Abstract
It is well known that cell cycle dysregulation plays an important role in breast cancer. The mechanism, however, is not fully understood. In this study, we aimed to explore whether estrogen and estrogen receptor pathway play a role in the regulation of cell cycle protein cyclin E expression, and whether the expression of cyclin E is associated with breast cancer prognosis. We first examined the level of cyclin E expression in breast cancer by immunohistochemistry. Benign fibroadenoma was used as controls. Next we cultured MCF-7 cells with different concentration of 17β-estradiol or tamoxifen for 48 hours. Then we employ qRT-PCR to determine changes of cyclin E in MCF-7 cells. Cyclin E is overexpressed in breast cancer and its expression is associated with the status of estrogen receptor and lymph node metastasis. After treatment with 17β-estradiol, the gene expression of cyclin E was enhanced, and as the concentration increased, the enhancement increased. After treatment with tamoxifen, the gene expression of cyclin E was inhibited, and as the concentration decreased, the inhibition increased. We demonstrated that estrogen induces, while tamoxifen inhibits cyclin E expression. This indicate that estrogen receptor pathway play a critical role in cell cycle dysregulation in breast cancer.
Keywords: Breast cancer, cyclin E, 17β-estradiol, tamoxifen
Introduction
Breast cancer is the most common cancer among women and remains the 2nd leading cause of cancer death in females. Studies have shown that dysregulation of cell cycles plays a critical role in breast cancer development and metastasis, but the mechanisms of cell cycle dysregulation in breast cancer are not completely understood.
Cell cycle is composed of G1, S, G2 and M phases. Normal cells progress to each phase under the tight control of a series of regulatory factors, including cyclin family. Previous studies have demonstrated that cyclin E, as the main promoting factor in G1/S phase transition, is associated with the occurrence, development and prognosis of various types of tumors, including breast cancer [1-3]. Cyclin E is a type of nucleoprotein, the gene of which is located at 19q12-13 and encodes 395 amino acids. It binds to cyclin-dependent kinase 2 (CDK2) to form cyclin E/CDK2 complex, which participates in the phosphorylation of retinoblastoma protein in G1 and S phases, accelerates S phase and affects the initiation of DNA replication. Hillon NK et al. analyzed 114 cases of breast cancer, and found that the mortality rate of patients with cyclin E overexpression was significantly higher than patients with low expression of cyclin E [4], although another study by Barkhem et al. failed to demonstrate the connections between cyclin E and prognosis using multivariate analysis [5,6]. One aim of our current study is to explore whether cyclin E is overexpressed in breast cancer and whether its expression is associated with nodal metastasis, pathological stage, and the status of estrogen receptor.
Both endogenous and extrinsic estrogens play important roles in the occurrence and development of breast cancer. Estrogen promotes breast cancer via two ways, its toxic metabolite and estrogen receptor signaling pathway. Tamoxifen is a type of selective estrogen receptor modulator that inhibits the classical estrogen receptor signaling pathway. It binds to estrogen receptor and alters its conformation, thus suppresses the formation of estrogen receptor dimer and nuclear translocation. Tamoxifen has been widely used since 1870s as an endocrine therapeutic drug for breast cancer. In this study, we also aimed to study the role of estrogen and estrogen receptor pathway in the regulation of cyclin E. We hypothesize that increased cyclin E expression in breast cancer is induced by estrogen pathway.
Materials and methods
Samples
All cases were obtained from patients who underwent mastectomy at the Fifth People’s Hospital of Jinan between January 2008 and December 2012, including 40 cases of invasive breast cancer and 40 cases of fibroadenoma. The diagnosis was confirmed using Hematoxylin and Eosin (HE) staining by two pathologists. Tissue samples were immediately frozen in liquid nitrogen after resection and stored at -80°C until use. None of the patients had previous neoadjuvant therapy. Written informed consent was obtained from all patients. Collections and using of tissue samples were approved by the Ethics Committee of Shandong University.
