Abstract
Premise of the study:
To facilitate population genetic analyses, microsatellite markers were developed for pokeweed (Phytolacca americana), a large, weedy, perennial herb native to eastern North America that is emerging as a significant invasive species in China.
Methods and Results:
We mined 1,100,538 Illumina MiSeq reads from genomic DNA for microsatellites and identified 58 primer pairs. We screened these primers for polymorphism in two native and two invasive populations. We identified 11 loci that amplified consistently. The number of alleles per locus ranged from two to six, and observed heterozygosity ranged from 0.00 to 1.00. All loci were largely monomorphic within populations but different among populations. The primers were of very limited use in the congener P. acinosa.
Conclusions:
These loci will provide a valuable resource to study the population genetics and invasion history of P. americana.
Keywords: biological invasions, Illumina, MiSeq, Phytolacca americana, Phytolaccaceae, pokeweed
Pokeweed, Phytolacca americana L. (Phytolaccaceae), is a large, weedy, perennial herb native to eastern North America but widely distributed in Asia and Europe. With high seed production and bird-dispersed fruits, the plant establishes readily in disturbed habitats (McDonnell et al., 1984). Pokeweed was likely intentionally introduced to China and first reported in 1935 in Zhejiang Province (Li and Xie, 2002; Xu et al., 2012). Recent reports in Asia indicate that P. americana may have emerged as a more aggressively invasive species where it has established (Kim et al., 2005). The species has recently become a significant threat to coastal forest ecosystems in China (Zhai et al., 2010; Fu et al., 2012). Furthermore, P. americana has largely displaced a Chinese native congener, P. acinosa Roxb., in parts of China. Although P. acinosa has been a historic part of Chinese pharmacopoeias for more than 2000 years, it is similar in appearance to P. americana, which in turn is considerably more toxic than P. acinosa (Kim et al., 2005), leading to the possibility of accidental poisonings. Despite its widespread distribution and emergence as an invasive species, many aspects of pokeweed evolutionary ecology are not well understood, including its breeding system. The microsatellites we have developed could be valuable tools to understand pokeweed population structure and invasion history.
METHODS AND RESULTS
We extracted genomic DNA from freshly collected leaves of one individual of P. americana from Memphis, Tennessee, using a QIAGEN DNeasy Plant Mini Kit (QIAGEN, Valencia, California, USA). We mined 1,100,538 Illumina MiSeq reads from genomic DNA from that individual for microsatellites and flanking primers using the PAL Finder pipeline (Castoe et al., 2012). We added a CAG sequence to the 5′ end of one of each of the primer pairs to facilitate use of a third, fluorescently labeled primer in the PCR.
To screen the primers, we collected leaf samples from populations both in the native and introduced range of P. americana: Florida, USA; Illinois, USA; Anhui, China; and Fukushima, Japan. We also collected leaf samples from a single population of the native P. acinosa in Jiangsu, China (GPS coordinates 32.06°N, 118.83°E). Collection coordinates and voucher information are provided in Appendix 1. Leaves were dried, frozen, and lysed before genomic DNA was extracted as described above. We tested 58 primer pairs for amplification; 11 produced consistent results for P. americana (Table 1). We were able to amplify only a single locus (PW65) for P. acinosa, where 12 of the 21 samples yielded products in the expected size range given data from P. americana. We amplified each locus in a 12.5-μL PCR reaction (10 mM Tris-HCl, 50 mM KCl, 0.1% Triton X-100, 100 μg/mL bovine serum albumin [BSA], 0.4 μM unlabeled primer, 0.04 μM tag-labeled primer, 0.36 μM universal dye-labeled primer, 4.0 mM MgCl2, 0.8 mM dNTPs, 0.25 units EconoTaq Polymerase [Lucigen, Middleton, Wisconsin, USA], and 10 ng DNA template) using a touchdown protocol where the annealing temperature decreased by 0.5°C for each of the first 20 cycles: 96°C (2.5 min), then 20 cycles of 96°C (30 s), initial 65°C (30 s), 72°C (30 s), then 20 cycles: 96°C (30 s), 50°C (30 s), 72°C (30 s), then 72°C (10 min). Initial annealing temperature was 60°C for PW182. After PCR, amplified fragments were diluted 1:5 and pooled in the following four groups: PW106, PW29, and PW43; PW54, PW46, and PW79; PW69, PW11, and PW223; and PW182 and PW65. Fluorescent dyes used to label each primer can be found in Table 1. Amplicons were visualized on an ABI 3730xl DNA sequencer (Applied Biosystems, Carlsbad, California, USA) and sized with an internal ROX-labeled size standard (GGF500R; Georgia Genomics Facility, Athens, Georgia, USA). Genotyping results were scored using GeneMarker software (version 2.4; SoftGenetics, State College, Pennsylvania, USA). Alleles were binned using the program MsatAllele (Alberto, 2009) according to the core repeat size of the microsatellite.
Table 1.
Characteristics of 11 microsatellite loci developed in Phytolacca americana.
