP kinase and KIT signaling synergistically suppress tumour growth in in vivo GIST xenograft mouse models.

(A) Treatment response of GIST882 xenografts in SCID mice. The treatment cohorts are as the following: 1) Vehicle (blue): water; 2) Imatinib (green): 100 mg/kg BID; 3) MEK162 (red): 30 mg/kg BID; 4) Imatinib+MEK162 (dose 1) (magenta): Imatinib (100 mg/kg BID) + MEK162 (10 mg/kg BID); 5) Imatinib+MEK162 dose 2 (yellow): Imatinib (50 mg/kg BID) + MEK162 (30 mg/kg BID); 6) Imatinib+MEK162 dose 3 (black): Imatinib (100 mg/kg BID) + MEK162 (30 mg/kg BID) (dose 3). n=6-8, Mean ± SEM. Two-tailed unpaired t test: *p<0.0001; ** p<0.0001; ***p<0.0001.

(B) Representative H&E images of GIST882 xenografts after 14 days of drug treatment by oral gavages as indicated. Vehicle: water; Imatinib: 100 mg/kg BID; MEK162: 30 mg/kg BID; Imatinib (100 mg/kg BID) + MEK162 (30 mg/kg BID).

(C) Immunoblots of three representative GIST882 xenograft tumours explanted after 2 days of drug treatment by oral gavages as indicated. Vehicle: water; Imatinib: 100 mg/kg BID; MEK162: 30 mg/kg BID; Imatinib (100 mg/kg BID) + MEK162 (30 mg/kg BID).

(D) Treatment response of GIST-T1xenografts in SCID mice as indicated by oral gavages. The treatment cohorts are as the following: 1) Vehicle: water; 2) Imatinib: 80 mg/kg BID; 3) MEK162: 30 mg/kg BID; 4) Imatinib (80 mg/kg BID) + MEK162 (30 mg/kg BID). n=10, Mean ± SEM. Two-tailed unpaired t test: *p<0.0001; ** p<0.0001; ***p<0.0001.

(E) Representative H&E images of GIST-T1 xenografts after 21 days of drug treatment by oral gavages as indicated. Vehicle (blue): water; Imatinib (green): 80 mg/kg BID; MEK162 (red): 30 mg/kg BID; Imatinib+MEK162 (magenta): Imatinib (80 mg/kg BID) + MEK162 (30 mg/kg BID).

(F) Immunoblots of three representative GIST-T1 xenograft tumours explanted after 2 days of drug treatment by oral gavages as indicated. Vehicle: water; Imatinib: 80 mg/kg BID; MEK162: 30 mg/kg BID; Imatinib (80 mg/kg BID) + MEK162 (30 mg/kg BID).

In the GIST-T1 xenograft model, single agent imatinib led to tumour stabilization. However, single agent MEK162 did not significantly inhibit tumour growth (Fig. 6D), consistent with the inability of MEK162 to durably inhibit the MAP kinase pathway in GIST-T1 cells (Fig. 5A, C). Yet, as in GIST882 xenografts, the combination of imatinib and MEK162 resulted in near complete response in GIST-T1 xenografts within 3 weeks of treatment (Fig. 6D, E). The treatment effects correlated with KIT and MAP kinase signaling pathway inhibition, ETV1 protein destabilization, and downregulation of ETV1 target genes (i.e., DUSP6 and KIT) (Fig. 6F, Supplementary Fig. 6D, E). These observations demonstrated a clear synergistic growth inhibitory effect of imatinib and MEK162 in GIST tumour growth in vivo. It is notable that the synergy of combination is more apparent in in vivo human GIST xenograft studies than in in vitro cell line assays.