Immunohistochemistry
Cyclin E monoclonal antibody and S-P kits were purchased from Sunbio Biotechnology (Shanghai, China). The test was performed according to the manufacturer’s manual. Phosphate-buffered saline was used as negative controls, and positive cancer tissues were used as positive controls.
3, 3’-diaminobenzidine (DAB) staining
Samples were treated with DAB staining kit (Wuhan Boshi Biotech., China) before being washed with tap water for 15 min, followed by counterstaining with hematoxylin for 1 min. The samples were then washed with tap water for 15 min until returning to blue. Finally, the samples were dehydrated, dried, and cover-slipped for study under the microscope. Positive staining of cyclin E is confined to the nucleus. The number of positive cells was counted from 5 different areas. From each area, 200 tumor cells were counted, with a total of 1,000 cells in each case. The percentage of positively stained cells was counted. Less than 10% positivity was considered negative, while > 10% positivity was considered positive.
Cell culture
MCF-7 cells were purchased from Biofavor Biotechnology (Wuhan, China) and cultured in phenol red-free a-Minimum Essential Medium (MEM) containing 10% fetal bovine serum, 100 U/ml penicillin, 100 U/ml streptomycin, and 10 μg insulin, under 37°C and 5% CO2. Log-phase cells were trypsinized and seeded into 6-well plates at a density of 5 × 105 per well. Twenty four hours later, cells were washed with phosphate-buffered saline and switched to serum-free, phenol red-free a-MEM medium. Then, 17β-estradiol (10-7 mol/l, 10-8 mol/l and 10-9 mol/l) or tamoxifen (10-5 mol/l, 10-6 mol/l and 10-7 mol/l) were added into the wells and incubated for 48 hours.
Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was isolated using Trizol reagent following manufacturer’s manual. Concentration of RNA was measured using a spectrophotometer (Model 752, Shanghai Shunyu Hengping Scientific Instrument Co., Ltd., China). RNA template (4.285 μg) from each sample was mixed with 2 μl Oligo (dT) and 2 μl dNTP, and then diluted to 14.5 μl using RNase-free H2O. The mixture was incubated at 70°C for 5 min, centrifuged for a short period of time and then placed on ice. Next, the mixture was mixed with 5 × RT buffer (4 μl), HRP (RRI)/RNase inhibitor (0.5 μl) and M-MLV (1 μl), and diluted to 20 μl using RNase-free H2O. For cDNA synthesis, the mixture was incubated at 42°C for 60 min and 95°C for 5 min.
Cyclin E gene was amplified using Fermentas qRT-PCR system (Thermo Scientific, USA). Human β-actin was used as internal reference. All primers were synthesized by GenScript Company (Nanjing, China). Cyclin E forward primer was AGTGGCGTTTAAGTCCCCTG, and reverse primer was ATACAAGGCCGAAGCAGCAA. Human β-actin forward primer was AGCGAGCATCCCCCAAAGTT, and reverse primer was GGGCACGAAGGCTCATCATT. PCR reaction system contained 1 μL cDNA, 2 μL dNTP (2.5 mM), 0.25 μL Ex Taq, 2.5 μL Ex Taq E buffer (10 × ), forward primer (0.5 μL) and reverse primer (0.5 μL), and was brought to a final volume of 25 μL by adding RNase free H2O. PCR procedures are as follows: initial denaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 56°C for 30 s, elongation at 72°C for 25 s, 30 cycles. After amplification, melting curve analysis was performed.
Statistical analysis
All statistical analyses were performed with SPSS 17.0 for Windows (StatSoft Inc., USA). All results are expressed as means ± SEM. All data were subjected to chi-square test. P < 0.05 was considered statistically significant. The data of the Quantitative real-time polymerase chain reaction were subjected to correlation analysis with SPSS.
Results
Cyclin E is overexpressed in breast cancer and its expression is associated with the status of lymph node metastasis and estrogen receptors
To determine the level of cyclin E expression in breast cancer, immunohistochemistry was performed in breast cancer specimens. Positive staining of cyclin E is confined to the nucleus (Figure 1A and 1B). Benign breast tumor, fibroadenoma, was used as a control. As summarized in Table 1, the positive staining rate of cyclin E in breast cancer is 42.5%, compared to only 12.5% in fibroadenoma (P < 0.05). Next we studied the relationship between cyclin E expression and various clinical parameters. We found that the expression of cyclin E was not related to pathological types, ages and lesion locations (P > 0.05), but was associated with the presence of lymph node metastasis and the expression of estrogen receptors (P < 0.05) (Table 2).
Figure 1.
Staining of cyclin E of breast cancer. A. Positive staining. B. Negative staining. Samples were treated with DAB staining kit (Wuhan Boshi Biotech., China) before being washed with tap water for 15 min, followed by counterstaining with hematoxylin for 1 min. The samples were then washed with tap water for 15 min until returning to blue. Finally, the samples were dehydrated, dried, and cover-slipped for study under the microscope.
Table 1.
Positive rate of cyclin E in breast cancer and benign breast fibroadenoma
| Types of cancers | Total No. | No. of positive patients | Positive rate (%) |
|---|---|---|---|
| Breast cancer | 40 | 17 | 42.5 |
| Breast fibroadenoma | 40 | 5 | 12.5 |
Table 2.
Relationship between pathological factors and the expression of cyclin E in breast cancer and benign breast fibroadenoma
| Pathological factors | Cyclin E positive | Cyclin E negative |
|---|---|---|
| Pathological types | ||
| Infiltrating ductal carcinoma | 10 | 13 |
| Other types | 7 | 10 |
| Age (years) | ||
| ≤ 50 | 5 | 6 |
| > 50 | 12 | 17 |
| Lesion locations | ||
| Left side | 8 | 10 |
| Right side | 9 | 13 |
| Lymph node metastasis | ||
| Yes | 12 | 4 |
| No | 9 | 15 |
| Estrogen receptor | ||
| Negative | 8 | 5 |
| Positive | 2 | 25 |
17β-estradiol increases cyclin E expression in a dose-dependent manner
To study the potential mechanisms that mediate cyclin E overexpression in breast cancer, we treated breast cancer cells (MCF-7) with different doses of 17β-estradiol for 48 hours. Cyclin E mRNA level was measured by qRT-PCR. As shown in Table 3 and Figure 2, cyclin E mRNA level is induced by 17β-estradiol in a dose dependent manner. The data of quantitative real-time polymerase chain reaction were subjected to correlation analysis with SPSS, and r value was 0.551. As the concentration of 17β-estradiol increased, the enhancement increased.
Table 3.
Quantitative data of Cyclin E induction by 17β-estradiol
| 17β-estradiol concentration (mol/l) | Blank | × 10-7 | × 10-8 | × 10-9 |
|---|---|---|---|---|
| β-actin | 20.4121 | 20.5745 | 20.9289 | 20.8464 |
| 20.2459 | 20.7249 | 20.9314 | 20.6687 | |
| 20.2514 | 20.7816 | 20.9573 | 20.6775 | |
| Cyclin E | 27.3281 | 26.644 | 27.1512 | 27.0055 |
| 27.1214 | 26.5899 | 26.918 | 26.9808 | |
| 27.1356 | 26.4488 | 26.9582 | 26.8615 | |
| Δt | 6.916 | 6.069 | 6.222 | 6.159 |
| 6.875 | 5.865 | 5.987 | 6.312 | |
| 6.884 | 5.667 | 6.001 | 6.184 | |
| ΔΔt | 0.000 | -0.846 | -0.694 | -0.757 |
| 0.000 | -1.011 | -0.889 | -0.563 | |
| 0.000 | -1.217 | -0.883 | -0.700 | |
| 2-ΔΔt | 1.000 | 1.798 | 1.617 | 1.690 |
| 1.000 | 2.015 | 1.852 | 1.478 | |
| 1.000 | 2.325 | 1.845 | 1.625 | |
| Means | 1.000 | 2.046 | 1.771 | 1.597 |
Note: MCF-7 cells were treated with 17β-estradiol (10-7 mol/l, 10-8 mol/l and 10-9 mol/l) for 48 h. Cyclin E mRNA was measured using Fermentas qRT-PCR system (Thermo Scientific, USA). Human β-actin was used as internal reference.
