Genetic knockdown of estrogen receptor-alpha in the subfornical organ augments ANG II-induced hypertension in female mice

Abstract

The present study tested the hypotheses that 1) ERα in the brain plays a key role in the estrogen-protective effects against ANG II-induced hypertension, and 2) that the subfornical organ (SFO) is a key site where ERα mediates these protective actions. In this study, a “floxed” ERα transgenic mouse line (ERα^flox) was used to create models in which ERα was knocked down in the brain or just in the SFO. Female mice with ERα ablated in the nervous system (Nestin-ERα⁻ mice) showed greater increases in blood pressure (BP) in response to ANG II. Furthermore, females with ERα knockdown specifically in the SFO [SFO adenovirus-Cre (Ad-Cre) injected ERα^flox mice] also showed an enhanced pressor response to ANG II. Immunohistochemical (IHC), RT-PCR, and Western blot analyses revealed a marked reduction in the expression of ERα in nervous tissues and, in particular, in the SFO. These changes were not present in peripheral tissues in Nestin-ERα⁻ mice or Ad-Cre-injected ERα^flox mice. mRNA expression of components of the renin-angiotensin system in the lamina terminalis were upregulated in Nestin-ERα⁻ mice. Moreover, ganglionic blockade on day 7 after ANG II infusions resulted in a greater reduction of BP in Nestin-ERα⁻ mice or SFO Ad-Cre-injected mice, suggesting that knockdown of ERα in the nervous system or the SFO alone augments central ANG II-induced increase in sympathetic tone. The results indicate that interfering with the action of estrogen on SFO ERα is sufficient to abolish the protective effects of estrogen against ANG II-induced hypertension.

there is considerable evidence from studies in both humans and animal models that estrogen modulates cardiovascular physiology and pathophysiology (9, 26). Previous studies from our laboratories have shown that central estrogen and estrogen receptor (ER) activation is critically involved in the protection against ANG II or aldosterone (Aldo)-dependent hypertension (34, 36, 37). In these studies, central infusion of estrogen attenuated ANG II- or Aldo-induced hypertension in both males and ovariectomized (OVX) females. In contrast, central blockade of ERs by nonselective antagonists increased ANG II or Aldo pressor effects in intact females (34, 36, 37). Because there are multiple cytosolic ER subtypes (e.g., ERα and ERβ), it is not clear which ER subtype is responsible for the antihypertensive effect of central estrogen and, importantly, the central site of estrogen action.

Both ERα and ERβ, the two classic ER subtypes, have been shown to be expressed in key regions of the brain involved in blood pressure (BP) regulation (30). Immunohistochemical (IHC) and molecular biological studies provide evidence for region-specific expression of ER subtypes in these nuclei. For example, ERα appears to predominate in the nucleus of the solitary tract (NTS)- and lamina terminalis (LT)-related structures [i.e., the subfornical organ (SFO), median preoptic nucleus (MnPO), organum vasculosum of the lamina terminalis (OVLT)], while ERβ is most prominent in the paraventricular nucleus (PVN) (30). We and others have shown that estrogen activation of central ERs, probably ERα, in female mice protects against baroreflex dysfunction and hypertension induced by ANG II (21, 37). In contrast, ERβ, but not ERα, in both the PVN and rostral ventral lateral medulla (RVLM) contributes to the protective effects of estrogen against Aldo-induced hypertension (39). These studies suggest that specific ER subtypes mediate the regulatory effect of estrogen on BP in different brain nuclei.

ANG II is an important factor in many forms of both clinical and experimental hypertension. Recent studies indicate that circulating ANG II increases sympathetic nervous system activity and BP via actions on the SFO, one of the key circumventricular organs (CVOs) lacking a blood-brain barrier (10, 18, 19). Genomic overexpression of superoxide dismutase, deletion of the different NADPH oxidase subunits, or blockade of endoplasmic reticulum stress in the SFO prevents hypertension caused by chronic ANG II infusion (16, 22, 41–43). This region is rich in both ANG II type 1 receptors (AT₁R) and ERα, but not ERβ. Under basal conditions, colocalization of ERα and AT₁R is evident in the SFO (15, 24). Previous studies from our laboratory have shown that in the SFO, estrogen attenuates ANG II-induced increases in cellular reactive oxygen species, which is a key intracellular signal produced by ANG II activation (40). Electrophysiological evidence also shows that chronic administration of estrogen not only attenuates the basal spontaneous discharge of SFO neurons, but also reduces the response of these neurons to systemic infusions of ANG II (3). This is further supported by the observations that iontophoretic application of estrogen to SFO neurons and that the acute systemic administration of estrogen inhibits the discharge of these neurons (31). Taken together, these results implicate estrogen interaction with ANG II in the SFO to antagonize the centrally mediated effects of ANG II on sympathetic activity and the control of BP.

In vivo studies employing systemic or intracerebroventricular administration of ER agonist or antagonist cannot specifically identify the site of the protective actions of estrogen against the hypertensive actions of blood-borne ANG II and unequivocally the type of ER that is critical at that site. Therefore, it remains to be fully established that ERα mediates estrogen by actions on the brain and, more specifically, the role of the SFO in this effect. In the present study, using a “floxed” ERα transgenic mouse line harboring a LoxP-flanked (exon 3) for the ERα (ERα^flox) (1), we created a nervous system ERα knockout (Nestin-ERα⁻) mouse by breeding of Nestin-Cre mice with ERα^flox mice, and a SFO ERα knockdown mouse by injection of adenovirus-Cre (Ad-Cre) into the SFO of the ERα^flox mice. Then, we applied these mouse models to determine whether ERα in the nervous system, especially in the SFO, is sufficient to account for the protective effect of estrogen against hypertension induced by circulating ANG II.

METHODS

Animals

All experiments were performed in female mice. A “floxed” ERα transgenic mouse line harboring a LoxP-flanked (exon 3) for the ERα (ERα^flox) was obtained from the University of Missouri and was used to create an animal model in which it is possible to knock out or knock down ERα in a targeted body structure/region. When male Nestin-Cre mice, which express Cre recombinase specifically in neuronal and glial precursor cells (32), are bred with female ERα^flox mice, about one-fourth of the progeny carry both ERα flox and Cre recombinase, which produces a genotype of nervous tissue-specific ERα ablation. These animals are referred to as Nestin-ERα⁻ mice in this article. About one-fourth of the offspring from such breeding bear ERα flox but lack Cre recombinase (Con-ERα^flox, i.e., the maternal phenotype). These two genotypes were the main strains used in this study. The generation of mice with an ERα inactivation (ERα⁻) has previously been described. Cre/LoxP recombination was detected in embryos as early as the head-fold stage. By embryonic day (E) 15.5, recombination occurred in virtually all cells of the nervous system (5). These mice have a deletion in exon 3 of the ERα gene, and they do not express any of the isoforms of the ERα protein (6). Moreover, these mice have similar body weight and normal levels of estradiol, testosterone, luteinizing hormone, and follicle-stimulating hormone compared with control mice (20).

Tail DNA was isolated, and mouse genotyping was performed in progeny by using the Easy-DNA Kit (Invitrogen), as described by Gieske et al. (7). The primer combination of ERαP2F (5′-gtg tca gaa aga gac aat-3′) plus ERαP3 (5′-ggc att acc act tct cct ggg agt ct-3′) was used to determine the presence or absence of LoxP sequences (flox 575 bp or ERα wild-type (WT) 543 bp) (Fig. 1A) in brain representative areas, including brain stem and forebrain structures along the LT (i.e., SFO, MnPO, OVLT), and peripheral organs, such as the kidney and liver. ERαP1 (5′-ttg ccc gat aac aat aac at-3′) and ERαP3 were also used to further confirm whether the exon 3 was removed in the same tissues (Fig. 1A), that is, the removal of the sequence of DNA binding domain and hormonal binding domain (ERα⁻ 359 bp or ERα WT 889 bp). To generate mice specifically lacking ERα in the SFO, a replication-deficient adenovirus encoding Cre-recombinase (Ad-Cre, 1 × 10¹⁰ plaque-forming units/ml, 100 nl) or a control empty vector (Ad-Con) was injected into the ventral hippocampal commissure and allowed to diffuse ventrally into the SFO of the ERα^flox mice, using methods described previously (29).

Fig. 1.

Representative tissue genotyping and mRNA expression of ERα, ERβ, and renin-angiotensin system (RAS) components in Nestin-ERα⁻ and Con-ERα^flox mice. A, top: Cre is present in all of the tissues of Nestin-ERα⁻ mouse, but is absent in Con-ERα^flox mouse. Middle: shown are flox band (575 bp) and ERα wild-type (WT) band by using a combination of ERα P2F and P3 primers, which detects the presence of LoxP sequences. All tissues had WT bands (543 bp), whereas flox bands (575 bp) were removed only in the brain stem and lamina terminalis (LT) in the Nestin-ERα⁻mouse. Bottom: bands detected by combination of ERα P1 and P3 primers, which confirms whether exon 3 of Nestin-ERα⁻ mouse was deleted in the presence of Cre recombinase. As expected, a smaller DNA band (359 bp) was present in the brain stem and LT of Nestin-ERα⁻ mouse with the presence of Cre. This did not occur in kidney and liver of Nestin-ERα⁻ mouse and any checked tissues of the Con-ERα^flox mouse. B: mRNA expression of ERα in the brain stem and LT, but not in kidney and liver, was significantly knocked down in Nestin-ERα⁻ mice, while ERβ expression in the brain stem, kidney, and liver, but not in the LT, was significantly upregulated compared with that in Con-ERα^flox mice. C: upregulation of mRNA expression in RAS components in the LT of Nestin-ERα⁻ when compared with Con-ERα^flox mice. (*P < 0.05 vs. Con-ERα^flox mice).

All mice were bred in the colony at the University of Iowa using harem breeding. After weaning at 3 wk of age, mice were housed individually in standard polypropylene cages placed in a temperature- and humidity-controlled facility with a 12:12-h light-dark cycle (0600 AM to 0600 PM). The mice were maintained on pelleted chow and had ad libitum access to water throughout. The female mice were divided into four groups: 1) control ERα^flox mice (n = 6), 2) Nestin-ERα⁻ mice (n = 7), 3) SFO Ad-Con-injected ERα^flox mice (n = 7), and 4) SFO Ad-Cre-injected ERα^flox mice (n = 7). These groups of mice were treated with ANG II subcutaneously. In addition, four identical groups (groups 1 and 2; n = 6 each; groups 3 and 4; n = 10 each) without ANG II treatment had their brains, kidneys, and livers collected for analysis of mRNA expression of ERα and renin-angiotensin system (RAS) components, including angiotensinogen (AGT), renin, AT₁R, and angiotensin-converting enzyme (ACE) in the brain stem, LT, kidney, and liver, and for analysis of protein expression of ERα in the SFO.

All experiments were conducted in accordance with the National Institutes of Health's Guide for the Care and Use of Laboratory Animals, and experimental protocols were approved by the University of Iowa Animal Care and Use Committee.

Surgical Procedures

Telemetry probe implantation.

Implantable mouse BP transmitters (TA11PA-C10, Data Sciences International) were used to directly measure arterial pressure in individual animals. The mice were anesthetized with a ketamine-xylazine mixture (100 mg/kg and 10 mg/kg). The carotid artery of the mouse was accessed with a ventral midline incision. The left carotid artery was isolated with fine-tipped vessel dilation forceps. Two occlusion sutures were placed beneath the artery. The elevated artery was punctured with a catheter introducer, and the telemetry catheter was inserted into the vessel. The catheter tip was advanced into the thoracic aorta so that ∼3 mm of the thin-walled tip section could reside in the aorta. The sutures were tied and secured with tissue adhesive. Through the same ventral incision, a subcutaneous tunnel was formed across the right pectoral area and was enlarged to form a pocket along the right flank. The body of the transmitter was slipped into the pocket and secured with tissue adhesive. The ventral incision was then closed with a suture.

Osmotic pump implantation.

The mice were anesthetized by inhalation of isoflurane to allow the implantation of osmotic pumps. Osmotic pumps (model 1002; Alzet), containing ANG II (Sigma Chemical) at a concentration sufficient to allow an infusion rate of 800 ng·kg⁻¹·min⁻¹, were implanted subcutaneously on the back.

SFO injection of adenovirus encoding Cre-recombinase.

Replication-deficient adenoviruses encoding Cre recombinase (Ad-Cre) or a control empty vector (Ad-Con) were generated by the University of Iowa Gene Transfer Vector Core. After baseline BP and HR recordings were made, the mice were anesthetized with ketamine-xylazine mixture, and an injector was introduced into the SFO (AP, −0.2 mm; ML, 0.0 mm; and DV, 3.1 mm) for injection of Ad-Cre or Ad-Con (100 nl).

Immunohistochemical and histological verification.

Upon completion of the in vivo protocols, mice were anesthetized and perfused transcardially with PBS followed by 4% paraformaldehyde. The brains were removed, postfixed in 4% paraformaldehyde for 1 h, and then cryoprotected for 2 days in 30% sucrose at 4°C. Frozen 20-μm coronal sections were cut with a cryostat. The tissue was washed with PBS and then blocked with 10% donkey serum (Jackson Laboratory) in PBS containing 0.2% Triton X-100 for 1 h. Sections were then incubated with a rabbit ERα antibody (Upstate; 1:400) and a mouse Cre-specific antibody (1:100; Covance) for 48 h at 4°C in the dark. After being thoroughly washed with PBS, sections were incubated with rhodamine-conjugated donkey anti-mouse antibody and Cy2-conjugated donkey anti-rabbit antibody to detect Cre (red) and ERα (green) expression, respectively. Fluorescence was then identified using a confocal microscope. The locations of the SFO injections were verified by visualization of expression of Cre (red). The animals with missed injections were excluded from analysis.

Western blot analysis of ERα protein expression in the SFO.

Fourteen days after SFO injections of Ad-Cre or Ad-Con, mice were deeply anesthetized with isoflurane. The brains were removed and stored at −80°C until assay. Micropunches were made to collect the SFO. Total cellular protein was isolated from tissue punches of the SFO and was analyzed for protein expression of ERα by Western blot analysis. Briefly, protein samples were mixed with equal volumes of SDS-PAGE buffer, loaded onto the 10% SDS-PAGE gel for electrophoresis, and then transferred to a PVDF membrane (Bio-Rad Laboratories). The membrane was probed with rabbit antibody for anti-ERα (1:1,000; Upstate) or anti-β-actin (1:2,500; Cell Signaling), respectively. This was followed by horseradish peroxidase-labeled anti-rabbit secondary antibody (Santa Cruz Biotechnology), and then treated with an enhanced chemiluminesence reagent. Band intensities were quantified with Imager (Bio-Rad) software and were normalized to β-actin.

Measurement of mRNA expression in brain, kidney, and liver.

Total RNA was isolated from the brain stem, LT, kidney, or liver using the TRIzol method (Invitrogen), and treated with DNase I (Invitrogen). RNA integrity was checked by gel electrophoresis. Total RNA was reverse transcribed using random hexamers following the manufacturer's instructions (Applied Biosystems). Real-time PCR was conducted using 200–300 ng of cDNA and 500 nM of each primer in a 20-μl reaction with iQ SYBR Green Supermix (Bio-Rad). Amplification cycles were conducted at 95°C for 3 min, followed by 40 cycles of 95°C for 15 s and annealing/extension at 60°C for 30 s. Reactions were performed in duplicate and analyzed using a C1000 thermocycler system (Bio-Rad). Samples that did not yield homogenous melt curves were excluded. Changes in mRNA expression levels were normalized to GAPDH levels and were calculated using the ΔΔCt method. Results are expressed as relative fold change, mean of fold change ± SE. Primers were purchased from Integrated DNA Technologies, and the sequences of the primers are shown in Table 1.

Table 1.

Primer sequences for real-time PCR

Gene	Forward Primer	Reverse Primer	Product Size, bp	Accession Number
GAPDH	AACAGCAACTCCCACTCTTC	CCTGTTGCTGTAGCCGTATT	111	NM_008084.3
Renin	ACGGATCAGGGAGAGTCAAA	GAAAGCCCATGCCTAGAACA	150	NM_031192.3
AGT	TCAAAGCAGGAGAGGAGGAAC	AAGGCCTCACACCACACTCT	173	NM_007428.3
AT1R	TGCCCATAACCATCTGCATAG	TTTCAGGAGCTGGAGGAAATAC	104	NM_177322.3
ACE1	ACCCTAGGACCTGCCAATCT	CTCCCAGGCAAACAACAACT	195	NM_207624.5
ERα	CTTCAGTGCCAACAGCCT	GACAGTCTCTCTCGGCCAT	345	NM_007956.3
ERβ	GCCAACCTCCTGATGCTTCTTT	TTGTACCCTCGAAGCGTGTGA	146	NM_207707

AGT, angiotensinogen; AT₁R, angiotensin receptor; ACE, angiotensin converting enzyme; ER, estrogen receptor.

Experimental Protocol

Measurement of BP and HR.

All mice were allowed 10 days of recovery from transmitter implantation surgery before any measurements were made. Thereafter, BP and HR were telemetrically recorded and stored with the Dataquest A.R.T. data acquisition system (Data Sciences International).

To determine the effects of ANG II on BP and HR in female mice with ERα knocked out in the nervous system, the osmotic pumps with ANG II were implanted subcutaneously in Nestin-ERα⁻ and control ERα^flox mice after 5 days of baseline recording.

To determine the effects of ANG II on BP and HR in female mice with ERα knockdown in the SFO, Ad-Cre or Ad-Con was injected into the SFO (100 nl) of ERα^flox mice. Beginning 7 days later, the mice were infused subcutaneously with ANG II for 7 days.

Evaluation of BP responses to autonomic blockade.

The autonomic contribution to increased BP was assessed by administering the ganglionic blocker hexamethonium (30 mg/kg ip). Ganglionic blockade was repeated twice, once during the baseline period and then after 7 days of ANG II infusion. On the day of the ganglionic blockade experiments, BP was recorded for 20 min both before and after hexamethonium injection. After hexamethonium injection, the largest decrease in BP occurred within 5 min. This nadir (2–3 min) was recorded as the maximum fall in BP.

Data Analysis

Mean arterial pressure (MAP) and HR were collected for five baseline days and then for seven consecutive days after ANG II pump implantation or 14 consecutive days after SFO adenovirus injection plus ANG II pump implantation. Difference scores for MAP and for HR were calculated for each animal on the basis of the mean of the 5-day baseline values subtracted from the mean of the 7 days of ANG II treatment. One-way ANOVAs for the experimental groups were then conducted on the means of calculated difference scores. After establishing a significant ANOVA, post hoc analyses were performed with Tukey multiple-comparison tests between pairs of mean change scores. The same statistical method was also used to analyze the differences in the mean of the 5-day baseline vs. the mean of 7 days of treatment in animals within the same group and the differences in mRNA or protein expression of the ERα and the RAS components in the brain stem, LT, kidney, liver, and the SFO in Nestin-ERα⁻ mice or Ad-Cre-injected mice vs. control ERα^flox mice or Ad-Con-injected ERα^flox mice, respectively. All data are expressed as means ± SE. Statistical significance was set at P < 0.05.

RESULTS

The mice exhibited circadian organization of MAP and HR both before and during infusion of ANG II. ANG II infusion elicited increases in daytime and nighttime BPs. Consequently, all data were expressed as values averaged from daytime and nighttime measurements.

Genotyping and ERα mRNA Expression in Nestin-ERα⁻ and Con-ERα^flox Mice

Figure 1A, top, shows the presence of the Cre recombinase gene in the genomic DNA of the Nestin-ERα⁻ mouse but not in the genomic DNA of the Con-ERα^flox mouse. PCR using ERα P2F and P3 primers was employed to detect the presence of LoxP sequences (flox 575 bp and WT 543 bp; Fig. 1A, middle). In the Con-ERα^flox mouse with the absence of Cre, the bands of both flox (575 bp) and ERα WT (543 bp) were present in all tissues. In contrast, in the Nestin-ERα⁻ mouse with the presence of Cre, the flox (575 bp) band was almost completely removed, and the ERα WT (543 bp) remained in the brain stem and LT. However, the flox (575 bp) band was still present in the liver and kidney, even in the presence of Cre. Furthermore, PCR using ERα P1 and P3 primers confirmed that exon 3 was deleted in the presence of Cre recombinase (Fig. 1A, bottom). ERα 359 bp, a smaller DNA band, which was expressed only in the brain stem and LT of Nestin-ERα⁻ mouse, indicated the removal of the sequence of DNA binding domain and hormonal binding domain (exon 3), while the ERα WT (889 bp) without deleting exon 3 was expressed in peripheral tissues of Nestin-ERα⁻ mouse and in all tissues of Con-ERα^flox mouse.

Figure 1B shows the levels of ERα and ERβ mRNA expression by RT-PCR in Nestin-ERα⁻ mice. Accordingly, the ERα expression was significantly knocked down by approximately one-half in the brain stem and LT (P < 0.05; Table 2). However, there were no changes in peripheral tissues, including the kidney and liver (P > 0.05). In contrast, ERβ expression was upregulated in the brain stem, kidney, and liver (P < 0.05), but there was no change in the LT (P > 0.05).

Table 2.

Averaged Ct and ΔΔCt values of ERα in the brain stem and the lamina terminalis of control-ERα^flox and Nestin-ERα⁻ mice

Mice/ERα	Change/Ct	Con-ERαflox	Nestin-ERα−
Brain stem	Ct	27.60 ± 0.24	28.44 ± 0.10
	ΔΔCt	0.00 ± 0.07	0.80 ± 0.04
	Fold change		0.57 ± 0.04*
LT	Ct	29.12 ± 0.09	30.59 ± 0.47
	ΔΔCt	0.00 ± 0.10	0.84 ± 0.06
	Fold change		0.56 ± 0.07*

LT, lamina terminalis.

^*P < 0.05 compared to control-ERα^flox.

The Effect of Nervous System-Specific ERα Knockout on the mRNA Expression of RAS Components in the LT

In LT tissue collected from Nestin-ERα⁻ mice, nervous system-specific ERα knockout produced a significant increase in the mRNA expression of renin, AT₁R, and ACE (P < 0.05) but had no effect on the mRNA expression of AGT (P > 0.05) when compared with Con-ERα^flox mice (Fig. 1C, Table 3).

Table 3.

Averaged Ct and ΔΔCt values of renin-angiotensin system components in the lamina terminalis of control-ERα^flox and Nestin-ERα⁻ mice

Mice/Genes	Ct/ΔΔCt	AGT	Renin	AT1R	ACE
Con-ERαflox	Ct	19.78 ± 0.12	30.62 ± 0.20	25.71 ± 0.15	23.31 ± 0.15
	ΔΔCt	0.00 ± 0.08	0.00 ± 0.10	0.00 ± 0.13	0.00 ± 0.11
Nestin-ERα−	Ct	19.88 ± 0.12	29.98 ± 0.12	25.09 ± 0.13	22.41 ± 0.12
	ΔΔCt	0.2 ± 0.10	−0.52 ± 0.06	−0.50 ± 0.06	−0.78 ± 0.04
Fold change		0.91 ± 0.10	1.40 ± 0.03*	1.37 ± 0.05*	1.69 ± 0.09*

AGT, angiotensinogen; AT₁R, angiotensin receptor; ACE, angiotensin converting enzyme.

^*P < 0.05 compared to control-ERα^flox.

Effects of ANG II on MAP and HR in Control ERα^flox and Nestin-ERα⁻ Mice

Baseline values for BP and HR were comparable in these two groups (Con-ERα^flox mice: 104.4 ± 1.8 mmHg and 593.5 ± 9.2 beats/min; Nestin-ERα⁻ mice: 105.7 ± 1.7 mmHg and 609.2 ± 12 beats/min). Seven days of ANG II infusion resulted in a 22.6 ± 2.7 mmHg (P < 0.05) increase in MAP in Nestin-ERα⁻ mice vs an 11.4 ± 1.8 mmHg increase in Con-ERα^flox mice (Fig. 2, A and C). In contrast, the increase in BP with ANG II did not result in a decrease in HR in any group of mice (Fig. 2B).

Fig. 2.

The nervous tissue-specific knockdown of ERα augmented the pressor effect of ANG II treatment. Daily measurement of mean arterial pressure (MAP; A) and heart rate (HR; B) before and during infusion of ANG II in Con-ERα^flox and Nestin-ERα⁻ mice. C: averaged increases in MAP induced by ANG II infusion in these two groups of mice. Control days are denoted by the letter C, followed by 7 days of ANG II infusion. *P < 0.05 compared with baseline. #P < 0.05 compared with Con-ERα^flox mice given ANG II.

Effects of ANG II on MAP and HR in SFO Ad-Con- or Ad-Cre-Injected ERα^flox Mice

Baseline values for BP and HR were comparable in Ad-Con-injected ERα^flox mice (105.5 ± 1.8 mmHg and 597.7 ± 8.9 beats/min; P > 0.05) and Ad-Cre-injected ERα^flox mice (103.7 ± 2.3 mmHg and 591.3 ± 15.4 beats/min). Neither Ad-Cre nor Ad-Con injections had any effect on the basal BP and HR. Females receiving a control empty vector injection into the SFO showed a significant increase in BP induced by systemic infusion of ANG II (Δ10.3 ± 1.2 mmHg; P < 0.05), but SFO Ad-Cre injection enhanced this pressor effect of ANG II (Δ19.5 ± 2.6 mmHg; P < 0.05 vs. Ad-Con injected mice, Fig. 3, A and C). ANG II infusion did not change HR in either SFO Ad-Con-injected or Ad-Cre-injected ERα^flox mice (Fig. 3B)

Fig. 3.

SFO ERα-mediated the protective effect of estrogen in ANG II-induced hypertension. Daily measurements of MAP (A) and HR (B) before and during infusion of ANG II in SFO Ad-Cre or Ad-Con treated ERα^flox mice. C: average changes in MAP across days induced by ANG II infusion. Control days are denoted by the letter C, followed by 7 days of ANG II infusion. *P < 0.05 vs. baseline. #P < 0.05 vs. Ad-Con group.

Localization and the Effects of SFO Adenoviral Delivery of Cre on ERα Expression

The locus of viral delivery of Cre to knockdown ERα in the SFO was verified by IHC and Western blot analyses. Figure 4A is an IHC photomicrograph, which illustrates the site of delivery and the cells affected in the SFO.

Fig. 4.

A: photomicrograph that illustrates the anatomical placement of the subfornical organ (SFO) cannula and the injection site. SFO Ad-Cre-injected ERα^flox mice showed reduced ERα staining (green) in the SFO that paralleled intense Cre staining (red) in this site. The injections were targeted to the ventral hippocampal commissure so that injectate would diffuse into the SFO to minimize mechanical damage to the SFO proper (B). C: robust ERα expression was seen in the OVLT or AP/NTS, but Cre expression could not be detected in these sites, indicating that the injected Ad-Cre was not likely to have leaked into the brain ventricle.

IHC showed that highly robust Cre expression was present in the SFO accompanied with a marked reduction in the expression of ERα (Fig. 4B) 2 wk following injection of Ad-Cre into the SFO. There was no indication that the SFO Ad-Cre injection leaked into the brain ventricle, as evidenced by finding that there was no apparent expression of Cre in the OVLT or in the AP/NTS (Fig. 4C) and that there was robust ERα expression apparent in these regions. In the SFO of Ad-Con-injected mice, there was clear ERα expression, but no Cre expression (Fig. 4B).

To confirm the effective knockdown of ERα in the SFO with these viruses, we performed a Western blot analysis on the micropunches taken from the SFO. As shown in Fig. 5, A and B, ERα protein level was significantly reduced in mice injected with Ad-Cre by ∼70% when compared with mice injected with the control vector, Ad-Con.

Fig. 5.

Western blot analysis of ERα protein expression in the SFO from mice receiving SFO injection of Ad-Cre or Ad-Con. A: representative Western blots of ERα and β-actin are shown. B: results of Western blot analysis represented the change in ERα protein expression, which was normalized with β-actin in the SFO.

Effects of Autonomic Blockade on BP

Figure 6 shows the decrease in BP produced by acute ganglionic blockade in all groups of female mice. The hexamethonium-induced decreases in BP were comparable in all groups before infusion of ANG II. Following 7 days of ANG II infusion, acute hexamethonium injection resulted in 57.0 ± 6.3 and 48.8 ± 5.2 mmHg decreases in BP in Nestin-ERα⁻ mice (Fig. 6A) and SFO Ad-Cre-injected mice (Fig. 6B), respectively. Both ERα knockdown groups showed significantly greater decreases in BP following hexamethonium relative to that seen in the Con-ERα^flox mice (−44.3 ± 3.4 mmHg; P < 0.05) and Ad-Con-injected mice (−39.0 ± 6.5 mmHg; P < 0.05) given ANG II.

Fig. 6.

Decreases in MAP in response to ganglionic blockade with hexamethonium before and on day 7 after infusion of ANG II in all groups of female mice. *P < 0.05 compared with control. #Compared to Con-ERα^flox or Ad-Cre-injected ERα^flox mice given ANG II.

DISCUSSION

The main findings of this study are that 1) the nervous system ERα is required for protective effects of estrogen against hypertension induced by systemic administration of ANG II, 2) the SFO is a key site where estrogen/ERα interacts with blood-borne ANG II, and 3) the augmented hypertensive effect of ANG II action on the nervous system by way of the SFO in ERα knockdown females involves increased sympathetic outflow.

We have previously reported that both removal of the ovaries and global knockout of ERα augment the pressor effects of ANG II in female mice. These data suggest that there is an important role for ERα in mediating the effects of estrogen in this mouse model with no significant compensation from other pathways (36, 37). In intact WT females, central, but not peripheral, administration of the ER antagonist ICI182,780 augmented increases in BP by ANG II (37). These results further indicate that it is central ERs that mediate estrogen's protective effects in this hypertension model. However, in these previous studies, we did not directly test the hypothesis that the inhibitory effects of estrogen on the ANG II-induced increase in BP can be unequivocally attributable to central ERα, even though ICI182,780 is known to have a high affinity for the ERα (33). In the present study, we used the Nestin-Cre mouse, which is a well-characterized model, combined with other interventions for deleting gene expression in the nervous system (32), and a floxed ERα mouse line to create a mouse model to specifically delete ERα in the nervous system. The specificity of the mouse model was verified by using RT-PCR and Cre expression showing that there was impaired ERα mRNA expression in brain tissues but not in the kidney and liver. The deletion of ERα in the nervous system significantly augmented this pressor effect of ANG II to an extent similar to that observed in global ERα knockout mice or the mice treated with central nonselective ER antagonist during ANG II infusion. These findings confirm the results and hypothesis derived from our previous studies, indicating that central ERα mediates a protective effect of estrogen against ANG II-induced hypertension.

The SFO lies outside the blood-brain barrier and has long been considered to be a critical peripheral-central interface for the cardiovascular actions of the circulating RAS (18). This CVO not only has access to circulating and intraventricular ANG II, but also can generate ANG II from AGT de novo (25, 28). Early microinjection, lesion, and autoradiographic studies provided physiological and anatomical evidence of the critical contribution of the SFO in mediating the central actions of ANG II. Importantly, the centrally mediated effects of systemically administered ANG II on BP and the secretion of vasopressin and oxytocin are all abolished by lesions of the SFO (18). In recent studies, genomic deletion of AGT, NADPH oxidase subunits, and endoplasmic reticulum in the SFO alone prevented the pressor effects induced by systemic ANG II infusion, clearly highlighting the SFO as an essential central site for circulating ANG II effects (16, 22, 25, 28, 41–43). Given that the SFO is rich in both AT₁R and ERα and that they are colocalized in this structure (15, 24), it is likely that the SFO is a site where estrogen can antagonize ANG II pressor effects via the interactions between ERα and AT₁R. Viral delivery of Cre recombinase provides a valuable tool for the region-specific ablation of gene expression (12). A series of studies from Davisson and colleagues (16, 22, 25, 28, 41–43) used the Cre-LoxP recombinase system to specifically dissect neural pathways, such as AGT, NADPH oxidase subunits, and others in the SFO. Using a similar strategy, we employed stereotaxic delivery of Ad-Cre into the SFO in ERα^flox mice in the present study. Immunohistochemistry revealed significantly reduced ERα staining in the SFO along with intense Cre staining at this site in Ad-Cre-treated ERα^flox mice. The knockdown of ERα protein expression in the SFO was confirmed by Western blot analysis. Functionally, the SFO-specific knockdown of ERα resulted in a significant augmentation of the pressor effect induced by ANG II. These results further substantiate the method that conditional ERα gene deletion can be achieved in the SFO by using the Cre recombinase/LoxP system in combination with viral gene transfer of Cre and that it is SFO ERα that mediates the protective effects of estrogen against the development of blood-borne ANG II-induced hypertension.

The chronic phase of ANG II-induced hypertension is associated with increased sympathetic nerve activity (14, 23). We have previously shown that female mice are able to buffer the ANG II-induced increases in BP better than the males because they have reduced activation of the sympathetic nervous system (36). Central ERs, probably ERα, play a mediating role in buffering this ANG II-induced increase in sympathetic nervous system activity (37). The present study confirms and extends these previous studies by showing that Nestin-ERα⁻ mice or SFO Ad-Cre-injected mice showed greater increases in BP during ANG II infusion and greater falls in BP after ganglionic blockade compared with control animals. These results indicate that central ERα activation, especially SFO ERα activation, inhibits ANG II-induced increases in sympathetic outflow, thus contributing to the protective effects of estrogen against hypertension.

