Skip to main content
PLOS ONE logoLink to PLOS ONE
. 2015 Mar 11;10(3):e0119639. doi: 10.1371/journal.pone.0119639

RNA-Dependent RNA Polymerase (NIb) of the Potyviruses Is an Avirulence Factor for the Broad-Spectrum Resistance Gene Pvr4 in Capsicum annuum cv. CM334

Saet-Byul Kim 1,#, Hye-Young Lee 1,#, Seungyeon Seo 1, Joo Hyun Lee 1, Doil Choi 1,*
Editor: Mark Gijzen2
PMCID: PMC4356556  PMID: 25760376

Abstract

Potyviruses are one of the most destructive viral pathogens of Solanaceae plants. In Capsicum annuum landrace CM334, a broad-spectrum gene, Pvr4 is known to be involved in resistance against multiple potyviruses, including Pepper mottle virus (PepMoV), Pepper severe mosaic virus (PepSMV), and Potato virus Y (PVY). However, a potyvirus avirulence factor against Pvr4 has not been identified. To identify the avirulence factor corresponding to Pvr4 in potyviruses, we performed Agrobacterium-mediated transient expressions of potyvirus protein coding regions in potyvirus-resistant (Pvr4) and -susceptible (pvr4) pepper plants. Hypersensitive response (HR) was observed only when a RNA-dependent RNA polymerase (NIb) of PepMoV, PepSMV, or PVY was expressed in Pvr4-bearing pepper leaves in a genotype-specific manner. In contrast, HR was not observed when the NIb of Tobacco etch virus (TEV), a virulent potyvirus, was expressed in Pvr4-bearing pepper leaves. Our results clearly demonstrate that NIbs of PepMoV, PepSMV, and PVY serve as avirulence factors for Pvr4 in pepper plants.

Introduction

Potyviruses belong to the family Potyviridae which represents the largest plant viruses, and severely affect the production of economically important crops. Several members of the genus Potyvirus including pepper mottle virus (PepMoV), pepper severe mosaic virus (PepSMV), potato virus Y (PVY) and tobacco etch virus (TEV) have a wide range of hosts such as potato, pepper, and tomato in Solanaceae plants [1]. The genome of potyviruses is composed of a single-stranded RNA with a length of ∼9.7 kb, which covalently links with a viral-encoded protein (VPg) at its 5’-end and contains a 3’polyadenylated tail. All members of potyviruses encode two polyproteins, a larger polyprotein of about 3,000 amino acids and the shorter one translated from a 2+ frameshift in the P3 coding region [2]. These polyproteins are cleaved by viral proteases subsequently generating eleven mature proteins [3].

To date, functions of PVY viral proteins are the most well studied among potyviruses in response mechanisms against plant host factors to trigger the plant immune system [2,48]. For example, PVY VPg interacts with a recessive resistance protein, pvr2 in pepper which is also known as a member of eukaryotic initiation factor 4E (elF4E) [9]. Another PVY viral protein, HC-Pro is known to function broadly in potato and tobacco by interacting with elF4E and its elFiso4E [10], and is also involved in HR-like cell death in potato by responding to resistance genes called NC tbr, NC spl and Ny tbr [7]. A PVY protease, NIa protease (also called NIaPro) was found to be required for Ry-mediated resistance of potato against PVY [5]. While these PVY viral proteins have structural analogy with other potyvirus proteins, they do not always function similar. For instance, a PepMoV NIaPro which exhibits 63.5% identity in sequence with a PVY NIaPro showed HR in Ry-mediated resistance; whereas, a TEV NIaPro failed to induce HR although it shares 45.9% identity with the PVY NIaPro [5].

PepMoV was first reported as an atypical pepper isolate of PVY [11], is known to cause a serious disease in pepper [12]. However, functions of PepMoV-encoded proteins mostly remain unknown.

The completion of the pepper genome sequencing project using Capsicum annuum landrace CM334 (hereafter CM334) provides a tremendous amount of information and facilitates characterization of multiple disease resistance genes in pepper [13]. CM334 contains a single dominant resistance gene, referred as Pvr4, which confers resistance against all strains of PepMoV, PepSMV, and PVY, but not to TEV [6,1418]. The Pvr4-mediated resistance in pepper plants exhibits extreme resistance or HR to multiple potyviruses which is not yet found in any other Solanaceae host plants such as tomato and potato [6,18]. Although the Pvr4 gene has been mapped to chromosome 10 of the pepper plant, it was not isolated, and subsequently the molecular mechanism of Pvr4-mediated resistance to PepMoV infection has not been elucidated [18]. Only a mutation of a RNA-dependent RNA polymerase (RdRp, also called NIb, hereafter NIb) area in PVY genome has been reported to confer virulence against Pvr4-bearing pepper plants [6]. However, a corresponding viral component that plays a role as an avirulence factor against Pvr4 in pepper plants remains to be identified.

