Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Mar 1.
Published in final edited form as: Clin Immunol. 2015 Jan 5;157(1):30–42. doi: 10.1016/j.clim.2014.12.010

The Osteopontin Transgenic Mouse is a New Model for Sjögren’s Syndrome

Sehba Husain-Krautter 1,2,*, Jill M Kramer 2,3,4,5,*, Wentian Li 2,6, Benchang Guo 2, Thomas L Rothstein 1,2,7,8
PMCID: PMC4357545  NIHMSID: NIHMS653627  PMID: 25572532

Abstract

Osteopontin (Opn) is a cytokine involved in both physiological and pathological processes, and is elevated in many autoimmune diseases. Sjögren’s syndrome (SS) is an autoimmune disease with a strong female predilection characterized by lymphocytic infiltration of exocrine glands. We hypothesized Opn contributes to SS pathogenesis. We examined an established SS model, and found increased Opn locally and systemically. Next, we examined Opn transgenic (Opn Tg) mice for evidence of SS. Opn Tg animals exhibited lymphocytic infiltration of salivary and lacrimal glands, and Opn co-localized with the infiltrates. Moreover, saliva production was reduced, and SS autoantibodies were observed in the serum of these mice. Finally, female Opn Tg mice showed more severe disease compared to males. Taken together, these data support a role for Opn in SS pathogenesis. We identify a new model of spontaneous SS that recapitulates the human disease in terms of sex predilection, histopathology, salivary deficits, and autoantibodies.

1. Introduction

Osteopontin (Opn) is a multifunctional protein with diverse physiological functions. Opn was originally isolated, cloned, and sequenced from the rat osteosarcoma cell-line ROS 17/2.8. The name “osteopontin” was thought to reflect its potential to form a bridge between osteoid cells and matrix [1]. Opn is now known to have a wide tissue distribution and is expressed by many immune cells including macrophages, dendritic cells, and lymphocytes [2–6]

Although Opn has important functions in many tissues, it is also implicated in several disease processes. Interestingly, Opn is associated with numerous autoimmune diseases in both humans as well as animal models, including systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), multiple sclerosis (MS), and type I diabetes [7–13]. Polymorphisms in OPN are also implicated in organ specific autoimmune diseases. For example, polymorphisms in the OPN alleles are observed in young type I diabetic patients [13] Moreover, OPN is identified as a new RA susceptibility gene [14]. Importantly, there are two recent studies that show increased Opn in serum and salivary tissue of patients with Sjögren’s syndrome (SS) [15, 16], although the role of Opn in SS remains poorly understood. Thus, many autoimmune conditions exhibit elevated Opn, and this is strongly correlated with disease development in both humans and in animal models.

Like most autoimmune diseases, SS displays a strong female predilection. The diagnosis of SS is complicated, and currently includes a compilation of both subjective and objective symptoms and signs [17], although recent work has resulted in a new preliminary diagnostic profile for SS that proposes removal of the subjective criteria from the current diagnostic algorithm [18]. Patients with SS typically display xerostomia and xerophthalmia, and also have lymphocytic infiltrates in salivary and lacrimal tissue. In addition, serological expression of anti-SSA (Ro) and/or anti-SSB (La) autoantibodies are included as part of the diagnostic criteria. An ideal SS mouse model should display characteristics similar to those seen in human SS including the aforementioned clinical, histological, and serological features [19].

Given the relationship between Opn and other autoimmune conditions, we hypothesized that Opn is important in the etiology and pathogenesis of SS. To determine whether Opn may be linked pathogenically to SS disease, we first examined Opn levels in the well-established NOD/ShiLtJ (NOD) SS model [20]. Opn expression was elevated in salivary gland tissue from these mice as compared to controls. We then sought to determine whether over-expression of Opn plays a role in SS pathogenesis. To this end, we used a murine model in which transgenic Opn expression is driven by an immunoglobulin enhancer/promoter [21]. Our results show that this model displays many features of human SS, and thus represents an excellent model to study this disease. The Opn transgenic (Opn Tg) model will prove a valuable tool in the study of this debilitating condition and further support the study of Opn as a previously unappreciated mediator in SS pathogenesis.

2. Materials and Methods

2.1. Mice

BALB/c, NOD/ShiLtJ (NOD) and C57BL/6 mice were obtained from the Jackson Laboratory. Opn Tg mice in which Opn expression is driven by the immunoglobulin enhancer/SV40 promoter were kindly provided by Dr. Uede from Hokkaido University, Japan [21]. These mice were backcrossed with C57BL/6 mice for a total of 13 generations. Mice were cared for and handled in accordance with Institutional Animal Care and Use Committee and National Institutes of Health guidelines.

2.2. Sera collection

Sera from Opn Tg mice were harvested at 18–31 weeks of age and from NOD mice at 16 weeks of age. Healthy age and gender matched C57BL/6 and BALB/c mice were used as controls. Mice were bled by cardiac puncture following euthanasia. Samples were placed at room temperature for two hours, and centrifuged at 3,000 rpm for 20 minutes. Samples were collected and stored at −20°C prior to use.

2.3. Isolation of exocrine tissue

Submandibular salivary gland (SMG) and lacrimal gland tissue were removed following euthanasia. Tissue was fixed in 10% buffered formalin or frozen for mRNA analysis.

2.4. mRNA isolation and quantitative PCR (qPCR)

mRNA was isolated from B and T cells and whole SMG tissue using a RNeasy kit (Qiagen). Reverse transcription was performed using an iScript kit (BioRad). qPCR was performed using SYBR green (BioRad), as previously described [17, 22]. Primers were as follows: Actin: Forward 5′ GCTACAGCTTCACCACCACA 3′, Reverse: 5′ TCTCCAGGGAGGAAGAGGAT 3′, Gapdh: Forward 5′ GCAGTGGCAAAGTGGAGATT 3′, Reverse: 5′ GAATTTGCCGTGAGTGGAGT 3′, and Opn: Forward: 5′ GACAACAACGGAAAGGGCAG 3′, Reverse: 5′ GATCGGCACTCTCCTGGCT 3′. All samples were analyzed in duplicate and Opn expression normalized to Actin or Gapdh. PCR settings were as follows: 50 °C for 2 min, 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. PCR data were analyzed by ΔCT.

2.5. Immunobloting analysis

Proteins were extracted from B and T cell pellets with radio-immunoprecipitation assay lysis buffer. In each experiment, equal amounts of protein for each condition were subjected to SDS-PAGE followed by immunoblotting as previously described [23]. Immunoreactive proteins were detected by ECL (Amersham Biosciences). Immunoblots were stripped and reprobed with control antibody to verify equal amounts of protein were loaded in each lane.

2.6. ELISA

Sera were harvested as described above. Serum anti-Ro autoantibody titers (Alpha Diagnostics), total IgM, IgA, IgG (Bethyl Laboratories), and Opn levels (R&D Systems) were assessed by ELISA according to the manufacturer’s instructions.

2.7. HEp-2 Staining

HEp-2 slides (MBL Bion) were incubated with diluted mouse sera (1:100) from female Opn Tg (n=4, 16 wks) and female C57BL/6 mice (n=4, 16 wks). Slides were stained with a polyvalent anti-immunoglobulin-FITC antibody (Sigma). Images were acquired using a fluorescence microscope (Zeiss Axiovert 200M) with a FITC filter.

2.8. Assessment of disease development

Hematoxylin and eosin (H&E) stained salivary and lacrimal gland tissues were examined for lymphocytic infiltrates. Lymphocytic foci consisting of at least 50 cells per high power field were considered indicative of SS disease, as previously described (16).