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp)a | Ta (°C) | Fluorescent dyeb | GenBank accession no. |
| PW11 | F: AGCCGGAGGTCTCTCTTGG | (AAC)33 | 354–372 | 65–55 | FAM | KP331491 |
| R: *CAGTTTAGAAATCTGGAATTAGAGTTGG | ||||||
| PW29 | F: *GATGAAGAAAGGGCAACCCC | (AATAAG)30 | 354–366 | 65–55 | HEX | KP331492 |
| R: ACGAGTGCAGATCCAAGTGC | ||||||
| PW46 | F: *GGATGCAAATAATCCTAGTTCGG | (ATT)36 | 331–352 | 65–55 | HEX | KP331493 |
| R: CAGACTCCCGAGTTTGTCCC | ||||||
| PW53 | F: AATCTTTGGCTTGGCCACC | (ATAC)24 | 454–458 | 65–55 | HEX | KP331494 |
| R: *TCAAAAGACAATGCAGAAGCC | ||||||
| PW54 | F: *CATATCACGAGAGGGGAGCC | (AAAAG)30 | 283–298 | 65–55 | FAM | KP331495 |
| R: GGTAACCTCATTGGGACCCG | ||||||
| PW65 | F: *CACAACAAGCGTTAATTTACGAGC | (ATC)33 | 359–368 | 65–55 | HEX | KP331496 |
| R: GTCATGCTCCTGCTCAGTCC | ||||||
| PW69 | F: *GGATGGTTTCTTCATGCAACG | (AAAAG)25 | 302–312 | 65–55 | HEX | KP331497 |
| R: AGCAAATCCTTGATCAGCCC | ||||||
| PW79 | F: *TTGCCAATAGTAACTCTTTGAACTCC | (ATGTCC)36 | 387–399 | 65–55 | FAM | KP331498 |
| R: CCAGAATGTGGGATTGAGGG | ||||||
| PW106 | F: CTAATATGAGCTTTAGCAACACTGC | (ATT)39 | 258–288 | 65–55 | FAM | KP331499 |
| R: *ATTATTCAACATGACACCATTAACC | ||||||
| PW182 | F: *TTGGTGACGACATTAGGAGGC | (AAAGG)30 | 308–318 | 60–50 | FAM | KP331500 |
| R: TAAGGGCAGCCGACCTAAGC | ||||||
| PW223 | F: *CGTAACACAACCTTACAATCTAAGCC | (ATC)36 | 438–447 | 65–55 | HEX | KP331501 |
| R: TGCTTTGTGAAGATCAGTGGG |
Note: Ta = range of annealing temperatures used in touchdown PCR.
Indicates the CAG sequence position (5′-CAGTCGGGCGTCATCA-3′).
Allele size is the range of observed alleles (including the CAG sequence length).
Fluorescent dye used for fragment analysis.
Data were checked for errors and null alleles using MICRO-CHECKER (van Oosterhout et al., 2004). No errors were detected. Possible null alleles were detected in the Florida and Illinois populations for PW46, in the Illinois and Japanese populations for PW223 and PW106, and in the Illinois population for PW79. Deviation from Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were tested in GENEPOP (version 4.2; Rousset, 2008), both with default parameters and Bonferroni corrections. Genetic diversity measures, including the number of alleles and observed and expected heterozygosities, were estimated in GenAlEx (version 6.501; Peakall and Smouse, 2006, 2012).
Because populations were largely monomorphic for one allele, only eight of the 44 possible tests were subject to both LD and HWE analyses. Overall, seven of the eight loci deviated from HWE, but none of the eight loci pairs were in LD (P > 0.05). The number of alleles per locus ranged from two to six and observed heterozygosity ranged from 0.00 to 1.00, although average observed heterozygosity was only 0.03 (Table 2). The breeding system of P. americana has never been adequately described. Armesto et al. (1983) speculated that the species was autogamous because of its high fruit set. Caulkins and Wyatt (1990) bagged inflorescences while still in bud and 60% of fruits set, but bagged emasculated flowers (which should not set any fruit) set 46% of their fruit, making their results difficult to interpret. A lack of within-population genetic variation does suggest that P. americana may be highly selfing. The allelic differences between populations are also consistent with autogamy. Although our markers cannot be used to distinguish between individuals of the same population, they can distinguish between individuals from different populations.
Table 2.
Genetic diversity of 11 newly developed microsatellites in two native (United States) and two invasive (Asia) populations of Phytolacca americana.a
| Florida, USA (n = 25.9/26) | Illinois, USA (n = 17.7/18) | Anhui, China (n = 24.0/25) | Fukushima, Japan (n = 23.4/24) | All samples (n = 93) | |||||||||
| Locus | A | Hob | He | A | Hob | He | A | Hob | He | A | Ho | He | A |
| PW11 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 2 |
| PW29 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 3 |
| PW46 | 3 | 0.12** | 0.53 | 3 | 0.00* | 0.20 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 5 |
| PW53 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 2 |
| PW54 | 2 | 1.00** | 0.50 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 3 |
| PW65 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 2 |
| PW69 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 2 | 0.04 | 0.04 | 3 |
| PW79 | 1 | 0.00 | 0.00 | 2 | 0.12* | 0.48 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 2 |
| PW106 | 1 | 0.00 | 0.00 | 4 | 0.06** | 0.52 | 4 | 0.05** | 0.25 | 2 | 0.05 | 0.05 | 6 |
| PW182 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 2 |
| PW223 | 1 | 0.00 | 0.00 | 3 | 0.00* | 0.43 | 2 | 0.00 | 0.08 | 1 | 0.00 | 0.00 | 3 |
Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; n = average number of individuals scored for all loci out of the total number of individuals attempted for a locality.