In this study, we screened all eleven proteins from PepMoV to identify the avirulence factor for the single dominant resistant gene, Pvr4, in CM334. Viral cistrons of PepMoV were cloned into an in planta expression vector for screening against Pvr4-segregating F2 populations derived from a cross between CM334 (Pvr4) and Jupiter (pvr4) cultivar. We revealed that NIbs from multiple potyviruses function as avirulence factors for Pvr4 in CM334.

Materials and Methods

Plant Materials

Six different C. annuum L. lines, including three resistance [CM334 (Pvr4/Pvr4), an F1 hybrid (Pvr4/pvr4), and a resistant homozygotic F2 (Pvr4/Pvr4) from a cross between CM334 and cv. Jupiter] and three susceptible lines [cv. ECW (pvr4/pvr4), cv. Jupiter (pvr4/pvr4), and a susceptible homozygotic F2 (pvr4/pvr4) from a cross between CM334 and cv. Jupiter] against PepMoV, were confirmed by viral inoculation and co-segregating DNA marker [18]. Briefly, to confirm resistance in pepper plants, we inoculated 4 to 6 weeks old leaves with PepMoV-GFP modified from PepMoV-Vb1 [19] and performed an enzyme-linked immunoassay (ELISA) to detect PepMoV according to the manufacturer’s protocol (Agdia, Elkhart, IN, USA). The genotypes of F1 and F2 lines were confirmed by Pvr4-linked co-segregating marker (PCAPS15) to distinguish Pvr4 and pvr4 genes [18]. Transient assays were performed with 4 to 6 week-old pepper plants. All pepper plants were grown in a growth chamber at 22–25°C with 60% relative humidity and a 14:10-hour light-dark cycle.

Application of Pvr4-linked CAPS Marker for Identification of Pepper Genotype

For detection of Pvr4-linked markers, PCR products that were amplified with the marker primer were digested with XhoI. Pvr4-linked CAPS marker (PCAPS15) allows discernment of the Pvr4 allele as Pvr4/Pvr4, Pvr4/pvr4, or pvr4/pvr4 [18]. As shown in Fig. 1A, XhoI digestion of the PCR products generated 550- and 270-bp fragments for Pvr4 and 470- and 350-bp fragments for pvr4.

Fig 1. Genotypes and genotype-specific accumulation of PepMoV in pepper plants.

Fig 1

(A) Identification of genotype in relation to Pvr4 using the CAPS marker (PCAPS15). Pvr4-harboring pepper genotypes have 550- and 270-bp fragments, while pvr4-plants have 470- and 350-bp fragments. RR; a resistant homozygotic F2, SS; a susceptible homozygotic F2. Genotype of each plant is depicted under the cultivar name, and phenotypes of plants are also described under the images. R denotes resistant, and S denotes susceptible. (B) Detection of accumulated PepMoV by ELISA. Resistance against PepMoV was confirmed by ELISA with PepMoV antibody, which presents an accumulation of virus. Genotype of each plant is depicted under the cultivar name. Pepper leaves were sampled at 15 dpi. Error bars represent standard deviations. This result and subsequent figures show a representative experiment of three biological replicates.