There is increasing evidence that the protective effects of estrogen can be attributed, at least in part, to modulating the expression of RAS components in the central nervous system (9, 26, 35). Recent studies have shown that OVX increased ACE1 and AT₁R activity, binding densities, and mRNA expression in the SFO and in the hypothalamus, including the PVN. These effects were prevented by restoration of normal estrogen levels (4, 13). Our previous studies also showed that subpressor doses of ANG II mainly upregulated ACE1 and AT₁R expression in the LT to cause increased sensitization in the absence of estrogen (38). In the present study, we demonstrate further that ablation of nervous system ERα significantly upregulated mRNA expression of renin, ACE1, and AT₁R in LT structures, which includes the SFO. This may indicate why females are more responsive to ANG II in the absence of SFO ERα. Whereas, it should be noted that ERα knockdown in the nervous system not only modulates the mRNA expression of RAS components in the SFO, but also may affect the expression of RAS in downstream nuclei that are inside the blood-brain barrier such as PVN and RVLM. It is possible that the changes in RAS components in the PVN and RVLM may also be involved in the enhanced BP response to ANG II in females lacking ERα. Future studies will be necessary to determine the effect of ERα knockdown on the mRNA expression of RAS components in other brain regions.

The expression of ERα and ERβ is region-specific in most brain nuclei implicated in the regulation of cardiovascular function (30). We and others have demonstrated that it is ERβ, but not ERα, in both the PVN and RVLM that mediate the attenuated effects of estrogen on resting BP, voltage-gated calcium currents, and the glutamate-induced or Aldo-induced increase in BP (8, 27, 39). Therefore, it is possible that ERβ in both the PVN and RVLM may be involved in estrogen's protection against ANG II-induced hypertension. However, previous studies indicate that the SFO is rich in only ERα and directly projects to the PVN and supraoptic nuclei (SON) (3, 15, 18, 31). The increased BP induced by ANG II action at the SFO is mediated by both the release of vasopressin, as a result of activation of magnocellular neurosecretory neurons in the PVN and SON, and the activation of parvocellular neurons in the PVN that innervate sympathoexcitatory neurons in the RVLM and spinal cord (11, 17, 18). Thus, it can be hypothesized that ERα activation in the SFO plays a primary role in the protective effects of estrogen as a result of estrogen interaction with circulating ANG II first in the SFO to decrease activity in the descending neural pathway, while the effects of ERβ activation in the PVN and RVLM are important for actions of estrogen on components controlling sympathetic tone located inside the blood-brain barrier. Surprisingly, upregulated ERβ expression in the brain stem and peripheral organs, such as liver and kidney, and probably also in the PVN (not examined) in the present study had no compensatory role in antagonizing ANG II-induced increase in BP under the condition of reduced ERα in the SFO or nervous system. Taken together, our previous and current studies involving ANG II-mediated increases in BP in 1) OVX WT mice, 2) global ERα knockout mice, 3) Nestin-ERα⁻ mice, and 4) SFO Ad-Cre-injected ERα^flox mice provide converging lines of evidence indicating that ERα in the SFO plays a pivotal role in mediating effects of estrogen on hypertension induced by circulating ANG II.

Both ERα and ERβ have been shown to be expressed in key regions of the brain involved in BP regulation (30), and there are no major differences in the levels of expression in these areas between the sexes (15). Our previous study showed that the central activation of ERs by intracerebroventricular infusion of estrogen in male mice inhibits ANG II-induced increases in sympathetic outflow and attenuates hypertension. In in vitro brain slices of the SFO taken from male mice, estrogen treatment inhibits ANG II-induced increases in reactive oxygen species (40). These observations suggest that estrogen and/or ER activation in the central nervous system also play a protective role in antagonizing ANG II-induced hypertension in males (40). Therefore, studying the effect of estrogen and ERα interactions in the SFO and the protection against hypertension in males are important studies for the future.

Perspectives and Significance

The present study verified that central ERα, especially in the SFO, mediates the protective effect of estrogen in the development of ANG II-induced hypertension in female mice. It has been shown that estrogen replacement after menopause is associated with negative effects such as an increased risk of breast cancer in certain populations (2), which are often attributed to its agonistic activity without receptor subtype (ERα vs. ERβ) or tissue specificity. In addition to selective ER agonists and antagonists, selective ER modulators (SERMs), which act on ERs in a tissue-specific fashion, are being currently investigated in several fields. The current findings will aid in developing SERMs with favorable properties and tissue specificity that target SFO ERα to prevent and treat hypertension in postmenopausal women as well as men.

GRANTS

This work was supported by National Institutes of Health Grants HL-14388, HL-98207, and MH-80241.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

Author contributions: B.X., M.H., and A.K.J. conception and design of research; B.X., Z.Z., T.G.B., and F.G. performed experiments; B.X. and Z.Z. analyzed data; B.X., Z.Z., M.H., and A.K.J. interpreted results of experiments; B.X. and Z.Z. prepared figures; B.X. drafted manuscript; B.X., M.H., and A.K.J. edited and revised manuscript; B.X., Z.Z., T.G.B., F.G., M.H., and A.K.J. approved final version of manuscript.