Locality and voucher information for the populations is available in Appendix 1.
An asterisk (*) indicates that the significance level for a χ2 test of Hardy–Weinberg equilibrium (HWE) was P < 0.001. The double asterisk (**) indicates that the significance level for a χ2 test of HWE was P < 0.00001.
CONCLUSIONS
We report 11 microsatellite loci in P. americana from both the native range in the United States and the invasive range in Asia. The genetic diversity data suggest that this species may be highly selfing, although a more detailed examination of the breeding system of this species is warranted. Even though these markers will be of limited use within populations, they should be useful for studies across populations, including those tracing the invasion history of this species. Only one marker was able to amplify any product in the Chinese native congener, P. acinosa, suggesting high genetic differentiation between the two species.
Appendix 1.
Voucher information for Phytolacca species used in this study.
| Species | Voucher specimen accession no.a | Collection localityb | Geographic coordinates | N |
| Phytolacca americana | FL1-HAD | Williston, Florida, USA | 29.462617, −82.450328 | 26 |
| Phytolacca americana | IL1-KEB | Nashville, Illinois, USA | 38.352300, −89.379167 | 18 |
| Phytolacca americana | PAN2-RM/MMM | Tangkou, Anhui, China | 29.927537, 118.026423 | 25 |
| Phytolacca americana | PJP6-RM | Sukagawa, Fukushima, Japan | 37.280853, 140.359136 | 24 |
| Phytolacca acinosa | CPN-RM | Nanjing, Jiangsu, China | 32.060703, 118.834628 | 24 |
Note: N = number of individuals.
HAD = Hollis A. Dahn, collector; KEB = Kerin E. Bentley, collector; MMM = Margalit M. Mauricio, collector; RM = Rodney Mauricio, collector. Vouchers deposited at the University of Georgia, Department of Genetics, Germplasm bank.
Locality (closest municipality) and state, province, or prefecture.
LITERATURE CITED
- Alberto F. 2009. MsatAllele 1.0: An R package to visualize the binning of microsatellite alleles. Journal of Heredity 100: 394–397. [DOI] [PubMed] [Google Scholar]
- Armesto J. J., Cheplick G. P., McDonnell M. J. 1983. Observations on the reproductive biology of Phytolacca americana (Phytolaccaceae). Bulletin of the Torrey Botanical Club 110: 380–383. [Google Scholar]
- Castoe T. A., Poole A. W., de Koning A. P. J., Jones K. L., Tomback D. F., Oyler-McCance S. J., Fike J. A., et al. 2012. Rapid microsatellite identification from Illumina paired-end genomic sequencing in two birds and a snake. PLoS ONE 7: e30953. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Caulkins D. B., Wyatt R. 1990. Variation and taxonomy of Phytolacca americana and P. rigida in the southeastern United States. Bulletin of the Torrey Botanical Club 117: 357–367. [Google Scholar]
- Fu J. P., Li C. R., Xu J. W., Cheng W. L., Song R. F., Liu Y. 2012. Prevention and control of invaded plant Phytolacca americana in sandy coastal shelter forests. Chinese Journal of Applied Ecology 23: 991–997. [PubMed] [Google Scholar]
- Kim Y. O., Johnson J. D., Lee E. J. 2005. Phytotoxic effects and chemical analysis of leaf extracts from three Phytolaccaceae species in South Korea. Journal of Chemical Ecology 31: 1175–1186. [DOI] [PubMed] [Google Scholar]
- Li Z. Y., Xie Y. 2002. Invasive alien species in China. China Forestry Publishing House, Beijing, People’s Republic of China. [Google Scholar]
- McDonnell M. J., Stiles E. W., Cheplick G. P., Armesto J. J. 1984. Bird-dispersal of Phytolacca americana L. and the influence of fruit removal on subsequent fruit development. American Journal of Botany 71: 895–901. [Google Scholar]
- Peakall R., Smouse P. E. 2006. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peakall R., Smouse P. E. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics (Oxford, England) 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rousset F. 2008. GENEPOP’007: A complete reimplementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
- van Oosterhout C., Hutchinson W. F., Wills D. P., Shipley P. 2004. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538. [Google Scholar]
- Xu H., Qiang S., Genovesi P., Ding H., Wu J., Meng L., Han Z., et al. 2012. An inventory of invasive alien species in China. NeoBiota 15: 1–26. [Google Scholar]
- Zhai S., Li C., Xu J., Liu L., Zhang D., Zhou Z. 2010. Spatial and temporal dynamics of Phytolacca americana seed rain under Robinia pseudoacacia forest in Lingshan Bay National Forest Park, Shandong, China. Chinese Journal of Plant Ecology 34: 1236–1242. [Google Scholar]