Cloning of Potyvirus Cistrons for in planta Expression

For cloning of PepMoV cistrons for in planta expression, specific primers to amplify each coding regions and the NIb from PepSMV (NC_008393) [20], PVY (EF026074.1) [21] and TEV (M11458.1) [17] were designed for use in the ligation-independent cloning (LIC) method by adding adapter sequences with: 5’- CGACGACAAGACCCT ATG (adaptor sequence) – viral coding region specific sequence – 3’ and 5’ – GAGGAGAAGAGCCCT TCA (adaptor sequence)—viral coding region specific sequence – 3’ [22,23]. P3N-PIPO cistron was generated by overlap PCR including a PIPO coding region in the GGAAAAAA motif to place the PIPO ORF in-frame with the N-terminal half of the P3 coding region [3,2426]. For cloning of PepMoV cistrons for western blot, specific primers added HA tag (TACCCATACGACGTCCCAGACTACGCT) to amplify NIb, CP and HC-Pro were designed for use in the ligation-independent cloning (LIC) method by adding adapter sequences with: 5’ - GAGGAGAAGAGCCCT (adaptor sequence) TCA AGCGTAGTCTGGGACGTCGTATGGGTA– viral coding region specific sequence – 3’ in C-terminal region (S1 Table). As a control, Coat Protein (CP) coding regions from PepSMV and PVY-0 were designed for use in the ligation-independent cloning (LIC) method by adding adapter sequences. All amplified PCR products were cloned by LIC method into the pCAMBIA2300-LIC vector containing the CaMV 35S promoter and the NOS terminator cassette [22,23]. A total 15 fmol of purified PCR product was treated with T4 DNA polymerase (NEB) in reaction buffer containing 10 mM dATP at 22°C for 30min and 70°C for 20min for inactivation of T4 DNA polymerase. The pCAMBIA2300-LIC vector was digested with PstI and treated with T4 DNA polymerase with 10 mM dTTP. T4 DNA polymerase-treated PCR products and pCAMBIA2300-LIC vector were mixed and incubated at room temperature for 30 min [22]. The mixture was transformed into E. coli DH10b competent cells. The entire sequence of cloned cistrons was confirmed by DNA sequencing at the National Instrumentation Center for Environmental Management (NICEM, Seoul, Korea). Each cloned vector was transformed into Agrobacterium tumefaciens strain C58C1 for transient in planta expression assays [27].

In planta Expression Assay in Pepper Plants

After transformation, the cultured cells were centrifuged and re-suspended in induction buffer (10 mM MgCl2, 10 mM MES pH 5.6, and 200 μM Acetosyringone), and cells were incubated at room temperature for 2 h before agro-infiltration. The concentration of Agrobacterium cells was adjusted to 0.5 at OD600, and then the cells were subjected to pressure infiltration using needleless syringe [28]. Empty vector and vector with necrosis-inducing protein (NIP) from Phytophthora sojae were infiltrated into one pepper leaf as a negative or positive control, respectively [29]. All experiments were performed as three biological replicates. Cell death on the leaves was observed at two or three days after Agrobacterium infiltration. Inoculated leaves were cleared in 100% ethanol to remove chlorophyll in order to visualize the cell death. Total RNA was extracted from pepper plant using TRIzol (Invitrogen, http://www.invitrogen.com/) according to the manufacturer’s instructions. First strand cDNA was synthesized using 3 μg total RNA with oligo (dT) and Superscript II reverse transcriptase (Invitrogen) for RT-PCR. Oligonucleotides used in RT-PCR were described in S1 Table.

Immunodetection of PepMoV-encoded proteins

To confirm the in planta expression of viral proteins, we representatively decided to design three HA-tagging constructs out of eleven viral-encoded proteins. HA tag sequence was added at C-terminal of PepMoV NIb, CP and HC-Pro (See Material and methods, Cloning of Potyvirus Cistrons for in planta Expression). These constructs were transformed into Agrobacterium C58C1 and the cells were fully infiltrated into N. benthamiana leaves. Total protein was extracted from leaves of N. benthamiana with extraction buffer as described in Win et al [30] at 1 day and 2 days after infiltration of each construct. Protein concentrations were measured by Bradford assay (Thermo Scientific, Waltham, Massachusetts, United States), and equal amounts were loaded onto polyacrylamide gels. After transfer, western blot analysis was accomplished to detect protein expression by using an anti-HA antibody (Abcam, Cambridge, UK) and an anti-rabbit horseradish peroxidase conjugate (Abcam, Cambridge, UK).

Results and Discussions

Genotypes and PepMoV Accumulation in Pepper Plants

To confirm Pvr4-mediated resistance in pepper plants, we performed genotype screening by PCR with the PCAPS15 marker, and then utilized ELISA to detect PepMoV accumulation [18]. When the marker was applied in pepper, Pvr4-harboring pepper genotypes showed 550- and 270-bp fragments, while Pvr4-lacking (pvr4-) plant genotype showed 470- and 350-bp fragments. In our results, CM334, F1 hybrid and the resistant homozygotic F2 (RR) lines contained band patterns of Pvr4-harboring genotype, whereas the other peppers had band patterns of Pvr4-lacking genotype (Fig. 1A). Resistance against PepMoV could be confirmed by ELISA with a PepMoV antibody, which presents an accumulation of virus. Lower values (ELSIA value < 0.2) which were detected with CM334, F1 hybrid and the resistant homozygotic F2 lines represented that PepMoV replication was limited in those peppers. On the other hand, ECW, Jupiter and the susceptible homozygotic F2 (SS) lines showed higher values (ELSIA value > 0.4) (Fig. 1B). These results indicated that Pvr4-harboring plants successfully repressed the growth of PepMoV virus and that resistance phenotypes of pepper plants against PepMoV co-segregated with their genotypes. From these conclusions, we decided to use these pepper lines for screening the avirulence factor of potyviruses.