We next examined the combination targeting strategy in the genetically engineered Kit^V558Δ/+ GIST mouse model that is partially sensitive to imatinib treatment (26). Treatment with single agent MEK162 or imatinib for 5 days resulted in a reduction of tumour proliferation by Ki67 and increased tumour fibrosis by trichrome staining (Fig. 7A-D). The combination treatment of imatinib and MEK162 lead to increased tumour fibrosis and significantly greater reduction of Ki-67 than either single agent (Fig. 7A, B). Moreover, the combination treatment had significantly reduced tumour weight compared to either single agent alone or to vehicle (Fig. 7C). These treatment effects of the combination therapy are accompanied by increased inhibition of the Kit and MAP kinase signaling pathways, decreased Etv1 protein and its downstream target Dusp6 (Fig. 7D). The treatment data in both xenografted human GIST models and genetically engineered GIST mouse models indicate that the combination therapy of imatinib and MEK162 is a more effective treatment for imatinib-sensitive GIST than either single agent alone in vivo.

Figure 7. Combined inhibition of the MAP kinase and KIT signaling synergistically suppress tumour growth in genetically engineered GIST mouse model.

(A) Ki67 percentage of murine cecal GISTs isolated after 5 days of drug treatment by oral gavages of the GIST GEMM (Kit^V558Δ/+). Vehicle (black): water; Imatinib (blue): 50 mg/kg BID; MEK162 (yellow): 30 mg/kg BID; Imatinib+MEK162 (red): Imatinib (50 mg/kg BID) + MEK162 (30 mg/kg BID). n=7-9, Mean ± SEM. Two-tailed unpaired t test, p value indicated in figure.

(B) Representative Trichrome and Ki67 IHC images of murine cecal GISTs isolated after 5 days of drug treatment by oral gavages of the GIST GEMM (Kit^V558Δ/+) under the same conditions as in (A).

(C) Tumour weight of murine cecal GISTs isolated after 5 days of drug treatment by oral gavages of the GIST GEMM (Kit^V558Δ/+) under the same conditions as in (A). n=7-9, Mean ± SEM. Two-tailed unpaired t test, p value indicated in figure.

(D) Immunoblots of representative cecal tumours from GIST GEMM (Kit^Δ558/+) treated under the same drug treatment conditions as indicated in (A) for 1.5 days. Two cecal tumours from two different mice for each treatment conditions. Dusp6 is one of the transcriptional targets of Etv1.

Discussion

Using genetically engineered mouse models, we have demonstrated the in vivo requirement of the lineage specific master regulator, ETV1, in GIST initiation and proliferation. We have further demonstrated that ETV1 positively regulates KIT expression level by direct binding to the KIT enhancer regions and it forms a positive feedback circuit to cooperate with mutant KIT in GIST oncogenesis. These observations posit ETV1 as a relevant therapeutic target for the treatment of GISTs. In addition, since ETV1 is required for the survival of GIST precursor ICCs and is required for GIST tumour initiation in vivo, it may also represent a therapeutic target for the Kit-low GIST progenitor/stem cell population. Importantly, targeting ETV1 will help break the positive feedback circuit and indirectly target KIT expression independent of the KIT mutational status.

While it is challenging to therapeutically target non-ligand dependent transcription factors, the unique MAP kinase signaling dependent regulation of ETV1 protein stability has allowed us to target ETV1 protein stability in GIST. The acquisition of KIT activating mutations during GIST tumourigenesis activates downstream MAP kinase signaling and augmented stability of ETV1 protein (21). Our data in two imatinib-sensitive GIST cell lines suggest that mutant KIT is the principal driver of MAP kinase activation as imatinib treatment significantly inhibit MAP kinase activation, ETV1 protein stability and ETV1-mediated transcription. In vitro, MEK162 synergized with lower doses of imatinib but higher doses of imatinib alone can maximally suppress MAP kinase activity and cell proliferation (Fig. 5). However, in both xenograft systems and genetically engineered mouse models in vivo, maximum tolerated doses of imatinib cannot adequately and durably suppress MAP kinase activity and ETV1 protein levels. This may be due to either the inability to attain sufficient drug levels to fully inhibit KIT (27) or the presence of paracrine signals that activate MAP kinase pathway bypassing KIT (26). The survival signals that bypass KIT may be heterogeneous dependent on the tumour contexts. Here, addition of even low doses of MEK162, leads to durable destabilization of ETV1 protein and dramatically augments tumour response, resulting in complete responses.