2.9. Saliva collection and quantification

Pilocarpine HCl (0.3 mg/100 μL) was injected intraperitoneally (Sigma-Aldrich), and saliva was collected for 10 minutes. Saliva was immediately placed on ice, centrifuged briefly, and quantified using a pipette. All samples were stored at −20° C prior to study.

2.10. B cell isolation and activation

B cells were isolated from spleens of C57BL/6 and Opn Tg mice by negative selection using magnetic beads (Miltenyi Biotech) and resuspended in culture medium consisting of RPMI 1640 medium supplemented with L-glutamine (2 mM), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (20 mM), penicillin (100 U/ml), streptomycin (0.1 mg/ml), 2-mercaptoethanol (50 mM) and 10% FCS. The isolated B cells were treated with F(ab′)2 fragments of goat ant-mouse IgM at 15 μg/ml (anti-Ig) (Jackson ImmunoResearch) and cultured for 4 days.

2.11. In vitro [3H] thymidine assay

B cells were isolated from spleens of C57BL/6 and Opn Tg mice by negative selection, and cultured as described above. B cells were seeded at a density of 1 x 105 cells/ 0.1 ml medium in a 96-well culture plate. On day 4 of culture, cells were pulsed with 0.5 microcurie/well of [3H] thymidine for 6 hours. Cells were then harvested, and incorporation of [3H] thymidine was quantified using a scintillation counter (Beckman Coulter).

2.12. Assessment of cell viability by flow cytometry

Splenic B cells isolated from C57BL/6 and Opn Tg mice were cultured for 1, 2, 3 and 5 days, as described above. At the end of each incubation period, cell viability was assessed using propidium iodide (1 mg/ml) by flow cytometry. Data was acquired using a LSRII flow cytometer (BD Biosciences) and analyzed with FlowJo software (Tree Star).

2.13. Cytokine Quantification

Sera were harvested as described above and Interleukin-4 (IL-4), IL-6, IL-2 and TNF-α were quantified by multiplex ELISA cytokine array using Q-Plex™ technology (Quansys Biosciences). Q-Plex™ technology involves the micro-spotting of individual groups of capture antibody in either a cartesian or polar coordinate system on the bottom of a 96 well plate, each spot being its own micro ELISA. Each well is identically spotted. Standard ELISA incubation steps apply such as initial sample incubation, washing, secondary antibody incubation, washing, incubation with the chemiluminescent label and measurement.

2.14. Immunohistochemistry and histopathology

Formalin fixed, paraffin embedded tissue was stained with H&E using the Symphony automated platform (Ventana). Immunohistochemistry (IHC) was performed on salivary tissue with an IntelliPATH autostainer (BioCare Medical) using an Opn antibody (0.07 μg/mL) (LifeSpan Biosciences). An isotype control (Abcam) was used at the same concentration.

3. Results

3.1. Opn is increased in salivary tissue and serum of NOD animals

To determine whether Opn is pathogenically linked to SS disease, we assessed Opn expression in serum and SMG tissue using the well-characterized NOD SS model. NOD animals develop spontaneous SS disease in a highly predictable time frame [20]. To determine whether salivary Opn is elevated in SS, we isolated SMG tissue from NOD females with clinical disease and age and gender matched BALB/c controls. We found that NOD animals have higher expression of Opn compared to healthy controls (Figure 1A). Then, we assessed Opn in sera to determine whether it is elevated systemically. Opn is significantly increased in the NOD animals (n=5) compared to controls (n=5) (Figure 1B). To assess Opn expression in the context of disease development, we examined SMG tissue from female NOD mice at the pre-disease (4 weeks of age, n=5), pre-clinical disease (12 weeks of age, n=5) and clinical disease stages (16 weeks of age, n=5). Age and gender matched BALB/c mice were used as controls. We found that Opn is increased in the SMG of NOD mice with clinical disease, whereas there was no difference in Opn expression at the pre-disease or pre-clinical disease time points (Figure 1C). This indicates that Opn expression in the SMG of NOD mice correlates with the development of SS-like features in these animals.

Figure 1. Opn is increased in SMG tissue and serum of NOD mice.

Figure 1

Open in a new tab

(A) NOD females (n=5, 16 weeks old) with late stage disease were euthanized and salivary glands harvested. SMG from age and gender matched BALB/c mice were used as controls (n=5). Tissue was homogenized, and relative Opn transcript levels were quantified by qPCR. Each sample was analyzed in duplicate and normalized expression relative to Actin is shown. (B) Serum Opn levels were assessed by ELISA. Each sample was analyzed in duplicate. Significance was determined using the Mann-Whitney test (**p<0.01) and (*p<0.05), and mean and SEM are shown. (C) SMG tissue was harvested from NOD females with pre-disease (n=5, 4 weeks old), pre-clinical (n=5, 12 weeks old), and clinical disease (n=5, 16 weeks old). Relative Opn expression was quantified by qPCR as described in (A). (D) Immunohistochemical staining was performed on SMG tissue from Opn Tg female animals and BALB/c controls (16 weeks old). Opn is identified by brown staining. Samples were counterstained with hematoxylin, which appears blue. Representative staining from 3 animals is shown. Scale bars are shown in the lower right of each photomicrograph (original magnification 400X).

We then examined the SMG tissue of clinical disease stage NOD (n=3) and control BALB/c females (n=3) for Opn expression by IHC. We observed Opn expression by salivary gland ducts in both NOD and control BALB/c mice as previously reported [24, 25]. Of note, Opn expression was also seen in the lymphocytes infiltrating the SMG tissue of NOD animals (Figure 1D). This infiltration is termed focal lymphocytic sialadenitis (FLS), and is a hallmark of SS in both murine models and SS patients [17]. Thus, this finding suggests that the increased Opn observed at the clinical disease stage in the SMG gland of NOD mice is most likely due to expression by the infiltrating lymphocytes. Thus Opn is elevated in salivary tissue and systemically in SS-afflicted NOD mice, suggesting a role for Opn in SS pathogenesis.

3.2. B cells have increased Opn compared to T cells in Opn Tg mice

Next, we sought to confirm that Opn is elevated in B cells derived from Opn Tg animals. We evaluated Opn Tg mice in which Opn expression is driven by the immunoglobulin heavy chain promoter, and thus is thought to be primarily B cell derived [21]. Accordingly, previous studies demonstrate B220+ cells from Opn Tg mice express significantly higher amounts of Opn compared to B220− cells [21]. To confirm these data, we purified splenic B and T cells from Opn Tg animals and C57BL/6 controls using magnetic beads and measured Opn expression by qPCR. In agreement with prior studies, we found Opn transcripts are markedly elevated in splenic B cells from the Opn Tg mice compared to T cells from the same animals (Figure 2A). We also evaluated Opn protein levels in Opn Tg animals. Similarly, we observed increased Opn levels in splenic B cells as compared to T cells (Figure 2B and C). Of note, unstimulated B and T cells from wild type mice do not express Opn mRNA or protein as previously shown [6]. Although these experiments were conducted in male mice, females had similar Opn levels (data not shown). Thus, B cells from Opn Tg animals produce significantly more Opn than T cells.

Figure 2. B cells have increased Opn compared to T cells in the Opn Tg mice.

Figure 2

Open in a new tab

Spleens were obtained from Opn Tg mice and B cells were isolated using magnetic beads. (A) mRNA was isolated and reverse transcribed. Relative Opn transcript levels were quantified by qPCR. Each individual sample was analyzed in triplicate and normalized expression relative to Actin from three independent experiments is shown. Error bars represent SEM. Significance was determined using the Mann-Whitney test (**p<0.01). (B) Cell lysates from B and T cells from Opn transgenic mice were subjected to immunoblotting using antibody directed against Opn. Membranes were stripped and re-probed with Gapdh specific antibody as a loading control. (C) Immunoblot analysis data represented as fold change. Significance was determined using the Mann-Whitney test (**p<0.01). (B) Represents one of three independent experiments and (C) represents mean fold change of all three experiments. (A to C) All mice were male and 14–16 weeks of age.