Identification of NIb as the Avirulence Factor of PepMoV in Pvr4-bearing Pepper Plants

To identify the avirulence factor of PepMoV, we performed in planta expression analyses with eleven viral proteins of PepMoV in pepper plants (Table 1). First, PepMoV coding regions were dissected and cloned into the pC2300-LIC binary vector with a 35S promoter [1,2]. For in planta expression analyses, each clone was infiltrated in all six pepper cultivars, respectively. As results, HR-like cell death was observed only in the PepMoV NIb-expressing leaves in a genotype-specific manner. However, the HR-like cell death was absent when other viral cistrons were infiltrated (Fig. 2A and S1 Fig.)

Table 1. PepMoV cistrons used in this study.

Name of cistron Size (bp) Function References
P1 861 serine protease [32]
HC-Pro 1368 helper-component protease [10]
P3 1083 potyviral membrane protein [3,33]
6K1 156 unknown -
CI 1902 cylindrical inclusion [34]
6K2 156 potyviral membrane protein [33]
VPg 564 viral protein genome-linked [35]
NIa (Pro) 738 nuclear inclusion A [36]
NIb 1557 RNA dependent RNA polymerase [6,37]
CP 819 coat protein [38]
P3N-PIPO 771 cell-to-cell movement [3,24]

Fig 2. Identification of NIb as the HR-inducing avirulence factor against Pvr4-bearing pepper plants.

Fig 2

(A) Transient expression of PepMoV viral proteins in CM334 and Jupiter. Eleven cistrons from PepMoV were infiltrated into CM334 and Jupiter. At 3 dpi, leaves were cleared with 100% ethanol to remove chlorophylls in order to visualize the cell death. For this and subsequent experiments, Empty vector and vector with necrosis-inducing protein (NIP) from P. sojae were infiltrated as a negative or positive control, respectively. Regions of infiltration were marked with ovals and the area of cell death was marked as red. Inoculated viral cistrons were depicted under panels. (B) Transient expression of HC-Pro:HA, CP:HA and NIb:HA in CM334. Plant responses with HA-tagged proteins were tested in Pvr4-harboring plants (CM334). Inoculated viral cistrons were depicted under panels. (C) Expression of PepMoV NIb:HA, CP:HA and HC-Pro:HA proteins in N. benthamiana leaves. 5-week-old tobacco leaves were collected at 24hpi and 48hpi. Untreated leaves were used as mock for negative controls. Each protein was immunodetected by using anti-HA antibody. Coomassie blue–stained total proteins were shown as loading controls.

To test whether each clone from PepMoV interacts with Pvr4 at the protein level, we picked three clones, NIb, HC-Pro, and CP from PepMoV and generated HA-tagged constructs (PepMoV NIb:HA, PepMoV HC-Pro:HA and PepMoV CP:HA). Each protein expression was detected by western blot experiments using anti-HA at 24 and 48 hours after infiltration in N. benthamiana (Fig. 2C). To verify that these proteins still have their activity in Pvr4-mediated resistance, we performed in planta expression of these HA-tagged proteins in CM334 and also observed HR-like cell death with PepMoV NIb:HA regardless of whether the HA tag was present or not. Over-expression of other cistrons such as PepMoV HC-Pro and PepMoV CP did not induce HR-like cell death in CM334 (Fig. 2B). This results suggested that the PepMoV NIb protein works as the avirulence factor in Pvr4-containing CM334.

To investigate the correlation of NIb-induced cell death with Pvr4 gene in pepper, we also examined the phenotypes of the F2 population derived from CM334 and Jupiter by transient expression of PepMoV NIb. The genotypes of the F2 segregating progenies of the cross between CM334 and Jupiter were clarified by the PCAPS15 marker analysis (Fig. 3A). All Pvr4-bearing plants showed HR cell death while none of pvr4-plants show HR cell death (Fig. 3B). This results implied that HR-like cell death phenotype induced by PepMoV NIb is related to Pvr4.

Fig 3. Correlation of genotypes and cell death phenotype of Pvr4 against NIb in the F2 population.