The response to single agent imatinib in our model systems mirrors that of patients undergoing first-lines imatinib treatment. While the majority of patients attain clinical benefits with imatinib treatment, the RESIST response rate is only ~50% and radiographic or pathologic complete responses rarely occur. Our data suggest that the combination therapy represents a significantly more effective strategy than imatinib alone in GIST clinical management and may prevent the development of imatinib-resistance in advanced GIST if used upfront.

Methods

Generation of compound genetically engineered GIST models (GEM)

All mouse studies are approved by MSKCC IACUC under protocol 11-12-029. The Kit^Δ558V/+ knock-in mouse was a generous gift from Dr. Peter Besmer (30), the Etv1^−/− mice was a generous gift from Dr. Thomas Jessell (24), the Etv1^flox/flox mice was a generous gift from Dr. David Ladle (Wright State University) (25) and the Rosa26^CreERT2 mice was a generous gift from Dr. Andrea Ventura (31). The Etv1^−/−;Kit^Δ558V/+, Etv1^+/+;Kit^Δ558V/+, Etv1^flox/flox;Rosa26^{CreERT2/CreERT2} and Etv1^flox/flox; Kit^Δ558V/+;Rosa26^{CreERT2/CreERT2} mice were generated through standard mouse breeding within the MSKCC animal facility.

Cell lines, antibodies and reagents

The GIST48 and GIST882 cell lines were obtained from Dr. Jonathan A. Fletcher (DFCI) and were maintained as previously described (21). The GIST-T1 cell line was obtained from Dr. Takahiro Taguchi (32). The GIST-T1 cell line harbors 57-nucleotide (V570-Y578) in-flame deletion in KIT exon 11 and was maintained in RPMI supplemented with 10% FBS, 10mM HEPES pH 7.5. All GIST cell lines have been authenticated for KIT mutations by DNA-sequencing and have been tested negative for mycoplasma infection by MycoAlert Plus MycoPlasma Detection Kit (Lonza), last in February, 2014.

Antibodies to the following were used for IHC, Immunofluorecence(IF), western blotting and ChIP: rabbit anti-ETV1 (Abcam, 1:100 for IF , 1:500 for western blotting, 2 μg for ChIP), rabbit anti-ANO1 clone SP31 (LSBio, 1:50 for IHC), rabbit anti-KIT (Cell signaling, #3074, 1:1000 for western blotting, 1:100 for IHC), rat anti-mouse Kit (clone ACK4, Cedarlane, CL8936ap, 1:100 for IF), rabbit anti-Ki67 (Abcam, ab15580, 1:400 for IHC), rabbit anti-H3K4me1 (for ChIP, Abcam, ab8895), rabbit anti-H3K4me3(for ChIP, Abcam, ab8580), rabbit anti-phosphorylated KIT (Cell signaling, #3073, 1:1000 for western blotting), rabbit anti-phosphorylated ERK1/2 (Cell signaling, #4370, 1:5000 for western blotting, 1:400 for IHC), rabbit anti-ERK1/2 (Cell signaling, #4695, 1:5000 for western blotting), rabbit anti-phosphorylated AKT (Cell signaling, #4060, 1:1000 for western blotting), rabbit AKT (Cell signaling, #4685, 1:1000 for western blotting), rabbit anti-phosphorylated S6 (Cell signaling, #2317, 1:1000 for western blotting, 1:400 for IHC), rabbit anti-S6 (Cell signaling, #4856, 1:1000 for western blotting), rabbit anti-cleaved caspase 3 (Cell signaling, #9661, 1:1000 for western blotting, 1:400 for IHC), HRP-conjugated anti-GAPDH (Abcam, ab9385, 1:5000 for western blotting), HRP-conjugated anti-actin (Abcam, ab49900, 1:5000 for western blotting). The MEK162 (a MEK inhibitor) and imatinib (a KIT inhibitor) were supplied by Novartis.

Lentiviral knockdown and CRISPR/Cas9 mediated knockout

pLKO.1 constructs against ETV1 (shETV1: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. Lentiviruses were generated by co-transfecting the shETV1 hairpin constructs with psPax2 and pVSVG (Addgene) into 293FT cells (Invitrogen) using Lipofectamine 2000 (Invitrogen). GIST882, GIST48 and GIST-T1 cells were infected shSCR or shETV1 lentivirus. RNA was collected 72 hours post infection and analyzed for KIT mRNA by RT-PCR.

In order to knock out ETV1 in human GIST cell lines, we designed 3 pairs of single guide RNA (sgRNA) sequences for human ETV1 using the design tool from Feng Zhang Lab and cloned the targeting sequences into the lentiCRISPRv2 vector obtained from Addgene. Lentiviruses for ETV1 sgRNAs or vector control were generated in 293FT cells by standard methods using amphotropic packaging vector. GIST48 cells were infected with lentivirus for 48 hours and selected with 2ug/ml puromycin for 7 days. KIT mRNA and protein level were analyzed 16 days post infection. The target guides sequences are:

sgETV1-1: F: CACCGTGAAGAGGTGGCCCGACGTT; R: AAACAACGTCGGGCCACCTCTTCAC; sgETV1-2: F: CACCGCAGCCCTTTAAATTCAGCTA; R: AAACTAGCTGAATTTAAAGGGCTGC;

sgETV1-3: F: CACCGGATCCTCGCCGTTGGTATGT; R: AAACACATACCAACGGCGAGGATCC.

Stable gene expression

cDNAs for human wild-type MEK1, wild-type MEK2, MEK1^L115P mutant, MEK2^L119P mutant were cloned into lentiviral based vector pLX301(Addgene). Lentivirus was produced in 293FT cells by standard methods using amphotropic packaging vector. GIST-T1 cells were infected and selected with 2ug/ml puromycin for 5 days at 48 hours post infection for subsequent biochemical and drug treatment studies.

To determine the effect of ETV1 overexpression on KIT transcript levels, cDNA of human ETV1 was cloned into MSCV-based retroviral vector pMIG (Addgene). Retrovirus was produced in 293FT cells by standard methods using amphotropic packaging vector.GIST882 and GIST-T1 cells were infected with empty vector or pMIG-ETV1. RNA was isolated 48 hours post infection to analyze KIT mRNA by qRTPCR.

Mouse procedures

For the GI tract of mice at different postnatal age (Postnatal day 7 to 6 months old), the stomach, small intestine, large intestine, cecum or cecal GIST tumours are dissected and separated and embedded in paraffin or snap frozen as previously described(21) for subsequent analyses. For tamoxifen or corn oil treatment of Etv1^f/f;Kit^V558Δ/+;Rosa26^{CreERT2/CreERT2} mice, tamoxifen (Toronto Research Chemicals) was dissolved in at 20 mg/ml in corn oil and injected intraperitoneally to 6-week old mice at a dose of 4 mg every other day for 3 doses. Mice were euthanized 2 weeks after the first tamoxifen dose.

For drug treatment studies in Kit^V558Δ/+ mice, approximately 8-10 weeks Kit^V558Δ/+ mice were treated in 4 cohorts by oral gavage, 1) Vehicle: water; 2) Imatinib: 50 mg/kg BID; 3) MEK162 30 mg/kg, BID; 4) Imatinib+MEK162: Imatinib 50 mg/kg BID + MEK162 30 mg/kg BID. Cecal tumours were isolated and weighed after 5 days of treatment and subjected for paraffin embedding and analyzed by H&E, Trichrome stain and IHC of Ki67. For short-term treatment, the protein and RNA were isolated from cecal tumours after 1.5 day treatment for immunoblots and qRT–PCR analyses, respectively. To generate lysates for western blots, tissue was homologized in SDS lysis buffer using the FastPrep-24 system with Lysing Matrix A (MP Biomedicals).