3.3. B cells from Opn Tg animals show enhanced survival and mitogenesis

Since Opn Tg animals express B cell derived Opn [21], we examined B cells from these animals to determine if they demonstrated enhanced survival and mitogenic activity compared to controls. To assess survival, we measured cell viability using propidium iodide. Flow cytometric analysis revealed increased numbers of viable B cells derived from Opn Tg mice (Figure 3A). In addition, Opn Tg B cells showed increased mitogenic activity in response to B cell receptor engagement by anti-IgM F(ab′)2 fragments as compared to C57BL/6 controls (Figure 3B). Thus, B cells derived from Opn Tg animals have enhanced survival and proliferative capacity.

Figure 3. B cells from Opn Tg mice demonstrate enhanced survival and mitogenesis.

Figure 3

Open in a new tab

(A) Viability of B cells from Opn Tg (16 weeks old, n=3) and control C57BL/6 mice (16 weeks old, n=3) was evaluated using propidium iodide following culture for 1, 2, 3, and 5 days. (B) Tritiated thymidine incorporation assays were done using Opn Tg (16 weeks old, n=3) and C57BL/6 control B cells (16 weeks old, n=3). Isolated B cells were treated with F(ab′)2 fragments of goat ant-mouse IgM at 15 μg/ml (anti-Ig) (Jackson ImmunoResearch) and cultured for 4 days. Each assay was repeated three times, and representative experiments are shown. Significance was determined using the Mann-Whitney test (*p<0.05), and (****p<0.0001), and SEM is shown.

3.4. Female Opn Tg mice express serum autoantibodies characteristic of SS

Since Opn is increased in NOD SS mice as well as Opn Tg animals, we sought to determine whether elevated Opn contributes to SS pathogenesis. To this end, we examined both IgG and IgM from Opn Tg animals and C57BL/6 controls. We assayed for autoantibodies using an autoantigen array as an initial screening tool. Results from this array indicated a substantial increase in antibodies directed against SSA (Ro60 and Ro52) in female Opn Tg serum as compared to serum from male Opn Tg animals, and male and female C57BL/6 controls (data not shown). To confirm this, we examined sera from Opn Tg females (n=14, 15–19 weeks) and age and sex matched C57BL/6 controls (n=9) by ELISA. In accordance with the autoantigen array data, we found that female Opn Tg mice have higher titers of anti-SSA autoantibodies (Figure 4A). Finally, we used Hep-2 substrate slides to detect anti-nuclear autoantibodies in serum by indirect immunofluorescence. Strikingly, sera from female Opn Tg mice (n=4, 16–18 weeks) showed significantly more autoreactivity than C57BL/6 control sera (n=4, 16–18 weeks) or sera from male Opn Tg mice (n=4, 16–18 weeks) (Figure 4B).

Figure 4. SS Autoantibodies are increased in female Opn Tg mice.

Figure 4

Open in a new tab

(A) An anti-Ro ELISA was conducted using sera from Opn Tg (n=14, 15–19 weeks) and control C57BL/6 mice (n=9, 15–19 weeks old). Samples were analyzed in duplicate. Significance was determined using the Mann-Whitney test (**p<0.01), and mean and SEM are shown. (B) HEp-2 staining was performed using sera from female Opn Tg (n=4, 16 wks old), male Opn Tg (n=4, 16 wks old) and control female C57BL/6 mice (n=4, 16 wks old) and a representative example from each group is shown.

Since Opn Tg animals express elevated levels of autoantibodies, we sought to confirm that the increase in autoantibodies was not due to heightened antibody production. To this end, we performed ELISAs to quantify serum IgM, IgA and IgG levels in Opn Tg females and age and gender matched C57BL/6 controls. As expected we observed an increase in serum IgM levels in the Opn Tg animals, although total IgA and IgG were comparable in both groups (Supplementary Figure 1). Notably, the anti-SSA levels (all isotypes) in Opn Tg mice were increased 1.83 fold, while the IgM titers were increased 1.56 fold and the IgG and IgA titers were not increased at all. These data indicate that the increase autoantibodies observed in Opn Tg females is not solely due to higher antibody titers seen in these animals. Thus, these results suggest Opn Tg mice recapitulate the female disease predominance observed in human SS as evidenced by enhanced autoantibody production.

3.5. Histopathological findings consistent with SS are evident in salivary and lacrimal gland tissue from female Opn Tg mice

Next, we examined salivary and lacrimal tissue from female Opn Tg mice for FLS. Mice and humans have 3 major salivary glands: parotid, sublingual and submandibular. We focused our analyses on the SMG, since this is the largest salivary gland in mice, and this gland shows evidence of FLS that is similar to the human disease and also present in other SS models [26, 27]. Initially, animals were assayed between the ages of 5 and 14 weeks, and lymphocytes were not observed in SMG tissue at this early time point (n=10) (data not shown). Importantly, we found FLS within the salivary tissue in 10 out of 16 female Opn Tg mice beginning at 16 weeks of age. Lymphocytes were absent in SMG tissue from age and sex matched controls (n=8) (Figure 5A and B). In addition, we examined lacrimal tissue from 8 of the 16 animals for histologic changes consistent with SS. Significantly, 4 of 8 Opn Tg animals demonstrated lymphocytic infiltration of this tissue that was absent in controls. Of note, only 2 of 16 animals showed both salivary as well as lacrimal infiltrates (Figure 5C, D, E and F). Taken together, 12 of 16 (75%) of Opn Tg animals exhibited lymphocytic infiltration of salivary and/or lacrimal gland tissue, suggesting this model demonstrates histopathologic features consistent with human SS. These results are summarized in table 1.

Figure 5. Opn Tg mice have exocrine histopathology consistent with human SS.

Figure 5

Open in a new tab

Lymphocytic infiltration was assessed in salivary gland (A) and lacrimal gland tissue (B) of female control C57BL/6 mice and salivary (C and E) and lacrimal gland tissue (D and F) from age and sex matched Opn Tg mice (C, D, E and F). All animals were 18–24 weeks of age. Representative staining from at least 8 animals is shown. Black arrows represent lymphocytic infiltration, and white arrows indicate ducts. Scale bars are shown in lower right of each photomicrograph (original magnification 400X).

Table 1.

Animal # of infiltrates (SMG) # of infiltrates (lacrimal)
1 2 0
2 0 1
3 1 1
4 0 0
5 3 0
6 0 0
7 1 1
8 0 1
9 1 N.D.
10 0 N.D
11 1 N.D
12 0 N.D
13 1 N.D
14 4 N.D
15 2 N.D
16 1 N.D
Open in a new tab

N.D. = Not determined

3.6. Opn is expressed by ductal epithelium and co-localizes with the lymphocytic infiltrates in SMG tissue from female Opn Tg mice

In mice, Opn is normally expressed by submandibular seromucous acini and ductal epithelium [24, 25]. We performed IHC to determine which cells within the salivary tissue express Opn in diseased Opn Tg animals. We demonstrate that Opn co-localizes with lymphocytic infiltrates within SMG tissue. In addition, Opn is expressed by ductal epithelium in SMG tissue, and these findings were seen in both Opn Tg and control animals as expected (Figure 6A, B and C). In addition, we used immunoblotting to confirm these results as shown in figure 6D and E. We observed increased Opn levels in SMG tissue of Opn Tg animals as compared to controls. These findings demonstrate that female Opn Tg mice show histologic features of SS, and lymphocytic infiltrates within the SMG express Opn.

Figure 6. Opn is expressed by SMG ductal epithelium of female Opn Tg mice.

Figure 6

Open in a new tab

Immunohistochemical staining was performed on SMG tissue from Opn Tg female animals and C57BL/6 control female animals (n=4, 20 weeks old). Staining for Opn (A and C) and isotype control (IC) (B and D) is shown. Brown staining represents expression of the indicated protein. All samples were counterstained with hematoxylin, which appears blue. Representative staining from 3 animals is shown. Scale bars are shown in the lower right of each photomicrograph (original magnification 100X). (E) Cell lysates from SMG of Opn Tg and C57BL/6 mice were subjected to immunoblotting using antibody directed against Opn. Membranes were stripped and re-probed with Gapdh specific antibody as a loading control. (F) Immunoblot analysis data represented as fold change. Significance was determined using Mann-Whitney test (**p<0.01). (E) Represents one of three independent experiments and (F) represents mean fold change of all three experiments. (E and F) All mice were female and 18–20 weeks of age.

3.7. Opn transgenic animals exhibit decreased saliva production

Loss of salivary flow is a hallmark of SS disease and is included as part of the diagnostic criteria [17]. Although the cause of xerostomia in SS is not completely understood, autoantibodies, apoptosis of glandular tissue, polymorphisms in inflammatory genes, and lymphocytic infiltration of salivary tissue may all contribute to loss of saliva [27–30]. To determine whether Opn Tg animals exhibit decreased salivary flow, we assayed production of stimulated saliva following intraperitoneal injection with the parasympathetic agonist, pilocarpine. Notably, we found female Opn Tg mice (16–20 weeks old) produced significantly less saliva than age and sex matched control animals (Figure 7). These results demonstrate functional deficits in saliva production in these mice that mimic findings seen in human subjects with SS.

Figure 7. Female Opn Tg animals exhibit decreased saliva production.

Figure 7

Open in a new tab

Whole stimulated saliva was collected from Opn Tg (n=14) and control animals (n=14). All animals were 16–20 weeks of age. Significance was determined using the Mann-Whitney test (***p<0.001), and mean and SEM are shown.

3.8. Inflammatory cytokines are elevated in the serum of female Opn Tg mice

To determine whether cytokines that are elevated in human SS are also increased in Opn Tg mice, we performed a multiplex ELISA assay. Sera were isolated from female Opn Tg (n=6, 16–18 weeks old) and C57BL/6 mice (n=5, 16–18 weeks old). We observed a significant increase in IL-4, IL-6, IL-2 and TNF-α levels in the sera from Opn Tg mice as compared to healthy controls (Figure 8). These findings are consistent with those seen in human pSS patients [31–33]. Therefore, the serum cytokine profile of female Opn Tg mice resembles that of human pSS patients.

Figure 8. Inflammatory cytokines are elevated in the serum of Opn Tg mice.

Figure 8

Open in a new tab

Sera from female Opn Tg (n=5, 16–18 weeks old) and control female C57BL/6 mice (n=5, 16–18 weeks old,) were assayed by multiplex ELISA. Significance was determined using the Mann-Whitney test (**p<0.01) and (*p<0.05). Each sample was analyzed in triplicate, and mean and SEM are shown

4. Discussion

We show, for the first time, a disease phenotype in Opn Tg animals, suggesting a role for B cell derived Opn in SS development. It is well established that Opn plays a role in the pathogenesis of autoimmune diseases such as SLE, MS, Type I diabetes, and RA, although the role of Opn in SS has not been clarified [13, 15, 16]. Results from our study show NOD mice with clinical disease express increased Opn in both salivary tissue and serum. Further, Opn Tg animals display histologic evidence of SS disease in both salivary and lacrimal gland tissue, and show diminished saliva production. Opn Tg females express elevated anti-SSA autoantibodies. Thus, the Opn Tg mouse represents a new model of pSS that closely mimics the human disease.

The Opn Tg model is particularly valuable because it will allow for examination of Opn in the context of SS pathogenesis. Importantly, these mice develop spontaneous pSS in a relatively short time frame not always seen in other pSS models [34]. We found that 75% of all female animals examined at 18–24 weeks of age showed lymphocytic infiltration of glandular tissue and most animals had significantly decreased saliva production. These animals breed well, and we have not observed development of extraneous malignancies reported in other pSS models [35]. Thus Opn Tg animals represent an excellent model in which to study SS, as the disease develops spontaneously and is more severe in females.

Good murine models are needed to facilitate the study of SS because the etiology of the disease is unknown, and factors responsible for its progression are poorly understood. The role of the microbiome is an emerging area in autoimmune research, and studies implicate the host microbiota in type I diabetes, and RA [36–38]. A recent report showed that bacterially-derived peptides mimic the amino acid sequence and structure of an SS autoantigen (Ro60), and some of these peptides activate Ro60 specific T cells [39]. While the significance of commensal or pathogenic bacteria in SS remains unclear, this is an important area of SS research that needs further exploration.

Regardless of the cause of SS, elevated inflammatory cytokines are characteristic of this disease. We performed multiplex ELISA to determine whether cytokines that are elevated in human SS are also increased in female Opn Tg mice [31–33, 40–42]. We found elevated levels of IL-4, IL-6, IL-2 and TNF-α in the sera of these animals, although the cellular source of these cytokines in our model is unclear. Opn can act on numerous cell types, and data suggest Opn may skew T helper subsets towards Th1, Th17 or Th2 depending on the inflammatory stimulus [43–45]. Alterations in normal CD4+ T helper (Th) subset ratios are observed in SS [46]. The Th17 subset is also activated pathogenically, and the T regulatory subset is also dysregulated [32, 47]. While T cells were classically considered to be the primary source of cytokines in SS, there is significant evidence showing B cells are also integral to disease [48, 49]. Opn is a known polyclonal B cell activator [50], and increased Opn expression may result in secretion of B cell derived pro-inflammatory cytokines [51, 52].

For example, fibroblast-like synoviocytes from RA patients produce Opn, and in co-culture experiments with B cells, B cell derived IL-6 production was enhanced [53]. A study of patients with Crohn’s disease examined the relationship between Opn and TNF-α using in vivo activated T cells from these individuals. Interestingly, Opn enhanced T cell derived TNF-α secretion in a dose dependent manner [54]. Moreover, there is a positive correlation between Opn and IL-2 levels in diseased lung tissue in a pulmonary fibrosis model, and incubation with IL-2 results in increased expression of Opn by human bile duct epithelial cells [55, 56]. Thus, it is possible that Opn and IL-2 have a positive feedback loop and work together to influence biological functions [57].

Similar to IL-2, IL-4 and Opn were both elevated in liver tissue in a steatohepatitis model [58, 59]. While it is known that stimulation of B cells with IL-4 along with B-cell receptor engagement results in Opn production [6], the effect of Opn on IL-4 production is less clear. Studies using Opn deficient animals demonstrate decreased IL-4 production in the invariant natural killer T cell population [60], and asbestos treated Opn−/− animals have reduced IL-4 expression in bronchoalveolar lavage samples [61]. Thus, these studies suggest that a relationship exists between OPN and IL-4 induction, but whether this extends to B cells specifically remains to be determined.

Aside from its effects on inflammatory cytokine production, Opn is a powerful chemoattractant for macrophages and NK cells, and these cells could be an important source of inflammatory cytokines locally within the salivary tissue in SS [62, 63]. The effect of Opn on NK cells is particularly intriguing, especially given the emerging role of NK cells in SS disease. A recent study shows that a polymorphism in the NK cell soluble activating receptor (NCR3/NKp30) promoter conferred protection against pSS. Moreover, systemic levels of NCR3/NKp30 are increased in pSS patients, and the ligand for this receptor is expressed by salivary epithelial cells [64]. Significantly, Opn may be a positive regulator of NK cell development, as Opn deficient mice show impaired development of NK cells in the bone marrow and spleen. Moreover, paracrine Opn signaling is crucial for NK-lineage commitment [65]. A separate study examined Opn in the context of Influenza A virus infection and found an increased number of NK cells induced by Opn [66]. Thus, it is possible that Opn expression influences NK cell activity and number, and this may contribute to SS progression.

Importantly, Opn exerts anti-apoptotic effects on T cells, and dendritic cells, as well as monocytes and macrophages [67–70]. We observed Opn affects B cells in the same way, as cultured Opn Tg B cells show increased survival and mitogenesis. Significantly, similar findings were seen in wild type B cells stimulated with recombinant Opn. The means by which Opn leads to increased survival of B cells is unclear. Studies in MS models and human patients suggest B cell activating factor (BAFF) induces B cell derived Opn that maintains T cell survival through upregulation of the anti-apoptotic protein Bcl-2 [71]. Importantly, high levels of BAFF are documented in SS mouse models and pSS patients [72–74]. Thus, Opn and BAFF may work in concert to enhance survival and expansion of self-reactive B cells in SS. This could represent an important mechanism leading to loss of B cell tolerance in SS.

B cell abnormalities are well documented in SS, and therapies that deplete B cells, such as the anti-CD20 antibody rituximab, have shown modest success in treating the disease [75–77]. However, in rare cases this therapy results in life threatening infection, and so other more targeted therapies would be of significant clinical value [78]. A study using a collagen induced arthritis model demonstrated anti-Opn antibody therapy resulted in apoptosis of activated T cells and reduced levels of inflammatory cytokines in sera [79]. More recently, the safety and efficacy of this approach was demonstrated in human RA patients [80]. Thus, this strategy may be effective in SS patients, as Opn blockade will likely have fewer side effects than the B cell depletion therapies currently in use to treat autoimmunity.

Together the results herein provide evidence that B cell derived Opn plays a role in SS development. While further studies are needed to determine whether this effect is B cell intrinsic in human disease, it is clear that Opn has potent effects on many cells types and is crucial to development of autoimmunity in several models. Opn has not been carefully studied in the context of SS, and the Opn Tg model will serve as a valuable resource to examine the significance of Opn in SS disease. Moreover, further studies are warranted in humans to determine whether Opn is a potential therapeutic target in SS.

Supplementary Material

supplement
NIHMS653627-supplement.docx (253.9KB, docx)

Highlights.

  • Osteopontin (Opn) is elevated in several autoimmune diseases.

  • Opn transgenic (Opn Tg) mice are a new model for Sjögren’s syndrome (SS).

  • Female Opn Tg mice show more severe disease compared to males.

  • Opn Tg animals exhibit lymphocytic infiltration of salivary and lacrimal glands.

  • Opn Tg mice have reduced saliva and increased SS autoantibodies.

Acknowledgments

The authors gratefully acknowledge Ms. Natalie Bitar and Dr. Xuemei Zhong (Hematology and Oncology Section, Department of Medicine Core Facilities, Boston University Medical Center, MA) and Yana Moses (Department of Pathology, Long Island Jewish Medical Center, NY) for assistance with tissue preparation for histological analysis. We would also like to thank Dr. Uede from Hokkaido University, Japan for kindly proving the Opn Tg mice. This work was supported by a Mentored Clinical Scientist Research Career Development Award (K08 DE020882) from the NIDCR awarded to JMK and R01 AI75141 from NIAID awarded to TLR.

Footnotes

The content is solely the responsibility of the authors and does not represent the official views of the NIDCR, NIAID, NCRR, or the NIH.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Oldberg A, Franzen A, Heinegard D. Cloning and sequence analysis of rat bone sialoprotein (osteopontin) cDNA reveals an Arg-Gly-Asp cell-binding sequence. Proceedings of the National Academy of Sciences of the United States of America. 1986;83:8819–23. doi: 10.1073/pnas.83.23.8819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Brown LF, Berse B, Van de Water L, Papadopoulos-Sergiou A, Perruzzi CA, Manseau EJ, et al. Expression and distribution of osteopontin in human tissues: widespread association with luminal epithelial surfaces. Molecular biology of the cell. 1992;3:1169–80. doi: 10.1091/mbc.3.10.1169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.McKee MD, Nanci A. Secretion of Osteopontin by macrophages and its accumulation at tissue surfaces during wound healing in mineralized tissues: a potential requirement for macrophage adhesion and phagocytosis. The Anatomical record. 1996;245:394–409. doi: 10.1002/(SICI)1097-0185(199606)245:2<394::AID-AR19>3.0.CO;2-K. [DOI] [PubMed] [Google Scholar]
  • 4.Kourepini E, Aggelakopoulou M, Alissafi T, Paschalidis N, Simoes DC, Panoutsakopoulou V. Osteopontin expression by CD103-dendritic cells drives intestinal inflammation. Proceedings of the National Academy of Sciences of the United States of America. 2014;111:E856–65. doi: 10.1073/pnas.1316447111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.O’Regan AW, Chupp GL, Lowry JA, Goetschkes M, Mulligan N, Berman JS. Osteopontin is associated with T cells in sarcoid granulomas and has T cell adhesive and cytokine-like properties in vitro. Journal of immunology. 1999;162:1024–31. [PubMed] [Google Scholar]
  • 6.Guo B, Tumang JR, Rothstein TL. B cell receptor crosstalk: B cells express osteopontin through the combined action of the alternate and classical BCR signaling pathways. Molecular immunology. 2009;46:587–91. doi: 10.1016/j.molimm.2008.07.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Keszei M, Detre C, Castro W, Magelky E, O’Keeffe M, Kis-Toth K, et al. Expansion of an osteopontin-expressing T follicular helper cell subset correlates with autoimmunity in B6. Sle1b mice and is suppressed by the H1-isoform of the Slamf6 receptor. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2013;27:3123–31. doi: 10.1096/fj.12-226951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.D’Alfonso S, Barizzone N, Giordano M, Chiocchetti A, Magnani C, Castelli L, et al. Two single-nucleotide polymorphisms in the 5′ and 3′ ends of the osteopontin gene contribute to susceptibility to systemic lupus erythematosus. Arthritis and rheumatism. 2005;52:539–47. doi: 10.1002/art.20808. [DOI] [PubMed] [Google Scholar]
  • 9.Xu G, Nie H, Li N, Zheng W, Zhang D, Feng G, et al. Role of osteopontin in amplification and perpetuation of rheumatoid synovitis. The Journal of clinical investigation. 2005;115:1060–7. doi: 10.1172/JCI23273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Shimizu Y, Ota K, Ikeguchi R, Kubo S, Kabasawa C, Uchiyama S. Plasma osteopontin levels are associated with disease activity in the patients with multiple sclerosis and neuromyelitis optica. Journal of neuroimmunology. 2013;263:148–51. doi: 10.1016/j.jneuroim.2013.07.005. [DOI] [PubMed] [Google Scholar]
  • 11.Chiocchetti A, Orilieri E, Cappellano G, Barizzone N, SDA, GDA, et al. The osteopontin gene +1239A/C single nucleotide polymorphism is associated with type 1 diabetes mellitus in the Italian population. International journal of immunopathology and pharmacology. 2010;23:263–9. doi: 10.1177/039463201002300124. [DOI] [PubMed] [Google Scholar]
  • 12.Karamizadeh Z, Kamali Sarvestani E, Saki F, Karamifar H, Amirhakimi GH, Namavar Shooshtarian MH, et al. Investigation of osteopontin levels and genomic variation of osteopontin and its receptors in Type 1 diabetes mellitus. Journal of endocrinological investigation. 2013;36:1090–3. doi: 10.3275/9098. [DOI] [PubMed] [Google Scholar]
  • 13.Marciano R, D’Annunzio G, Minuto N, Pasquali L, Santamaria A, Di Duca M, et al. Association of alleles at polymorphic sites in the Osteopontin encoding gene in young type 1 diabetic patients. Clinical immunology. 2009;131:84–91. doi: 10.1016/j.clim.2008.11.004. [DOI] [PubMed] [Google Scholar]
  • 14.Gazal S, Sacre K, Allanore Y, Teruel M, Goodall AH, Tohma S, et al. Identification of secreted phosphoprotein 1 gene as a new rheumatoid arthritis susceptibility gene. Annals of the rheumatic diseases. 2014 doi: 10.1136/annrheumdis-2013-204581. [DOI] [PubMed] [Google Scholar]
  • 15.Wang YH, Zhao MS, Zhao Y. Expression of osteopontin in labial glands of patients with primary Sjogren’s syndrome. Beijing da xue xue bao Yi xue ban = Journal of Peking University Health sciences. 2012;44:236–9. [PubMed] [Google Scholar]
  • 16.Wu GL, Li TY, Fan YS, Yu GY. Therapeutic effect of Chinese herbal medicine for strengthening qi, nourishing yin, and removing stasis on serum osteopontin and quality of life of patients with primary Sjogren’s syndrome. Chinese journal of integrative medicine. 2011;17:710–4. doi: 10.1007/s11655-011-0850-8. [DOI] [PubMed] [Google Scholar]
  • 17.Vitali C, Bombardieri S, Jonsson R, Moutsopoulos HM, Alexander EL, Carsons SE, et al. Classification criteria for Sjogren’s syndrome: a revised version of the European criteria proposed by the American-European Consensus Group. Annals of the rheumatic diseases. 2002;61:554–8. doi: 10.1136/ard.61.6.554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Shiboski SC, Shiboski CH, Criswell L, Baer A, Challacombe S, Lanfranchi H, et al. American College of Rheumatology classification criteria for Sjogren’s syndrome: a data-driven, expert consensus approach in the Sjogren’s International Collaborative Clinical Alliance cohort. Arthritis care & research. 2012;64:475–87. doi: 10.1002/acr.21591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lavoie TN, Lee BH, Nguyen CQ. Current concepts: mouse models of Sjogren’s syndrome. Journal of biomedicine & biotechnology. 2011;2011:549107. doi: 10.1155/2011/549107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Cha S, Peck AB, Humphreys-Beher MG. Progress in understanding autoimmune exocrinopathy using the non-obese diabetic mouse: an update. Critical reviews in oral biology and medicine : an official publication of the American Association of Oral Biologists. 2002;13:5–16. doi: 10.1177/154411130201300103. [DOI] [PubMed] [Google Scholar]
  • 21.Iizuka J, Katagiri Y, Tada N, Murakami M, Ikeda T, Sato M, et al. Introduction of an osteopontin gene confers the increase in B1 cell population and the production of anti-DNA autoantibodies. Laboratory investigation; a journal of technical methods and pathology. 1998;78:1523–33. [PubMed] [Google Scholar]
  • 22.Zhong X, Tumang JR, Gao W, Bai C, Rothstein TL. PD-L2 expression extends beyond dendritic cells/macrophages to B1 cells enriched for V(H)11/V(H)12 and phosphatidylcholine binding. European journal of immunology. 2007;37:2405–10. doi: 10.1002/eji.200737461. [DOI] [PubMed] [Google Scholar]
  • 23.Schneider TJ, Grillot D, Foote LC, Nunez GE, Rothstein TL. Bcl-x protects primary B cells against Fas-mediated apoptosis. Journal of immunology. 1997;159:4834–9. [PubMed] [Google Scholar]
  • 24.Obermuller N, Gassler N, Gretz N, Kranzlin B, Hoffmann S, Geiger H, et al. Distinct immunohistochemical expression of osteopontin in the adult rat major salivary glands. Journal of molecular histology. 2006;37:53–60. doi: 10.1007/s10735-006-9031-z. [DOI] [PubMed] [Google Scholar]
  • 25.Ogbureke KU, Fisher LW. Expression of SIBLINGs and their partner MMPs in salivary glands. Journal of dental research. 2004;83:664–70. doi: 10.1177/154405910408300902. [DOI] [PubMed] [Google Scholar]