Fig 3

(A) Identification of genotype in relation to Pvr4 using the CAPS marker (PCAPS15). Thirty plants of the F2 generation were tested to identify their genotypes. Genotypes of plants (Gen*) are described under the images as R (resistant) or S (susceptible). (B) Response of the F2 population plants derived from Jupiter and CM334 to PepMoV proteins, NIb and CP. Thirty progenies of the F2 generation were tested to verify whether Pvr4-harboring plants show HR in response to PepMoV NIb. The F2 lines which showed HR cell death as well as Pvr4 genotypes were marked as R. S represents the F2 lines which did not show HR cell death and were confirmed as pvr4-plants. Inoculated viral cistrons were depicted at the left of panel.

In a previous study, it was suggested that an untranslatable RNA sequence of the Cymbidium Ringspot Virus (CymRSV) CP might be a HR inducing elicitor in Datura stramonium [31]. To confirm the NIb RNA itself does not cause HR-like cell death, we generated the frame-shifted mutant of NIb (PepMoV-ΔNIb) and transiently expressed in the F2 populations derived from Jupiter and CM334. Expression of PepMoV NIb and PepMoV-ΔNIb were confirmed in pepper leaves tested by RT-PCR (S2 Fig.). The NIb mutant did not induce HR-like cell death phenotype in any tested pepper plants while the in-frame NIb construct showed HR cell death (S2 Fig.). This result indicated that HR-like cell death was not induced by NIb RNA in resistant pepper plants, but by NIb protein. Taken together, these results clearly demonstrate that the PepMoV NIb protein is the avirulence factor for Pvr4 in pepper plants.

NIb proteins of other Potyviruses as Avirulence Factors in Pvr4-mediated Resistance

To test whether NIb proteins from other potyviruses function as avirulence factors, we cloned NIb coding regions from potyviruses PepSMV and PVY into the pCAMBIA2300-LIC vector and examined in planta expression assays with pepper plants. When each NIb cistron was transiently expressed in each pepper plants, HR-like cell death was observed only in Pvr4-containing plants (CM334, the F1 hybrid, and the resistant homozygotic F2) (Fig. 4 and S3 Fig.). These results indicate that NIbs of PepSMV and PVY also function as Pvr4 interactants in the plant immune system.

Fig 4. Confirmation of NIb as the HR-inducing avirulence factor against Pvr4-bearing pepper plants.

Fig 4

In planta expressions of NIbs from four potyviruses were performed in CM334 and Jupiter, respectively.

Since TEV is a virulent potyvirus to Pvr4-bearing pepper plants, we tested whether TEV NIb interacts with Pvr4 and subsequently causes cell death. Thus, TEV NIb coding region was cloned into pC2300-LIC vector and in planta expressed in leaves of CM334 and Jupiter. However, HR-like cell death was not observed in any pepper leaves when the clone was infiltrated (Fig. 4). Taken together, although TEV has NIb like other potyviruses, TEV NIb could not induce HR-like cell death and additionally TEV shows virulence in Pvr4-bearing pepper plants (Table 2). The reason why TEV NIb does not cause HR-like cell death is likely that it has a difference in structure compared to other three potyviruses NIbs. In previous study, TEV diverged from other three potyviruses in phylogenetic tree when parts of these nucleotide sequences were compared [17]. Furthermore, when we compared the identity of NIb proteins among four potyviruses, TEV NIb had 61% identity compared with PepMoV, PepSMV and PVY, while three potyviruses have at least 76% identity. This result infers that TEV NIb, which has lower identity to other potyviruses NIbs, may not be recognized by Pvr4.

Table 2. Resistance and HR induced NIb of potyviruses in Pvr4-harboring pepper plants.

Potyvirus species NIb-induced HR Virus resistance
Phenotype References
PepMoV (DQ631638) + R In this study, [18,19]
PepSMV (NC_008393) + R [18,20]
PVY (EF026074) + R [18,39]
TEV (M11458) S [18,39]

HR, hypersensitive response. R, resistant; S, susceptible.

PepMoV; Pepper mottle virus, PepSMV; Pepper severe mosaic virus, PVY; Potato virus Y, TEV; Tobacco etch virus.

+, HR induced;

−, HR not induced.

In sum, the high similarity of NIb protein sequences in avirulent potyviruses might be important for these proteins to function as avirulence factors. Subsequently, this would mediate a broad-spectrum stable resistance for Pvr4-bearing pepper plants.

Conclusion

In this study, we demonstrated that NIb proteins of three potyviruses are common avirulence factors for Pvr4-mediated resistance in pepper plants. These results may provide an efficient tool for the isolation of the broad-spectrum potyvirus resistance gene Pvr4 from pepper, as well as for studying potyvirus resistance mechanisms in plants.