For xenograft studies, 5×10⁶ GIST882 or GIST-T1 cells resuspended in 100μl of 1:1 mix of growth media and Matrigel (BD Biosciences) were subcutaneously injected into CB17-SCID mice (Taconic). Tumour sizes were measured weekly starting 6 weeks after xenografting. For short term treatment, xenografts were explanted after 2 days of drug treatment for histology analysis; protein and RNA were isolated for immunoblots and qRT–PCR analyses, respectively. For long term treatment, xenograft were treated twice daily until the end of experiments. For treatment from the same day of implantation, GIST882 cells expressing firefly luciferase were grafted. Tumour growth was monitored by bioluminescence imaging of anesthetized mice by retro-orbitally injecting d-luciferin and imaging with the IVIS Spectrum Xenogen machine (Caliper Life Science). To generate lysates for western blotting, tissue was homologized in SDS lysis buffer using the FastPrep-24 system with Lysing Matrix A (MP Biomedicals).

Immunofluorescence, Immunohistochemistry and Histology

For immunofluorescence of cryostat sections of the mouse gastrointestinal tract, mouse stomach, small intestine, caecum and large intestine were dissected and fixed in 4% paraformaldehyde for 2h followed by an overnight incubation in 30% sucrose. They were then embedded in OCT, flash frozen and cut into 5-μm sections using a cryostat. Tamoxifen treated and corn oil treated littermate controls of Etv1^f/f;Kit^V558Δ/+;Rosa26^{CreERT2/CreERT2} were embedded onto the same block to ensure identical processing. Tissue sections were blocked for 1 hour using 5% goat serum, incubated with primary antibodies at 4 °C overnight and secondary antibody for 2h at room temperature. Slides were mounted using Prolong Gold (Invitrogen) and images were taken on a Nikon Eclipse TE2000-E microscope using a Photometric Coolsnap HQ camera. Images were taken with ×20 (numerical aperture 0.75) or ×60 (numerical aperture 1.4) objectives. Monochrome images taken with DAPI, FITC and Texas Red filter sets were pseudo-colored blue, green and red, respectively, and merged using ImageJ The exposure, threshold and maximum were identical between Tamoxifen treated and corn oil treated littermate controls of Etv1^f/f;Kit^V558Δ/+;Rosa26^{CreERT2/CreERT2} images.

Tissue paraffin embedding, sectioning and H&E staining were performed by the Histoserv, Inc. Immunohistochemistry was performed by the MSKCC HOPP automatic staining facility using a Ventana BenchMark ULTRA automated stainer.

RNA isolation and qRT-PCR

For tissue culture cells, RNA was isolated using E.Z.N.A total RNA kit (Omega). For xenograft and mouse models, explanted tissue samples were grounded in 1000μl Trizol (Invitrogen) using a PowerGen homogenizer (Fisher Scientific), followed by addition of 200μl chloroform. The samples were then centrifuged at 10,000g for 15 min. The upper phase was mixed with an equal volume of 70% ethanol, and the RNA was further purified using E.Z.N.A total RNA kit (Omega).

For qRT-PCR, RNA was reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (ABI) and PCR was run using Power SYBR Master Mix (ABI) on a Realplex machine (Eppendorf). Expression was normalized to the ribosomal protein RPL27. The following primer pairs were used(21):

ETV1-Exon67: F: CTACCCCATGGACCACAGATTT, R: CTTAAAGCCTTGTGGTGGGAAG;

KIT: F: GGGATTTTCTCTGCGTTCTG, R: GATGGATGGATGGTGGAGAC;

DUSP6: F: TGCCGGGCGTTCTACCTGGA, R: GGCGAGCTGCTGCTACACGA

RPL27: F: CATGGGCAAGAAGAAGATCG, R: TCCAAGGGGATATCCACAGA;

Cell viability

GIST882 cells and GIST-T1 were plated at 4×10⁴ cells and 1×10⁴ cells retrospectively per well in a 96-well plate on day 0 and treated with drugs after 12h to allow cell attach. Triplicate wells were cultured until day 7. Viability was assessed using Alarmar Blue (R&D) for survival.

Chromatin immunoprecipitation (ChIP) and sequencing

Chromatin isolation from GIST882, GIST48 and GIST-T1 cells was performed as previously described (21). For ETV1 knockdown experiments, chromatin was isolated 72 h after siRNA transfection with either Scramble (siSCR, Dharmacon) or ETV1-specific siRNA (siETV1, Dharmaon). For drug treatment experiment, GIST882 chromatin was isolated 8 h after treatment and GIST-T1 chromatin was isolated 2 hours after treatment.

The human ChIP-qPCR primers pairs were:

KIT enhancer1: F: GAAGCAAACCCCAGGCTGTA, R: TTTGCCAACTGTTGCTTCGG;

KIT enhancer2: F: GGGGAAGCACGAAAAACACC, R: TCGAAGACTTGTCCCTTGGC;

KIT enhancer3: F: TGGTTTCCTCGTCACAGATCC, R: GGAAGAAAGGAGCAGCGGAA;

PSA promoter: F: TGGGCGTGTCTCCTCTGC, R: CCTGGATGCACCAGGCC

H3K4me1 and H3K4me3 ChIP sequencing were performed in GIST48 cells (GSE64609). Next-generation sequencing was performed on either an Illumina Genome Analyzer II or a HiSeq2000 with 50-bp single reads. Reads were aligned to the human genome (hg 19) using the Bowtie alignment software within the Illumina Analysis Pipeline and duplicate reads were eliminated for subsequent analysis. Peak calling was performed using MACS 1.4 comparing immunoprecipitated chromatin with input chromatin. On the basis of RefSeq gene annotation, the resultant peaks were separated into promoter peaks (located within ±2 kb of a transcription start site), promoter distal peaks (located from −50 kb of a transcription start to +5 kb of a transcription end) and otherwise intergenic peaks. The ChIP-seq profiles presented were generated using Integrated Genome Browser software of SGR format files.

Gene expression analysis

We have also performed at least three sets of independent ETV1 shRNA knockdown experiments in GIST882, GIST48 and GIST-T1 cells and assayed the effects of ETV1 suppression on KIT expression by qRT-PCR and pooled all experiments for analysis.

To determine the transcriptional effect of Cre-mediated Etv1 exon 11 excision in murine cecal tumours, we performed RNA-Seq (GSE64608). The isolated RNA was processed using the TruSeq RNA sample Prep kit (#15026495, Illumina) according to the manufacturers’ protocol. Briefly, the RNA was Poly-A selected, reverse transcribed and the obtained cDNA underwent end-repair, A-tailing, ligation of the indexes & adapters, and PCR enrichment. The libraries were sequenced on an Illumina HiSeq-2500 platform with 51bp paired-end reads to obtain a minimum yield of 40 million reads per sample. The sequence data was processed and mapped to the human reference genome (hg19) using STAR v2.330(33). Gene expression was quantified using the Cuffdiff(34). Hierarchical clustering was performed using Partek Genomics Suite. Gene set enrichment analysis was performed using JAVA GSEA 2.0 program(28). The gene sets use were the Broad Molecular Signatures Database gene sets c2 (curated gene sets), c5 (gene ontology gene sets), c6 (oncogenic signatures), c7 (immunologic signatures) as well as additional sets “Imatinb UP” and “Imatinib DN” composed of genes up and downregulated by 2-fold with FDR < 0.05 in cecal tumours of Kit^V558Δ/+ mice respectively(26).

Statistics

All statistical comparisons between two groups were performed by Graphpad Prism software used a two-tailed unpaired t test.

Statement of Significance.

ETV1 is a lineage-specific oncogenic transcription factor required for the growth and survival of GIST. We describe a novel strategy of targeting ETV1 protein stability by the combination of MEK and KIT inhibitors that synergistically suppress tumor growth. This strategy has the potential to change first line therapy in GIST clinical management.

Abbreviations List

GIST

Gastrointestinal stromal tumour

ETV1

ets variant 1

MAPK

Mitogen-activated protein kinases