Figure 2.
Cyclin E induction by 17β-estradiol. MCF-7 cells were treated with 17β-estradiol (10-7 mol/l, 10-8 mol/l and 10-9 mol/l) for 48 h. Cyclin E mRNA was measured using Fermentas qRT-PCR system (Thermo Scientific, USA). Human β-actin was used as internal reference. Values were normalized to that of the control. Data are expressed as means ± SEM. *, The data were subjected to correlation nanlysis with SPSS and r was 0.551.
Tamoxifen decreases cyclin E expression in a dose-dependent manner
To test whether estrogen induces cyclin E expression via estrogen receptor pathway, we treated cells with tamoxifen, which blocks the pathway. After 48 hours treatment, cyclin E mRNA level was measured. As shown in Table 4 and Figure 3, tamoxifen inhibits cyclin E expression in a dose dependent manner. The data of quantitative real-time polymerase chain reaction were subjected to correlation analysis with SPSS, and r value was 0.718. As the concentration of tamoxifen decreased, the inhibition increased.
Table 4.
Quantitative data of Cyclin E inhibition by tamoxifen
| Tamoxifen concentration (mol/l) | Blank | × 10-5 | × 10-6 | × 10-7 |
|---|---|---|---|---|
| β-actin | 20.4348 | 20.7533 | 20.8954 | 21.1701 |
| 20.448 | 20.6341 | 20.9097 | 20.9317 | |
| 20.5483 | 20.6949 | 21.1219 | 20.9829 | |
| Cyclin E | 26.5699 | 27.6508 | 27.5654 | 27.2633 |
| 26.5998 | 27.6617 | 27.8049 | 27.4156 | |
| 26.6192 | 27.8493 | 27.703 | 27.5932 | |
| Δt | 6.135 | 6.898 | 6.670 | 6.093 |
| 6.152 | 7.028 | 6.895 | 6.484 | |
| 6.071 | 7.154 | 6.581 | 6.610 | |
| ΔΔt | 0.000 | 0.762 | 0.535 | -0.042 |
| 0.000 | 0.876 | 0.743 | 0.332 | |
| 0.000 | 1.084 | 0.510 | 0.539 | |
| 2-ΔΔt | 1.000 | 0.590 | 0.690 | 1.030 |
| 1.000 | 0.545 | 0.597 | 0.794 | |
| 1.000 | 0.472 | 0.702 | 0.688 | |
| Means | 1.000 | 0.535 | 0.663 | 0.837 |
Note: MCF-7 cells were treated with tamoxifen (10-5 mol/l, 10-6 mol/l and 10-7 mol/l) for 48 h. Cyclin E mRNA was measured using Fermentas qRT-PCR system (Thermo Scientific, USA). Human β-actin was used as internal reference.
Figure 3.
Cyclin E inhibition by tamoxifen. MCF-7 cells were treated with tamoxifen (10-5 mol/l, 10-6 mol/l and 10-7 mol/l) for 48 h. Cyclin E mRNA was measured using Fermentas qRT-PCR system (Thermo Scientific, USA). Human β-actin was used as internal reference. Values were normalized to that of the control. Data are expressed as means ± SEM. *, The data were subjected to correlation nanlysis with SPSS and r was 0.718.
Discussion
Breast cancer, as the 2nd leading cause of death and the most common cancer in women, its mechanisms are not completely understood. Both estrogen receptor pathway and cell signal pathway play important roles in breast cancer development. The relationship between these two pathways, however, is not established. In this paper, we aimed to explore the relationship between these two pathways. We found that cyclin E is overexpressed in breast cancer compared to benign breast tumors (Table 1). Its expression is induced by estrogen in vitro, while inhibited by the antagonist of estrogen receptor, tamoxifen (Figures 1 and 2). We also found that the expression of cyclin E is not related to pathological types, ages and locations of the lesion, but is strongly associated with the status of lymph node metastasis and the expression of estrogen receptors.
Estrogen stimulates the growth of breast cancer cells by binding estrogen receptor. The main downstream transcriptional signaling of estrogen receptor is c-Myc expression [7]. Myc activates cyclin E/CDK2 in breast cancer cells resulting in cell cycle progression. The role of cyclin E in breast cancer has been previously studied in animal models. Weroha SJ et al. discovered that cyclin E/CDK2 complex participated in all steps of estradiol-induced breat cancerization in rats by stimulating the over-replication of centrosome [8]. Breast cancer cells can also express the homopolymer of cyclin E with low molecular weight [9]. In human, cyclin E has been linked to breast cancer prognosis. There were studies on the relationship between cyclin E and breast cancer prognosis, some of which showed that poor prognosis was related to the high expression of cyclin E [10-13]. Keyomarsi K et al. showed that cyclin E was usually overexpressed in breast cancer, and the activity of cyclin E in breast cancer could be used as predictors for judging tumor aggressiveness and its clinical prognosis [14]. Our results confirmed the overexpression of cyclin E in breast cancer and found that cyclin E is associated with lymph node metastasis and the status of estrogen receptor. The overexpression of cyclin E may be a promising therapeutic target in breast cancer. In clinic, high level of cyclin E was found to be associated with resistance to endocrine therapy and human epidermal growth factor receptor-2 monoclonal antibody therapy [15,16]. Thus, developing drugs or small molecules that target to lower cyclin E level in breast cancer will be potentially enhance breast cancer therapy.
Acknowledgements
This work was supported by the Science & Technology Project of Jinan Municipal Health Bureau (No. 2011-02).
Disclosure of conflict of interest
None.
References
- 1.Geng Y, Eaton EN, Picon M, Roberts JM, Lundberg AS, Gifford A, Sardet C, Weinberg RA. Regulation of cyclin E transcription by E2Fs and retinoblastoma protein. Oncogene. 1996;12:1173–1180. [PubMed] [Google Scholar]
- 2.Keyomarsi K, Tucker SL, Buchholz TA, Callister M, Ding Y, Hortobagyi GN, Bedrosian I, Knickerbocker C, Toyofuku W, Lowe M, Herliczek TW, Bacus SS. Cyclin E and survival in patients with breast cancer. N Engl J Med. 2002;347:1566–1575. doi: 10.1056/NEJMoa021153. [DOI] [PubMed] [Google Scholar]
- 3.Akli S, Zheng PJ, Multani AS, Wingate HF, Pathak S, Zhang N, Tucker SL, Chang S, Keyomarsi K. Tumor-specific low molecular weight forms of cyclin E induce genomic instability and resistance to p21, p27, andantiestrogens in breast cancer. Cancer Res. 2004;64:3198–3208. doi: 10.1158/0008-5472.can-03-3672. [DOI] [PubMed] [Google Scholar]
- 4.Dhillon NK, Mudryj M. Cyclin E overexpression enhances cytokine-mediated apoptosis in MCF7 breast cancer cells. Genes Imman. 2003;4:336–342. doi: 10.1038/sj.gene.6363973. [DOI] [PubMed] [Google Scholar]
- 5.Barkhem T, Carlsson B, Nilsson Y, Enmark E, Gustafsson J, Nilsson S. Differential response of estrogen receptor alpha and estrogen receptor beta to partial estrogen agonists/antagonists. Mol Pharmacol. 1998;54:105–112. doi: 10.1124/mol.54.1.105. [DOI] [PubMed] [Google Scholar]
- 6.Beekman JM, Allan GF, Tsai SY, Tsai MJ, O’Malley BW. Transcriptional activation by the estrogen-receptor requires a conformational change in the ligand-binding domain. Mol Endocrinol. 1993;7:1266–1274. doi: 10.1210/mend.7.10.8264659. [DOI] [PubMed] [Google Scholar]
- 7.Butt AJ, McNeil CM, Musgrove EA, Sutherland RL. Downstream targets of growth factor and oestrogen signalling and endocrine resistance: the potential roles of c-Myc, cyclin D1 and cyclin E. Endocr Relat Cancer. 2005;12:S47–S59. doi: 10.1677/erc.1.00993. [DOI] [PubMed] [Google Scholar]
- 8.Weroha SJ, Lingle WL, Hong Y, Li SA, Li JJ. Specific overexpression of cyclin e·CDK2 in early preinvasive and primary breast tumors in female ACI Rats induced by estrogen. Horm Cancer. 2010;1:34–43. doi: 10.1007/s12672-009-0004-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Al-Kuraya K, Schrami P, Torhorst J, Tapia C, Zaharieva B, Novotny H, Spichtin H, Maurer R, Mirlacher M, Köchli O, Zuber M, Dieterich H, Mross F, Wilber K, Simon R, Sauter G. Prognostic relevance of gene amplificationsand coamplifications in breast cancer. Cancer Res. 2004;64:8534–8540. doi: 10.1158/0008-5472.CAN-04-1945. [DOI] [PubMed] [Google Scholar]
- 10.Altucci L, Addeo R, Cicatiello L, Dauvois S, Parker MG, Truss M, Beato M, Sica V, Bresciani F, Weisz A. 17beta-Estradiol induces cyclin D1 gene transcription, p36D1-p34cdk4 complex activation and p105Rb phosphorylation during mitogenic stimulation of G(1)-arrested human breast cancer cells. Oncogene. 1996;12:2315–2324. [PubMed] [Google Scholar]
- 11.Balmanno K, Cook SJ. Sustained MAPK kinase activation is required for the expression of cyclin D1, p21Cip1 and a subset of AP-1 proteins in CCL39 cells. Oncogene. 1999;18:3085–3097. doi: 10.1038/sj.onc.1202647. [DOI] [PubMed] [Google Scholar]
- 12.Barbareschi M, Pelosio P, Caffo O, Buttitta F, Pellegrini S, Barbazza R, Dalla Palma P, Bevilacqua G, Marchetti A. Cyclin-D1-gene amplification and expression in breast carcinoma: relation with clinicopathologic characteristics and with retinoblastoma gene product, p53 and p21WAF1 immunohistochemical expression. Int J Cancer. 1997;74:171–174. doi: 10.1002/(sici)1097-0215(19970422)74:2<171::aid-ijc5>3.0.co;2-w. [DOI] [PubMed] [Google Scholar]
- 13.Olayioye MA, Neve RM, Lane HA, Hynes NE. The ErbB signaling network: Receptor heterodimerization in development and cancer. EMBO J. 2000;19:3159–3167. doi: 10.1093/emboj/19.13.3159. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Keyomarsi K, Tucker SL, Buchholz TA, Callister M, Ding Y, Hortobagyi GN, Bedrosian I, Knickerbocker C, Toyofuku W, Lowe M, Herliczek TW, Bacus SS. Cyclin E and Burvival in patients with breast cancer. N EngI J Med. 2002;347:1566–1575. doi: 10.1056/NEJMoa021153. [DOI] [PubMed] [Google Scholar]
- 15.Citri A, Yarden Y. EGF-ERBB signalling: Towards the systems level. Nat Rev Mol Cell Biol. 2006;7:505–516. doi: 10.1038/nrm1962. [DOI] [PubMed] [Google Scholar]
- 16.Scaltriti M, Eichhorn PJ, Cortés J, Prudkin L, Aura C, Jiménez J, Chandarlapaty S, Serra V, Prat A, Ibrahim YH, Guzmán M, Gili M, Rodríguez O, Rodríguez S, Pérez J, Green SR, Mai S, Rosen N, Hudis C, Baselga J. Cyclin E amplification/overexpression is a mechanismof trastuzumab resistance in HER2+ breast cancer patients. Proc Natl Acad Sci U S A. 2011;108:3761–3766. doi: 10.1073/pnas.1014835108. [DOI] [PMC free article] [PubMed] [Google Scholar]