Supporting Information

S1 Fig. Identification of NIb as the HR-inducing avirulence factor against Pvr4-bearing pepper plants.

Transient expression of PepMoV viral proteins in the resistant homozygotic F2 (RR), F1 hybrid, ECW and the susceptible homozygotic F2 (SS). Eleven cistrons from PepMoV were infiltrated into four pepper cultivars.

(TIF)

S2 Fig. Verification of NIb-encoded protein as the avirulence factor against Pvr4-bearing pepper plants.

(A) Response of five pepper cultivars after in planta expression of NIb or frame-shifted NIb mutant clone of PepMoV at 2–3 dpi. (B) RT-PCR of transient overexpressed PepMoV NIb and -ΔNIb. Pepper leaves were sampled at 0, 12, 18, 24 and 48 hours after transient overexpression. As a control, actin was used.

(TIF)

S3 Fig. Confirmation of NIb as the HR-inducing avirulence factor against Pvr4-bearing pepper plants.

In planta expressions of NIbs from four potyviruses were performed in four cultivars, respectively.

(TIF)

S1 Table. Primer sequences used in this study.

(XLSX)

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This work was supported by a grant from National Research Foundation of Korea, Ministry of Science, ICT and Future Planning (Project No. 2010-0015105) and a Vegetable Breeding Research Center of an ARC Grant (PJ710001-05) from the Ministry for Food, Agriculture, Forestry, and Fisheries of the Korean government to DC.