  • 26.Delaleu N, Nguyen CQ, Peck AB, Jonsson R. Sjogren’s syndrome: studying the disease in mice. Arthritis research & therapy. 2011;13:217. doi: 10.1186/ar3313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Daniels TE, Cox D, Shiboski CH, Schiodt M, Wu A, Lanfranchi H, et al. Associations between salivary gland histopathologic diagnoses and phenotypic features of Sjogren’s syndrome among 1,726 registry participants. Arthritis and rheumatism. 2011;63:2021–30. doi: 10.1002/art.30381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Robinson CP, Brayer J, Yamachika S, Esch TR, Peck AB, Stewart CA, et al. Transfer of human serum IgG to nonobese diabetic Igmu null mice reveals a role for autoantibodies in the loss of secretory function of exocrine tissues in Sjogren’s syndrome. Proceedings of the National Academy of Sciences of the United States of America. 1998;95:7538–43. doi: 10.1073/pnas.95.13.7538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Okuma A, Hoshino K, Ohba T, Fukushi S, Aiba S, Akira S, et al. Enhanced apoptosis by disruption of the STAT3-IkappaB-zeta signaling pathway in epithelial cells induces Sjogren’s syndrome-like autoimmune disease. Immunity. 2013;38:450–60. doi: 10.1016/j.immuni.2012.11.016. [DOI] [PubMed] [Google Scholar]
  • 30.Mongini PK, Kramer JM, Ishikawa TO, Herschman H, Esposito D. Candidate chromosome 1 disease susceptibility genes for Sjogren’s syndrome xerostomia are narrowed by novel NOD. B10 congenic mice Clinical immunology. 2014;153:79–90. doi: 10.1016/j.clim.2014.03.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Szodoray P, Alex P, Jonsson MV, Knowlton N, Dozmorov I, Nakken B, et al. Distinct profiles of Sjogren’s syndrome patients with ectopic salivary gland germinal centers revealed by serum cytokines and BAFF. Clinical immunology. 2005;117:168–76. doi: 10.1016/j.clim.2005.06.016. [DOI] [PubMed] [Google Scholar]
  • 32.Katsifis GE, Rekka S, Moutsopoulos NM, Pillemer S, Wahl SM. Systemic and local interleukin-17 and linked cytokines associated with Sjogren’s syndrome immunopathogenesis. The American journal of pathology. 2009;175:1167–77. doi: 10.2353/ajpath.2009.090319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Szodoray P, Alex P, Brun JG, Centola M, Jonsson R. Circulating cytokines in primary Sjogren’s syndrome determined by a multiplex cytokine array system. Scandinavian journal of immunology. 2004;59:592–9. doi: 10.1111/j.0300-9475.2004.01432.x. [DOI] [PubMed] [Google Scholar]
  • 34.Li H, Dai M, Zhuang Y. A T cell intrinsic role of Id3 in a mouse model for primary Sjogren’s syndrome. Immunity. 2004;21:551–60. doi: 10.1016/j.immuni.2004.08.013. [DOI] [PubMed] [Google Scholar]
  • 35.Li J, Maruyama T, Zhang P, Konkel JE, Hoffman V, Zamarron B, et al. Mutation of inhibitory helix-loop-helix protein Id3 causes γδ T-cell lymphoma in mice. Blood. 2010;116:5615–21. doi: 10.1182/blood-2010-03-274506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Sapone A, de Magistris L, Pietzak M, Clemente MG, Tripathi A, Cucca F, et al. Zonulin upregulation is associated with increased gut permeability in subjects with type 1 diabetes and their relatives. Diabetes. 2006;55:1443–9. doi: 10.2337/db05-1593. [DOI] [PubMed] [Google Scholar]
  • 37.Watts T, Berti I, Sapone A, Gerarduzzi T, Not T, Zielke R, et al. Role of the intestinal tight junction modulator zonulin in the pathogenesis of type I diabetes in BB diabetic-prone rats. Proceedings of the National Academy of Sciences of the United States of America. 2005;102:2916–21. doi: 10.1073/pnas.0500178102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Eerola E, Mottonen T, Hannonen P, Luukkainen R, Kantola I, Vuori K, et al. Intestinal flora in early rheumatoid arthritis. British journal of rheumatology. 1994;33:1030–8. doi: 10.1093/rheumatology/33.11.1030. [DOI] [PubMed] [Google Scholar]
  • 39.Szymula A, Rosenthal J, Szczerba BM, Bagavant H, Fu SM, Deshmukh US. T cell epitope mimicry between Sjogren’s syndrome Antigen A (SSA)/Ro60 and oral, gut, skin and vaginal bacteria. Clinical immunology. 2014;152:1–9. doi: 10.1016/j.clim.2014.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Brayer JB, Cha S, Nagashima H, Yasunari U, Lindberg A, Diggs S, et al. IL-4-dependent effector phase in autoimmune exocrinopathy as defined by the NOD. IL-4-gene knockout mouse model of Sjogren’s syndrome. Scandinavian journal of immunology. 2001;54:133–40. doi: 10.1046/j.1365-3083.2001.00958.x. [DOI] [PubMed] [Google Scholar]
  • 41.Gao J, Killedar S, Cornelius JG, Nguyen C, Cha S, Peck AB. Sjogren’s syndrome in the NOD mouse model is an interleukin-4 time-dependent, antibody isotype-specific autoimmune disease. Journal of autoimmunity. 2006;26:90–103. doi: 10.1016/j.jaut.2005.11.004. [DOI] [PubMed] [Google Scholar]
  • 42.Nguyen CQ, Gao JH, Kim H, Saban DR, Cornelius JG, Peck AB. IL-4-STAT6 signal transduction-dependent induction of the clinical phase of Sjogren’s syndrome-like disease of the nonobese diabetic mouse. Journal of immunology. 2007;179:382–90. doi: 10.4049/jimmunol.179.1.382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Ashkar S, Weber GF, Panoutsakopoulou V, Sanchirico ME, Jansson M, Zawaideh S, et al. Eta-1 (osteopontin): an early component of type-1 (cell-mediated) immunity. Science. 2000;287:860–4. doi: 10.1126/science.287.5454.860. [DOI] [PubMed] [Google Scholar]
  • 44.Chen G, Zhang X, Li R, Fang L, Niu X, Zheng Y, et al. Role of osteopontin in synovial Th17 differentiation in rheumatoid arthritis. Arthritis and rheumatism. 2010;62:2900–8. doi: 10.1002/art.27603. [DOI] [PubMed] [Google Scholar]
  • 45.Yang M, Ma C, Liu S, Sun J, Shao Q, Gao W, et al. Hypoxia skews dendritic cells to a T helper type 2-stimulating phenotype and promotes tumour cell migration by dendritic cell-derived osteopontin. Immunology. 2009;128:e237–49. doi: 10.1111/j.1365-2567.2008.02954.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Mitsias DI, Tzioufas AG, Veiopoulou C, Zintzaras E, Tassios IK, Kogopoulou O, et al. The Th1/Th2 cytokine balance changes with the progress of the immunopathological lesion of Sjogren’s syndrome. Clinical and experimental immunology. 2002;128:562–8. doi: 10.1046/j.1365-2249.2002.01869.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Nguyen CQ, Yin H, Lee BH, Carcamo WC, Chiorini JA, Peck AB. Pathogenic effect of interleukin-17A in induction of Sjogren’s syndrome-like disease using adenovirus-mediated gene transfer. Arthritis research & therapy. 2010;12:R220. doi: 10.1186/ar3207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Cornec D, Devauchelle-Pensec V, Tobon GJ, Pers JO, Jousse-Joulin S, Saraux A. B cells in Sjogren’s syndrome: from pathophysiology to diagnosis and treatment. Journal of autoimmunity. 2012;39:161–7. doi: 10.1016/j.jaut.2012.05.014. [DOI] [PubMed] [Google Scholar]
  • 49.Pers JO, Youinou P. Are the B cells cast with the leading part in the Sjogren’s syndrome scenario? Oral diseases. 2013 doi: 10.1111/odi.12153. [DOI] [PubMed] [Google Scholar]
  • 50.Lampe MA, Patarca R, Iregui MV, Cantor H. Polyclonal B cell activation by the Eta-1 cytokine and the development of systemic autoimmune disease. Journal of immunology. 1991;147:2902–6. [PubMed] [Google Scholar]
  • 51.Denhardt DT, Guo X. Osteopontin: a protein with diverse functions. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 1993;7:1475–82. [PubMed] [Google Scholar]
  • 52.Patarca R, Wei FY, Singh P, Morasso MI, Cantor H. Dysregulated expression of the T cell cytokine Eta-1 in CD4–8-lymphocytes during the development of murine autoimmune disease. The Journal of experimental medicine. 1990;172:1177–83. doi: 10.1084/jem.172.4.1177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Take Y, Nakata K, Hashimoto J, Tsuboi H, Nishimoto N, Ochi T, et al. Specifically modified osteopontin in rheumatoid arthritis fibroblast-like synoviocytes supports interaction with B cells and enhances production of interleukin-6. Arthritis Rheum. 2009;60:3591–601. doi: 10.1002/art.25020. [DOI] [PubMed] [Google Scholar]
  • 54.Agnholt J, Kelsen J, Schack L, Hvas CL, Dahlerup JF, Sørensen ES. Osteopontin, a protein with cytokine-like properties, is associated with inflammation in Crohn’s disease. Scand J Immunol. 2007;65:453–60. doi: 10.1111/j.1365-3083.2007.01908.x. [DOI] [PubMed] [Google Scholar]
  • 55.Nakama K, Miyazaki Y, Nasu M. Immunophenotyping of lymphocytes in the lung interstitium and expression of osteopontin and interleukin-2 mRNAs in two different murine models of pulmonary fibrosis. Experimental lung research. 1998;24:57–70. doi: 10.3109/01902149809046054. [DOI] [PubMed] [Google Scholar]
  • 56.Whitington PF, Malladi P, Melin-Aldana H, Azzam R, Mack CL, Sahai A. Expression of osteopontin correlates with portal biliary proliferation and fibrosis in biliary atresia. Pediatric research. 2005;57:837–44. doi: 10.1203/01.PDR.0000161414.99181.61. [DOI] [PubMed] [Google Scholar]
  • 57.Wiwanitkit V. Effect of interleukin-2 and tumor necrosis factor-alpha on osteopontin: molecular function and biological process. Pediatrics international : official journal of the Japan Pediatric Society. 2008;50:213–5. doi: 10.1111/j.1442-200X.2008.02561.x. [DOI] [PubMed] [Google Scholar]
  • 58.Luo XY, Takahara T, Kawai K, Fujino M, Sugiyama T, Tsuneyama K, et al. IFN-gamma deficiency attenuates hepatic inflammation and fibrosis in a steatohepatitis model induced by a methionine- and choline-deficient high-fat diet. American journal of physiology Gastrointestinal and liver physiology. 2013;305:G891–9. doi: 10.1152/ajpgi.00193.2013. [DOI] [PubMed] [Google Scholar]
  • 59.Karcher EL, Hill TM, Bateman HG, 2nd, Schlotterbeck RL, Vito N, Sordillo LM, et al. Comparison of supplementation of n-3 fatty acids from fish and flax oil on cytokine gene expression and growth of milk-fed Holstein calves. Journal of dairy science. 2014;97:2329–37. doi: 10.3168/jds.2013-7160. [DOI] [PubMed] [Google Scholar]
  • 60.Diao H, Iwabuchi K, Li L, Onoe K, Van Kaer L, Kon S, et al. Osteopontin regulates development and function of invariant natural killer T cells. Proc Natl Acad Sci U S A. 2008;105:15884–9. doi: 10.1073/pnas.0806089105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Sabo-Attwood T, Ramos-Nino ME, Eugenia-Ariza M, Macpherson MB, Butnor KJ, Vacek PC, et al. Osteopontin modulates inflammation, mucin production, and gene expression signatures after inhalation of asbestos in a murine model of fibrosis. Am J Pathol. 2011;178:1975–85. doi: 10.1016/j.ajpath.2011.01.048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Persy VP, Verhulst A, Ysebaert DK, De Greef KE, De Broe ME. Reduced postischemic macrophage infiltration and interstitial fibrosis in osteopontin knockout mice. Kidney international. 2003;63:543–53. doi: 10.1046/j.1523-1755.2003.00767.x. [DOI] [PubMed] [Google Scholar]
  • 63.Zhang ZX, Shek K, Wang S, Huang X, Lau A, Yin Z, et al. Osteopontin expressed in tubular epithelial cells regulates NK cell-mediated kidney ischemia reperfusion injury. Journal of immunology. 2010;185:967–73. doi: 10.4049/jimmunol.0903245. [DOI] [PubMed] [Google Scholar]
  • 64.Rusakiewicz S, Nocturne G, Lazure T, Semeraro M, Flament C, Caillat-Zucman S, et al. NCR3/NKp30 contributes to pathogenesis in primary Sjogren’s syndrome. Science translational medicine. 2013;5:195ra96. doi: 10.1126/scitranslmed.3005727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Chung JW, Kim MS, Piao ZH, Jeong M, Yoon SR, Shin N, et al. Osteopontin promotes the development of natural killer cells from hematopoietic stem cells. Stem cells. 2008;26:2114–23. doi: 10.1634/stemcells.2008-0370. [DOI] [PubMed] [Google Scholar]
  • 66.Sato K, Iwai A, Nakayama Y, Morimoto J, Takada A, Maruyama M, et al. Osteopontin is critical to determine symptom severity of influenza through the regulation of NK cell population. Biochemical and biophysical research communications. 2012;417:274–9. doi: 10.1016/j.bbrc.2011.11.100. [DOI] [PubMed] [Google Scholar]
  • 67.Wang KX, Denhardt DT. Osteopontin: role in immune regulation and stress responses. Cytokine & growth factor reviews. 2008;19:333–45. doi: 10.1016/j.cytogfr.2008.08.001. [DOI] [PubMed] [Google Scholar]
  • 68.Hur EM, Youssef S, Haws ME, Zhang SY, Sobel RA, Steinman L. Osteopontin-induced relapse and progression of autoimmune brain disease through enhanced survival of activated T cells. Nature immunology. 2007;8:74–83. doi: 10.1038/ni1415. [DOI] [PubMed] [Google Scholar]
  • 69.Kawamura K, Iyonaga K, Ichiyasu H, Nagano J, Suga M, Sasaki Y. Differentiation, maturation, and survival of dendritic cells by osteopontin regulation. Clinical and diagnostic laboratory immunology. 2005;12:206–12. doi: 10.1128/CDLI.12.1.206-212.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Burdo TH, Wood MR, Fox HS. Osteopontin prevents monocyte recirculation and apoptosis. Journal of leukocyte biology. 2007;81:1504–11. doi: 10.1189/jlb.1106711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Ma N, He Y, Xiao H, Han G, Chen G, Wang Y, et al. BAFF maintains T-cell survival by inducing OPN expression in B cells. Molecular immunology. 2014;57:129–37. doi: 10.1016/j.molimm.2013.08.014. [DOI] [PubMed] [Google Scholar]
  • 72.Daridon C, Devauchelle V, Hutin P, Le Berre R, Martins-Carvalho C, Bendaoud B, et al. Aberrant expression of BAFF by B lymphocytes infiltrating the salivary glands of patients with primary Sjogren’s syndrome. Arthritis and rheumatism. 2007;56:1134–44. doi: 10.1002/art.22458. [DOI] [PubMed] [Google Scholar]
  • 73.Lavie F, Miceli-Richard C, Quillard J, Roux S, Leclerc P, Mariette X. Expression of BAFF (BLyS) in T cells infiltrating labial salivary glands from patients with Sjogren’s syndrome. The Journal of pathology. 2004;202:496–502. doi: 10.1002/path.1533. [DOI] [PubMed] [Google Scholar]
  • 74.Groom J, Kalled SL, Cutler AH, Olson C, Woodcock SA, Schneider P, et al. Association of BAFF/BLyS overexpression and altered B cell differentiation with Sjogren’s syndrome. The Journal of clinical investigation. 2002;109:59–68. doi: 10.1172/JCI14121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Hansen A, Lipsky PE, Dorner T. B cells in Sjogren’s syndrome: indications for disturbed selection and differentiation in ectopic lymphoid tissue. Arthritis research & therapy. 2007;9:218. doi: 10.1186/ar2210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Carubbi F, Cipriani P, Marrelli A, Benedetto P, Ruscitti P, Berardicurti O, et al. Efficacy and safety of rituximab treatment in early primary Sjogren’s syndrome: a prospective, multi-center, follow-up study. Arthritis research & therapy. 2013;15:R172. doi: 10.1186/ar4359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Dass S, Bowman SJ, Vital EM, Ikeda K, Pease CT, Hamburger J, et al. Reduction of fatigue in Sjogren syndrome with rituximab: results of a randomised, double-blind, placebo-controlled pilot study. Annals of the rheumatic diseases. 2008;67:1541–4. doi: 10.1136/ard.2007.083865. [DOI] [PubMed] [Google Scholar]
  • 78.Toussirot E, Bereau M. The Risk of Progressive Multifocal Leukoencephalopathy Under Biological Agents Used in the Treatment of Chronic Inflammatory Diseases. Inflammation & allergy drug targets. 2014 doi: 10.2174/1871528113666140224103712. [DOI] [PubMed] [Google Scholar]
  • 79.Fan K, Dai J, Wang H, Wei H, Cao Z, Hou S, et al. Treatment of collagen-induced arthritis with an anti-osteopontin monoclonal antibody through promotion of apoptosis of both murine and human activated T cells. Arthritis and rheumatism. 2008;58:2041–52. doi: 10.1002/art.23490. [DOI] [PubMed] [Google Scholar]
  • 80.Boumans MJ, Houbiers JG, Verschueren P, Ishikura H, Westhovens R, Brouwer E, et al. Safety, tolerability, pharmacokinetics, pharmacodynamics and efficacy of the monoclonal antibody ASK8007 blocking osteopontin in patients with rheumatoid arthritis: a randomised, placebo controlled, proof-of-concept study. Annals of the rheumatic diseases. 2012;71:180–5. doi: 10.1136/annrheumdis-2011-200298. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplement
NIHMS653627-supplement.docx (253.9KB, docx)

RESOURCES