References

  • 1. Ivanov KI, Eskelin K, Lõhmus A, Mäkinen K (2014) Molecular and Cellular Mechanisms Underlying Potyvirus Infection. J Gen Virol 95: 1415–1429. 10.1099/vir.0.064220-0 [DOI] [PubMed] [Google Scholar]
  • 2. Quenouille J, Vassilakos N, Moury B (2013) Potato virus Y: a major crop pathogen that has provided major insights into the evolution of viral pathogenicity. Mol Plant Pathol 14: 439–452. 10.1111/mpp.12024 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Chung BY-W, Miller WA, Atkins JF, Firth AE (2008) An overlapping essential gene in the Potyviridae. Proc Natl Acad Sci USA 105: 5897–5902. 10.1073/pnas.0800468105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Hong Y, Levay K, Murphy JF, Klein PG, Shaw JG, Hunt AG (1995) A potyvirus polymerase interacts with the viral coat protein and VPg in yeast cells. Virology 214: 159–166. [DOI] [PubMed] [Google Scholar]
  • 5. Mestre P, Brigneti G, Baulcombe DC (2000) An Ry-mediated resistance response in potato requires the intact active site of the NIa proteinase from potato virus Y . Plant J 23: 653–661. [DOI] [PubMed] [Google Scholar]
  • 6. Janzac B, Montarry J, Palloix A, Navaud O, Moury B (2010) A point mutation in the polymerase of Potato virus Y confers virulence toward the Pvr4 resistance of pepper and a high competitiveness cost in susceptible cultivar. Mol Plant Microbe Interact 23: 823–830. 10.1094/MPMI-23-6-0823 [DOI] [PubMed] [Google Scholar]
  • 7. Moury B, Caromel B, Johansen E, Simon V, Chauvin L, Jacquot E, et al. (2011) The helper component proteinase cistron of Potato virus Y induces hypersensitivity and resistance in potato genotypes carrying dominant resistance genes on chromosome IV. Mol Plant Microbe Interact 24: 787–797. 10.1094/MPMI-10-10-0246 [DOI] [PubMed] [Google Scholar]
  • 8. Tian Y-P, Valkonen JP (2013) Genetic determinants of Potato virus Y required to overcome or trigger hypersensitive resistance to PVY strain group O controlled by the gene Ny in potato. Mol Plant Microbe Interact 26: 297–305. 10.1094/MPMI-09-12-0219-R [DOI] [PubMed] [Google Scholar]
  • 9. Ayme V, Petit-Pierre J, Souche S, Palloix A, Moury B (2007) Molecular dissection of the potato virus Y VPg virulence factor reveals complex adaptations to the pvr2 resistance allelic series in pepper. J Gen Virol 88: 1594–1601. [DOI] [PubMed] [Google Scholar]
  • 10. Ala-Poikela M, Goytia E, Haikonen T, Rajamäki M-L, Valkonen JP (2011) Helper component proteinase of the genus Potyvirus is an interaction partner of translation initiation factors eIF (iso) 4E and eIF4E and contains a 4E binding motif. J Virol 85: 6784–6794. 10.1128/JVI.00485-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Zitter TA (1972) Naturally occurring pepper virus strains in South Florida. Plant Dis Rep 56: 586–590. [Google Scholar]
  • 12. Abdalla O, Desjardins P, Dodds J (1991) Identification, disease incidence, and distribution of viruses infecting peppers in California. Plant Dis 75: 1019–1023. [Google Scholar]
  • 13. Kim S, Park M, Yeom SI, Kim YM, Lee JM, Lee HA, et al. (2014) Genome sequence of the hot pepper provides insights into the evolution of pungency in Capsicum species. Nat Genet 46: 270–278. 10.1038/ng.2877 [DOI] [PubMed] [Google Scholar]
  • 14. Arnedo-Andrés M, Gil-Ortega R, Luis-Arteaga M, Hormaza J (2002) Development of RAPD and SCAR markers linked to the Pvr4 locus for resistance to PVY in pepper (Capsicum annuum L.). Theor Appl Genet 105: 1067–1074. [DOI] [PubMed] [Google Scholar]
  • 15. Caranta C, Thabuis A, Palloix A (1999) Development of a CAPS marker for the Pvr4 locus: a tool for pyramiding potyvirus resistance genes in pepper. Genome 42: 1111–1116. [PubMed] [Google Scholar]
  • 16. Grube R, Blauth J, Andrés MA, Caranta C, Jahn M (2000) Identification and comparative mapping of a dominant potyvirus resistance gene cluster in Capsicum . Theor Appl Genet 101: 852–859. [Google Scholar]
  • 17. Janzac B, Fabre MF, Palloix A, Moury B (2009) Phenotype and spectrum of action of the Pvr4 resistance in pepper against potyviruses, and selection for virulent variants. Plant Pathol 58: 443–449. [Google Scholar]
  • 18. Kim HJ, Han JH, Kim S, Lee HR, Shin JS, Kim JH, et al. (2011) Trichome density of main stem is tightly linked to PepMoV resistance in chili pepper (Capsicum annuum L.). Theor Appl Genet 122: 1051–1058. 10.1007/s00122-010-1510-7 [DOI] [PubMed] [Google Scholar]
  • 19. Lee MY, Song YS, Ryu KH (2011) Development of infectious transcripts from full-length and GFP-tagged cDNA clones of Pepper mottle virus and stable systemic expression of GFP in tobacco and pepper. Virus Res 155: 487–494. 10.1016/j.virusres.2010.12.004 [DOI] [PubMed] [Google Scholar]
  • 20. Ahn HI, Yoon JY, Hong JS, Yoon HI, Kim MJ, Ha JH, et al. (2006) The complete genome sequence of pepper severe mosaic virus and comparison with other potyviruses. Arch Virol 151: 2037–2045. [DOI] [PubMed] [Google Scholar]
  • 21. Baldauf PM, Gray S, Perry KL (2006) Biological and serological properties of Potato virus Y isolates in northeastern United States potato. Plant Dis 90: 559–566. [DOI] [PubMed] [Google Scholar]
  • 22. Oh S-K, Kim S-B, Yeom S-I, Lee H-A, Choi D (2010) Positive-selection and ligation-independent cloning vectors for large scale in planta expression for plant functional genomics. Mol Cells 30: 557–562. 10.1007/s10059-010-0156-2 [DOI] [PubMed] [Google Scholar]
  • 23. Bae C, Kim S-m, Lee DJ, Choi D (2013) Multiple classes of immune-related proteases associated with the cell death response in pepper plants. PLoS One 8: e63533 10.1371/journal.pone.0063533 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Vijayapalani P, Maeshima M, Nagasaki-Takekuchi N, Miller WA (2012) Interaction of the trans-frame potyvirus protein P3N-PIPO with host protein PCaP1 facilitates potyvirus movement. PLoS Pathog 8: e1002639 10.1371/journal.ppat.1002639 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Yu J-H, Hamari Z, Han K-H, Seo J-A, Reyes-Domínguez Y, Scazzocchio C, et al. (2004) Double-joint PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi. Fungal Genet Biol 41: 973–981. [DOI] [PubMed] [Google Scholar]
  • 26. Szewczyk E, Nayak T, Oakley CE, Edgerton H, Xiong Y, Taheri-Talesh N, et al. (2007) Fusion PCR and gene targeting in Aspergillus nidulans. Nat Protoc 1: 3111–3120. [DOI] [PubMed] [Google Scholar]
  • 27. Wroblewski T, Tomczak A, Michelmore R (2005) Optimization of Agrobacterium‐mediated transient assays of gene expression in lettuce, tomato and Arabidopsis. Plant Biotech J 3: 259–273. [DOI] [PubMed] [Google Scholar]
  • 28. Oh SK, Young C, Lee M, Oliva R, Bozkurt TO, Cano L. M, et al. (2009) In planta expression screens of Phytophthora infestans RXLR effectors reveal diverse phenotypes, including activation of the Solanum bulbocastanum disease resistance protein Rpi-blb2. Plant Cell 21: 2928–2947. 10.1105/tpc.109.068247 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Qutob D, Kamoun S, Gijzen M (2002) Expression of a Phytophthora sojae necrosis‐inducing protein occurs during transition from biotrophy to necrotrophy. Plant J 32: 361–373. [DOI] [PubMed] [Google Scholar]
  • 30. Win J, Kamoun S, Jones AM. Methods in Molecular Biology In: McDowell John M, editor. Purification of Effector–Target Protein Complexes via Transient Expression in Nicotiana benthamiana. New York: Human Press; 2011. pp. 181–194. [DOI] [PubMed] [Google Scholar]
  • 31. Szittya G, Burgyán J (2001) Cymbidium ringspot tombusvirus coat protein coding sequence acts as an avirulent RNA. J Virol 75: 2411–2420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Verchot J, Herndon KL, Carrington JC (1992) Mutational analysis of the tobacco etch potyviral 35-kDa proteinase: identification of essential residues and requirements for autoproteolysis. Virology 190: 298–306. [DOI] [PubMed] [Google Scholar]
  • 33. Restrepo-Hartwig MA, Carrington JC (1994) The tobacco etch potyvirus 6-kilodalton protein is membrane associated and involved in viral replication. J Virol 68: 2388–2397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Wei T, Zhang C, Hong J, Xiong R, Kasschau KD, Zhou X, et al. (2010) Formation of complexes at plasmodesmata for potyvirus intercellular movement is mediated by the viral protein P3N-PIPO. PLoS Pathog 6: e1000962 10.1371/journal.ppat.1000962 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Elena SF, Rodrigo G (2012) Towards an integrated molecular model of plant–virus interactions. Curr Opin Virol 2: 719–724. 10.1016/j.coviro.2012.09.004 [DOI] [PubMed] [Google Scholar]
  • 36. Carrington JC, Dougherty WG (1987) Small nuclear inclusion protein encoded by a plant potyvirus genome is a protease. J Virol 61: 2540–2548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Hong Y, Hunt AG (1996) RNA polymerase activity catalyzed by a potyvirus-encoded RNA-dependent RNA polymerase. Virology 226: 146–151. [DOI] [PubMed] [Google Scholar]
  • 38. Atreya PL, Lopez-Moya J, Chu M, Atreya CD, Pirone TP (1995) Mutational analysis of the coat protein N-terminal amino acids involved in potyvirus transmission by aphids. J Gen Virol 76: 265–270. [DOI] [PubMed] [Google Scholar]
  • 39. Valkonen J, Kyle M, Slack S (1996) Comparison of resistance to potyviruses within Solanaceae: infection of potatoes with tobacco etch potyvirus and peppers with potato A and Y potyviruses. Ann Appl Biol 129: 25–38. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Identification of NIb as the HR-inducing avirulence factor against Pvr4-bearing pepper plants.

Transient expression of PepMoV viral proteins in the resistant homozygotic F2 (RR), F1 hybrid, ECW and the susceptible homozygotic F2 (SS). Eleven cistrons from PepMoV were infiltrated into four pepper cultivars.

(TIF)

S2 Fig. Verification of NIb-encoded protein as the avirulence factor against Pvr4-bearing pepper plants.

(A) Response of five pepper cultivars after in planta expression of NIb or frame-shifted NIb mutant clone of PepMoV at 2–3 dpi. (B) RT-PCR of transient overexpressed PepMoV NIb and -ΔNIb. Pepper leaves were sampled at 0, 12, 18, 24 and 48 hours after transient overexpression. As a control, actin was used.

(TIF)

S3 Fig. Confirmation of NIb as the HR-inducing avirulence factor against Pvr4-bearing pepper plants.

In planta expressions of NIbs from four potyviruses were performed in four cultivars, respectively.

(TIF)

S1 Table. Primer sequences used in this study.

(XLSX)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES