Skip to main content
NCBI home page
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2014 Sep 4;178(1):65–74. doi: 10.1111/cei.12399

Activation of invariant natural killer T cells in regional lymph nodes as new antigen-specific immunotherapy via induction of interleukin-21 and interferon-γ

T Sakurai *, A Inamine *, T Iinuma *, U Funakoshi *, S Yonekura *, D Sakurai *, T Hanazawa *, T Nakayama †, Y Ishii ‡, Y Okamoto *
PMCID: PMC4360195  PMID: 24943738

Abstract

Invariant natural killer T (iNKT) cells play important immunoregulatory functions in allergen-induced airway hyperresponsiveness and inflammation. To clarify the role of iNKT cells in allergic rhinitis (AR), we generated bone marrow-derived dendritic cells (BMDCs), which were pulsed by ovalbumin (OVA) and α-galactosylceramide (OVA/α-GalCer-BMDCs) and administered into the oral submucosa of OVA-sensitized mice before nasal challenge. Nasal symptoms, level of OVA-specific immunoglobulin (IgE), and T helper type 2 (Th2) cytokine production in cervical lymph nodes (CLNs) were significantly ameliorated in wild-type (WT) mice treated with OVA/α-GalCer-BMDCs, but not in WT mice treated with OVA-BMDCs. These anti-allergic effects were not observed in Jα18–/– recipients that lack iNKT cells, even after similar treatment with OVA/α-GalCer-BMDCs in an adoptive transfer study with CD4+ T cells and B cells from OVA-sensitized WT mice. In WT recipients of OVA/α-GalCer-BMDCs, the number of interleukin (IL)-21-producing iNKT cells increased significantly and the Th1/Th2 balance shifted towards the Th1 dominant state. Treatment with anti-IL-21 and anti-interferon (IFN)-γ antibodies abrogated these anti-allergic effects in mice treated with α-GalCer/OVA-BMDCs. These results suggest that activation of iNKT cells in regional lymph nodes induces anti-allergic effects through production of IL-21 or IFN-γ, and that these effects are enhanced by simultaneous stimulation with antigen. Thus, iNKT cells might be a useful target in development of new treatment strategies for AR.

Keywords: α-galactosylceramide, bone marrow-derived dendritic cells, invariant natural killer T cell, IFN-γ, IL-21

Introduction

During the past several decades, the prevalence of allergic rhinitis (AR) has increased globally 1,2 and AR now affects 400 million people worldwide as a common allergic inflammatory disease that causes medical and socioeconomic problems 3. Significant improvement of AR symptoms can be achieved using readily available drugs such as H1-anti-histamines and topical corticosteroids, but these drugs do not treat the underlying disease 4. Antigen-specific immunotherapy may potentially alter the natural course of AR 4–6; however, conventional immunotherapies, including subcutaneous immunotherapy (SCIT) and sublingual immunotherapy (SLIT), are not convenient, because several years are required to establish a stable and adequate response. In addition, some patients do not show significant improvement of symptoms even with long-term therapy 7–9. These burdens on patients would be reduced by a new method with enhanced therapeutic efficacy and a shortened duration of treatment without serious adverse events.

Invariant natural killer T (iNKT) cells, a major subset of NK T cells, express a unique semi-invariant T cell receptor (TCR) with a Vα14-Jα18 chain in mice and a Vα24-Jα18 chain in humans 10,11. These cells produce many T helper type 1 (Th1)- and Th2-type proinflammatory cytokines, including interferon (IFN)-γ and interleukin (IL)-4, resulting in immune modulation of autoimmune diseases and responses to tumour and infectious agents 12–16. TCRs of iNKT cells recognize monomorphic major histocompatibility complex (MHC) class I-like CD1d molecules on antigen-presenting cells (APCs), and glycolipid antigens such as α-galactosylceramide (α-GalCer) presented on CD1d preferentially activate iNKT cells 17. iNKT cells have been suggested to be tolerogenic in allergic airway inflammation 18–20, but it is unclear whether iNKT cells regulate development of AR.

In this study, we administered ovalbumin (OVA)- and α-GalCer-pulsed bone marrow-derived dendritic cells (BMDCs) into the oral submucosa of OVA-sensitized mice and examined the role of activated iNKT cells in an AR mouse model. Administration of OVA/α-GalCer-pulsed BMDCs suppressed antigen-specific responses, whereas OVA-pulsed BMDCs did not do so. These results show that activation of iNKT cells in draining lymph nodes ameliorated nasal allergic responses in an AR mouse model, and that this anti-allergic effect is associated with IL-21 and IFN-γ production through activated iNKT cells.

Materials and methods

Mice

Female BALB/c mice (8 weeks old) were purchased from SLC Inc. (Hamamatsu, Japan). Jα18-deficient (Jα18–/–) mice were established by specific deletion of the Jα18 gene segment 15 and back-crossing 10 times to the BALB/c background. These mice were also used at 8 weeks of age. Mice were maintained under specific pathogen-free conditions. Use of the mice was approved by the Chiba University Institutional Animal Care and Use Committee and the experiments were conducted in conformity with the guidelines of the committee.

Reagents

α-GalCer (KRN7000) was obtained from Kirin Brewery (Gunma, Japan). OVA (grade 5) was purchased from Sigma-Aldrich (St Louis, MO, USA) and dissolved in endotoxin-free D-phosphate-buffered saline (PBS) (Wako Pure Chemical Industries, Osaka, Japan). RPMI-1640 medium (Sigma-Aldrich) supplemented with 10% fetal calf serum (FCS), l-glutamine (2 μM), penicillin (100 U/ml), streptomycin (100 μg/ml), HEPES (10 mM), 2-mercaptoethanol (55 μM), 1% non-essential amino acids and 1 mM sodium pyruvate (all from Gibco BRL, Grand Island, NY, USA) was used in cell culture experiments. Anti-FcγRII/III monoclonal antibodies (mAbs) (2·4G2) (BD Biosciences, San Jose, CA, USA) were used for Fc blocking. Allophycocyanin-conjugated α-GalCer-loaded CD1d tetramer was purchased from Proimmune (Oxford, UK). Fluorescein isothiocyanate (FITC)-anti-CD11c (N418) (eBiosciences, San Diego, CA, USA), phycoerythrin (PE)-conjugated mAbs including anti-CD4 (GK1·5), anti-CD19 (6D5), anti-CD40 (3/23), anti-CD86 (GL-1) (BioLegend, San Diego, CA, USA), anti-MHC class II IA + IE (M5/114·15) or anti-CD80 (16-10A-1) (eBiosciences) were used for fluorescence activated cell sorter (FACS) analysis. Anitbodies including anti-IL-4 (11B11), anti-IL-5 (TRFK5; Mabtech Ab, Nacka, Sweden), anti-IFN-γ (AN18; BioLegend) or anti-immunoglobulin (Ig)E (RME-1; BD Pharmingen, San Jose, CA, USA), and biotin-conjugated antibodies including anti-IL-4 mAb (BVD6-24G2), anti-IL-5 (TRFK4) (Mabtech antibody), anti-IFN-γ (R4-6A2; BioLegend) or anti-IgE (R35-72; BD Pharmingen) were used in enzyme-linked immunosorbent assays (ELISAs) 21. A mouse IL-13 ELISA Ready-SET-Go! Kit (eBiosciences) and a mouse anti-OVA IgE antibody assay kit (Chondrex, Redmond, WA, USA) were also used in the study.

Generation of BMDCs

Bone marrow cells obtained from the femurs of naive BALB/c mice were cultured with 20 ng/ml murine granulocyte–macrophage colony-stimulating factor (GM-CSF) (PeproTech, Rocky Hill, NJ, USA) for 8 days. Non-adherent cells were harvested and pulsed with or without 100 ng/ml α-GalCer for 3 h, followed by a 6-h incubation with or without 1 mg/ml OVA in 24-well plates at 1 × 106 cells/well. These cells were stimulated with 10 μg/ml lipopolysaccharide (LPS) (O111:B4; Sigma-Aldrich) for 3 h and then washed three times with PBS. DCs were analysed based on surface markers using FACS analysis (FACSCalibur; Becton Dickinson, Franklin Lakes, NJ, USA).

Administration of BMDCs in OVA-sensitized mice

BALB/c mice were sensitized intraperitoneally with 100 μg of OVA and 2 mg of alum (Pierce, Rockford, IL, USA) once a week for 3 weeks. One week after the last sensitization, the mice (n = 5–6 in each group) received 5 × 106 cells of BMDCs in 100 μl of PBS to the sublingual submucosa by injection and were treated intranasally with 1 mg of OVA for 7 consecutive days (challenge group) or with PBS for 6 consecutive days followed by OVA on the seventh day (control group). After the last treatment, the behaviour of the mice was documented for 5 min using a videorecorder. Sneezing and nasal-rubbing events were counted by an investigator who was blinded to the treatment. The mice were then killed and the serum, cervical lymph nodes (CLNs) and spleens were collected.

Adoptive transfer of CD4+ T cells and B cells

CD4+ T cells and B cells were sorted from OVA-sensitized wild-type (WT) mice by negative selection using a magnetic affinity cell sorting (MACS) system (Miltenyi Biotec, Bergisch Gladbach, Germany). A single-cell suspension was prepared from spleens 22. After Fc blocking, splenic cells were incubated with a mixture of biotinylated antibodies, including anti-IgM (MA-69), anti-B220 (RA3-6B2), anti-CD11b (M1/70), anti-CD11c (N418), anti-TER-119 (TER-119), anti-Gr-1 (RB6-MC5) (BioLegend) or allophycocyanin-conjugated α-GalCer-loaded CD1d tetramer to collect CD4+ T cells, or with a mixture of biotinylated antibodies including anti-CD3 (145-2C11; BioLegend), anti-CD11b, anti-CD11c, anti-TER-119, anti-Gr-1 or allophycocyanin-conjugated α-GalCer-loaded CD1d tetramer to collect B cells. After washing, these cells were incubated with anti-biotin beads and anti-allophycocyanin-beads (Miltenyi Biotec) and then subjected to MACS analysis. The purity of the cells was analysed using FACSCalibur (BD Biosciences) and CellQuest software (Becton Dickinson). Data were analysed with FlowJo software (TreeStar, Ashland, OR, USA). The isolated CD4+ T cells (1 × 107 cells) and B cells (1·5 × 107 cells) were then transferred intravenously to WT or Jα18–/– mice. One day later, injection of BMDCs and nasal challenge were performed as described above.

Neutralization assay

Anti-mouse IL-21 antibody (TY25), rat IgG2a antibody (54447) (R&D Systems), anti-mouse IFN-γ antibody (R4-6A2) or rat IgG2a antibody (RTK2758) (BioLegend) (250 μg) was injected intravenously in OVA-sensitized mice 1 day before BMDC administration and on day 3 of nasal challenge.

Proliferation assay

CD4+ T cells isolated from CLNs were cultured with OVA and irradiated splenic feeder cells for 48 h, with tritium-labelled thymidine (37 kBq/well) added for the last 8 h. The cells were then harvested with a cell harvester (Perkin Elmer, Waltham, MA, USA) onto a β plate and the radioactivity was measured using a liquid scintillation counter (Perkin Elmer).

Restimulation of CD4+ T cells

Single-cell suspensions were prepared from CLNs and CD4+ T cells were sorted by the MACS technique using a biotinylated anti-CD4 antibody (GK1·5; BioLegend) and anti-biotin beads (Miltenyi Biotec). The cells were cultured for 48 h at a density of 1·5 × 105 cells/well in round-bottomed 96-well microculture plates in the presence of 1 mg/ml OVA with CD4+ T cell-depleted and irradiated splenic feeder cells (5 × 105 cells) obtained from naive mice. The concentration of cytokines in the supernatant was measured by ELISA.

Detection of IL-21-producing iNKT cells

IL-21-producing iNKT cells were detected by an enzyme-linked immunospot (ELISPOT) assay 21 with anti-mouse IL-21 antibody and biotinylated anti-mouse IL-21 antibody (mouse IL-21 DuoSet; R&D Systems, Minneapolis, MN, USA). A single-cell suspension was prepared from CLNs and spleens, as described above. Splenocytes were incubated with anti-FcγRII/III mAbs and depleted with biotinylated antibodies, including anti-IgM, anti-B220, anti-CD11b, anti-CD11c, anti-TER-119, anti-Gr-1 and anti-biotin beads, using the MACS technique. The enriched spleen cells were incubated with allophycocyanin-conjugated α-GalCer-loaded CD1d tetramer and splenic iNKT cells were sorted using FACS ARIA II (BD Biosciences). CLN cells (2 × 105 cells/well) were cultured with α-GalCer (100 ng/well) and splenic iNKT cells (5 × 104 cells/well) were co-cultured with BMDCs (5 × 104 cells per well) in 96-well filtration plates (Multiscreen; Millipore Corp., Bedford, MA, USA) for 3 days.

Real-time reverse transcription–polymerase chain reaction (RT–PCR)

Total RNA was extracted from CD4+ cells in CLNs using TRIzol reagent (Life Technologies, Gaithersburg, MD, USA) and reverse transcribed using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA). Relative gene expression was calculated by a sequence detection system (StepOnePlus™; Applied Biosystems) and the amount of cDNA was normalized using the beta-actin housekeeping gene. Primer sets (Table 1) were purchased from Eurofins Operon MWG (Ebersberg, Germany).

Table 1.

Polymerase chain reaction (PCR) primers used in the study

Primer set Sense primer, 5′–3′ Anti-sense primer, 5′–3′
Vα14 CACTGCCACCTACATCTGTGT AGTCCCAGCTCCAAAATGCA
IL-21 GCCAGATCGCCTCCTGATTA CATGCTCACAGTGCCCCTTT
Bcl6 CCGGCTCAATAATCTCGTGAA GGTGCATGTAGATGTGTGAGTGA
IL-17RA AGTGTTTCCTCTACCCAGCAC GAAAACCGCCACCGCTTAC
RORγt CTTTCAATACCTCATTGTAT AGGTCCTTCTGGGGGCTTGC
Beta-actin CCAGCCTTCCTTCTTGGGTAT TGGCATAGAGGTCTTTACGGATGT
Open in a new tab

IL = interleukin; RORγt = RAR-related orphan receptor gamma t.

Statistical analysis

Statistical analysis was performed using a two-tailed Student's t-test with P < 0·05 considered to be significant. Data are shown as the mean ± standard deviation.

Results

Characteristics of BMDCs

Surface marker expression levels on stimulated BMDCs were evaluated by FACS analysis prior to administration into AR mice. The percentage of CD11c+ cells in the generated BMDCs was approximately 95%. Based on the MHC class II levels, there were few differences among BMDCs cultured with medium, OVA, α-GalCer and OVA plus α-GalCer. Similar patterns were observed for the expression levels of CD40, CD80 and CD86 (Fig. 1).

Fig 1.

Fig 1

Open in a new tab

Similar expression levels of surface markers in each group of bone marrow-derived dendritic cells (BMDCs). BMDCs were incubated with medium only, ovalbumin (OVA), α-galactosylceramide (α-GalCer) or OVA/α-GalCer, followed by addition of lipopolysaccharide (LPS), and surface markers were analysed by fluorescence activated cell sorter (FACS). BMDCs were gated on CD11c+. Shaded profiles in the histograms show background staining with rat immunoglobulin (Ig)G2a. Data are representative of three independent experiments.

Oral submucosal administration of BMDCs in OVA-sensitized mice

On the 7th day of nasal challenge with OVA, mice administered OVA/α-GalCer-BMDCs showed significant decreases in the number of sneezing and nasal rubbing attacks, and in the levels of both OVA-specific and total IgE, compared with mice administered BMDCs. There were no significant differences in nasal symptoms and IgE levels among mice that received BMDCs, OVA-BMDCs or α-GalCer-BMDCs (Fig. 2a,b).

Fig 2.

Fig 2

Open in a new tab

Prevention of development of nasal allergic symptoms by administration of ovalbumin, α-galactosylceramide-bone marrow-derived dendritic cells (OVA, α-GalCer-BMDCs). (a) Number of sneezes and nasal rubs. (b) OVA-specific and total immunoglobulin (Ig)E levels in serum. (c,e) Cytokine production and proliferation of CD4+ T cells obtained from cervical lymph nodes (CLNs). Counts per minute, cpm. (d) Relative gene expression of CD4+ cells obtained from CLNs. Data are representative of three independent experiments. *P < 0·05; **P < 0·01.

Analysis of CD4+ T cells isolated from CLNs

Cytokine production by CD4+ T cells in CLNs is shown in Fig. 2c. Of the Th2 cytokines examined, IL-4, IL-5 and IL-13 levels were significantly lower in CD4+ T cells from mice that received OVA/α-GalCer-BMDCs compared with those from mice that received BMDCs or OVA-BMDCs. Enhanced IFN-γ production occurred in mice that received OVA/α-GalCer-BMDCs. Gene expression profiles from quantitative RT–PCR analysis (Fig. 2d) showed higher Vα14 and IL-21 expression in the CLNs of OVA/α-GalCer-BMDC-treated mice compared with other groups. However, expression of Bcl-6, a Tfh cell-related transcript, and Th17 cell-related transcripts such as IL-17RA and RORγt, did not differ among the groups. Proliferation of CD4+ T cells also showed no differences among the groups of mice (Fig. 2e).

Adoptive transfer of CD4+ T cells and B cells into Jα18–/– mice

Following adoptive cell transfer of CD4+ T cells (excluding iNKT cells) and B cells from spleen of OVA-sensitized WT mice, nasal symptoms after OVA challenge in WT mice were significantly suppressed by oral submucosal administration of OVA/α-GalCer-BMDCs compared with mice administered other BMDCs. However, similar suppression was not observed in Jα18–/– [iNKT knock-out (KO)] mice that received OVA/α-GalCer-BMDCs (Fig. 3).

Fig 3.

Fig 3

Open in a new tab

Suppression of nasal symptoms by ovalbumin, α-galactosylceramide-bone marrow-derived dendritic cells (OVA, α-GalCer-BMDCs) in an invariant natural killer T (iNKT) cell-dependent manner. (a) Protocol of adoptive transfer. (b) Splenic CD4+ T cells and B cells of OVA-sensitized mice were transferred after removal of iNKT cells. (c) Nasal symptoms after the final nasal challenge. Data are representative of three independent experiments. *P < 0·05; **P < 0·01.

IL-21-producing iNKT cells in CLNs

After stimulation with α-GalCer, IL-21-producing cells increased significantly in CLN cells of mice treated with OVA/α-GalCer BMDCs (Fig. 4a), whereas IL-21 was not detected in culture supernatants of CD4+ T cells (data not shown). To determine whether iNKT cells produce IL-21 in response to α-GalCer presented on BMDCs, splenic iNKT cells of naive mice were co-cultured with BMDCs plus α-GalCer. The results showed that OVA/α-GalCer BMDCs stimulated IL-21 production in iNKT cells (Fig. 4b).

Fig 4.

Fig 4

Open in a new tab

Increase of invariant natural killer T (iNKT) cells producing interleukin (IL)-21 in cervical lymph nodes (CLNs). (a) CLN cells were cultured with α-galactosylceramide (α-GalCer) and IL-21-secreting cells were detected using an enzyme-linked immunospot (ELISPOT) assay. (b) Splenic iNKT cells and bone marrow-derived dendritic cells (BMDCs) were co-cultured, and IL-21-secreting cells were detected by ELISPOT assay. Data are representative of three independent experiments. n.d. = not detected; *P < 0·05; **P < 0·01.

Treatment with anti-IL-21 or anti-IFN-γ neutralizing antibody

Treatment with anti-IL-21 mAb or anti-IFN-γ mAb and nasal challenge in OVA/α-GalCer BMDC-treated mice increased the number of sneezes and nasal rubs, compared with control mAb-treated mice (Figs 5a and 6a). OVA-specific and total IgE levels were increased by anti-IL-21 mAb, whereas only OVA-specific IgE was increased by anti-IFN-γ mAb (Figs 5b and 6b).

Fig 5.

Fig 5

Open in a new tab

Failure of ovalbumin, α-galactosylceramide-bone marrow-derived dendritic cells (OVA, α-GalCer-BMDCs) to suppress nasal symptoms by neutralization of interleukin (IL)-21. (a) Nasal symptoms were observed for 5 min after the final nasal challenge. (b) OVA-specific and total immunoglobulin (Ig)E levels in serum. Data are representative of three independent experiments. *P < 0·05; **P < 0·01.

Fig 6.

Fig 6

Open in a new tab

Failure of ovalbumin, α-galactosylceramide-bone marrow-derived dendritic cells (OVA, α-GalCer-BMDCs) to suppress nasal symptoms by neutralization of interferon (IFN)-γ. (a) Nasal symptoms were observed for 5 min after the final nasal challenge. (b) OVA-specific and total IgE levels in serum. Data are representative of three independent experiments. *P < 0·05; **P < 0·01.

Discussion

The goal of this study was to assess the anti-allergic effects of activated iNKT cells in CLNs, which are regional draining lymph nodes, in an AR mouse model. Single administration of OVA/α-GalCer-BMDCs into the oral submucosa of OVA-sensitized mice suppressed nasal symptoms and the level of OVA-specific IgE in association with IL-21 and IFN-γ in an iNKT cell-dependent manner. Other BMDCs failed to alleviate the Th2 responses and, therefore, the production of both OVA-specific and total IgE was up-regulated. These findings indicate that, if antigen stimulation is provided simultaneously, activated iNKT cells in CLNs can suppress a nasal allergic reaction by producing IL-21 and IFN-γ.

IL-21, a type I cytokine, prevents B cell proliferation and correspondingly augments B cell death under certain conditions 23–26. This cytokine is produced preferentially by activated iNKT cells and CD4+ T cells, including Tfh cells and Th17 cells 27–29. Expression of Bcl6, a Tfh cell-related transcript, and Th17 cell-related transcripts such as IL-17RA and RORγt, did not increase in this study; but Vα14, an iNKT cell-related transcript, was markedly up-regulated and IL-21-producing iNKT cells increased significantly in CLNs of mice treated with OVA/α-GalCer-BMDCs in the oral submucosa. In addition, a neutralization assay revealed that IL-21 plays a critical role in suppressing OVA-specific IgE production. These results are congruent with those reported by Hiromura et al. showing that intranasal administration of recombinant mouse IL-21 reduces nasal symptoms and the serum level of OVA-specific IgE 30.

The Th1/Th2 balance in CLNs changed towards a Th1-skewed phenotype after administration of OVA/α-GalCer-BMDCs. An IFN-γ neutralization indicated that this Th1 cytokine can play a pivotal role in suppressing the level of OVA-specific IgE. In type I allergic diseases, allergens trigger a Th2-dominant immune response that generates antigen-specific IgE-producing memory B cells, but the role of IFN-γ in IgE production remains unclear 31,32. Antigen-specific IgE is produced mainly in draining lymph nodes 21,33 and CLNs are regional lymph nodes from the oral cavity, as well as the nasal cavity 33,34. In the present study, treatment with anti-IFN-γ antibody exacerbated nasal symptoms and the OVA-specific IgE titre in mice treated with OVA/α-GalCer-BMDCs. These results suggest that IFN-γ exerts a potent inhibitory effect on IgE production in AR.

The role of iNKT cells in allergic reactions is unclear. These cells have been suggested to have a suppressive effect on allergic disease 19,20,31,35; however, other reports show that iNKT cells have an essential role in development of airway hyperreactivity 18,36,37. This plasticity of iNKT cells may arise partially from differences in systemic versus topical administration of α-GalCer and the diversity of APCs. In the present study, OVA/α-GalCer-BMDCs led to suppress OVA-induced nasal allergic symptoms and OVA-specific IgE production. These findings share some features with the previous report demonstrating that mice administered OVA/α-GalCer-BMDCs intratracheally prior to OVA challenge failed to develop airway hyperresponsiveness 38.

Brimnes et al. showed that repeated sublingual administration of OVA for 5 days each week for 9 weeks resulted in relief from nasal allergic symptoms in an AR mouse model 39. Direct administration of OVA and α-GalCer to the oral mucosa failed to have this effect because α-GalCer is not a water-soluble antigen and is not readily phagocytosed by oral dendritic cells. In the present study, α-GalCer-BMDCs did not exacerbate nasal allergic symptoms and simultaneous administration of OVA and α-GalCer using BMDCs led to efficient suppression of OVA-induced allergic reactions.

We have reported previously that DCs isolated from PBMCs of patients with head and neck cancer migrated to CLNs after oral submucosal administration 34, and we showed that this treatment was safe 40. Simultaneous administration of an antigen with α-GalCer-DCs is thus an accessible way to activate iNKT cells in regional lymph nodes; however, further studies are needed to clarify the role of activated iNKT cells in regional lymph nodes in treatment of AR.

In conclusion, oral submucosal administration of OVA/α-GalCer-pulsed BMDCs activated iNKT cells in CLNs and suppressed Th2 responses in OVA-sensitized mice. In the present study, simultaneous stimulation with antigen and α-GalCer were considered essential to exert anti-allergic effects and led to relief of nasal allergic symptoms. This finding indicates that the activated iNKT cells have the potential to alleviate nasal allergic symptoms in the presence of antigen. Thus, activation of iNKT cells in regional lymph nodes might be an important target in new treatment strategies for AR.

Acknowledgments

We appreciate all the help given by staff of Department of Otolaryngology and immunology of Chiba University. This work was supported by a grant-in-aid for research on allergic disease and immunology from the Ministry of Health, Labor, and Welfare in Japan, and grant-in-aid for the Global Center for Education and Research in Immune System Regulation and Treatment Program from Ministry of Education, Culture, Sports, Science and Technology (MEXT) in Japan.

Disclosure

The authors have no conflicts of interest to declare.

References

  1. Bousquet J, Dahl R, Khaltaev N. Global alliance against chronic respiratory diseases. Allergy. 2007;62:216–223. doi: 10.1111/j.1398-9995.2007.01307.x. [DOI] [PubMed] [Google Scholar]
  2. Bousquet J, van Cauwenberge P, Khaltaev N, Group AW, Organization WH. Allergic rhinitis and its impact on asthma. J Allergy Clin Immunol. 2001;108:S147–334. doi: 10.1067/mai.2001.118891. [DOI] [PubMed] [Google Scholar]
  3. Greiner AN, Hellings PW, Rotiroti G, Scadding GK. Allergic rhinitis. Lancet. 2011;378:2112–2122. doi: 10.1016/S0140-6736(11)60130-X. [DOI] [PubMed] [Google Scholar]
  4. Calderón MA, Casale TB, Togias A, Bousquet J, Durham SR, Demoly P. Allergen-specific immunotherapy for respiratory allergies: from meta-analysis to registration and beyond. J Allergy Clin Immunol. 2011;127:30–38. doi: 10.1016/j.jaci.2010.08.024. [DOI] [PubMed] [Google Scholar]
  5. Bousquet J, Lockey R, Malling HJ. Allergen immunotherapy: therapeutic vaccines for allergic diseases. A WHO position paper. J Allergy Clin Immunol. 1998;102:558–562. doi: 10.1016/s0091-6749(98)70271-4. [DOI] [PubMed] [Google Scholar]
  6. Di Bona D, Plaia A, Scafidi V, Leto-Barone MS, Di Lorenzo G. Efficacy of sublingual immunotherapy with grass allergens for seasonal allergic rhinitis: a systematic review and meta-analysis. J Allergy Clin Immunol. 2010;126:558–566. doi: 10.1016/j.jaci.2010.06.013. [DOI] [PubMed] [Google Scholar]
  7. Canonica GW, Bousquet J, Casale T, et al. Sub-lingual immunotherapy: World Allergy Organization Position Paper 2009. Allergy. 2009;64(Suppl 91):1–59. doi: 10.1111/j.1398-9995.2009.02309.x. [DOI] [PubMed] [Google Scholar]
  8. Radulovic S, Calderon MA, Wilson D, Durham S. Sublingual immunotherapy for allergic rhinitis. Cochrane Database Syst Rev. 2010;(12) doi: 10.1002/14651858.CD002893.pub2. CD002893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Di Bona D, Plaia A, Leto-Barone MS, La Piana S, Di Lorenzo G. Efficacy of subcutaneous and sublingual immunotherapy with grass allergens for seasonal allergic rhinitis: a meta-analysis-based comparison. J Allergy Clin Immunol. 2012;130:1097–1107. doi: 10.1016/j.jaci.2012.08.012. .e2. [DOI] [PubMed] [Google Scholar]
  10. Bendelac A, Savage PB, Teyton L. The biology of NKT cells. Annu Rev Immunol. 2007;25:297–336. doi: 10.1146/annurev.immunol.25.022106.141711. [DOI] [PubMed] [Google Scholar]
  11. Lantz O, Bendelac A. An invariant T cell receptor alpha chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4–8– T cells in mice and humans. J Exp Med. 1994;180:1097–1106. doi: 10.1084/jem.180.3.1097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Ikarashi Y, Iizuka A, Koshidaka Y, et al. Phenotypical and functional alterations during the expansion phase of invariant Valpha14 natural killer T (Valpha14i NKT) cells in mice primed with alpha-galactosylceramide. Immunology. 2005;116:30–37. doi: 10.1111/j.1365-2567.2005.02193.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Sonoda KH, Faunce DE, Taniguchi M, Exley M, Balk S, Stein-Streilein J. NK T cell-derived IL-10 is essential for the differentiation of antigen-specific T regulatory cells in systemic tolerance. J Immunol. 2001;166:42–50. doi: 10.4049/jimmunol.166.1.42. [DOI] [PubMed] [Google Scholar]
  14. Sharif S, Arreaza GA, Zucker P, et al. Activation of natural killer T cells by alpha-galactosylceramide treatment prevents the onset and recurrence of autoimmune Type 1 diabetes. Nat Med. 2001;7:1057–1062. doi: 10.1038/nm0901-1057. [DOI] [PubMed] [Google Scholar]
  15. Cui J, Shin T, Kawano T, et al. Requirement for Valpha14 NKT cells in IL-12-mediated rejection of tumors. Science. 1997;278:1623–1626. doi: 10.1126/science.278.5343.1623. [DOI] [PubMed] [Google Scholar]
  16. Kakimi K, Guidotti LG, Koezuka Y, Chisari FV. Natural killer T cell activation inhibits hepatitis B virus replication in vivo. J Exp Med. 2000;192:921–930. doi: 10.1084/jem.192.7.921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Taniguchi M, Harada M, Kojo S, Nakayama T, Wakao H. The regulatory role of Valpha14 NKT cells in innate and acquired immune response. Annu Rev Immunol. 2003;21:483–513. doi: 10.1146/annurev.immunol.21.120601.141057. [DOI] [PubMed] [Google Scholar]
  18. Akbari O, Stock P, Meyer E, et al. Essential role of NKT cells producing IL-4 and IL-13 in the development of allergen-induced airway hyperreactivity. Nat Med. 2003;9:582–588. doi: 10.1038/nm851. [DOI] [PubMed] [Google Scholar]
  19. Morishima Y, Ishii Y, Kimura T, et al. Suppression of eosinophilic airway inflammation by treatment with alpha-galactosylceramide. Eur J Immunol. 2005;35:2803–2814. doi: 10.1002/eji.200525994. [DOI] [PubMed] [Google Scholar]
  20. Hachem P, Lisbonne M, Michel ML, et al. Alpha-galactosylceramide-induced iNKT cells suppress experimental allergic asthma in sensitized mice: role of IFN-gamma. Eur J Immunol. 2005;35:2793–2802. doi: 10.1002/eji.200535268. [DOI] [PubMed] [Google Scholar]
  21. Inamine A, Sakurai D, Horiguchi S, et al. Sublingual administration of Lactobacillus paracasei KW3110 inhibits Th2-dependent allergic responses via upregulation of PD-L2 on dendritic cells. Clin Immunol. 2012;143:170–179. doi: 10.1016/j.clim.2012.01.008. [DOI] [PubMed] [Google Scholar]
  22. Kudlacz E, Conklyn M, Andresen C, Whitney-Pickett C, Changelian P. The JAK-3 inhibitor CP-690550 is a potent anti-inflammatory agent in a murine model of pulmonary eosinophilia. Eur J Pharmacol. 2008;582:154–161. doi: 10.1016/j.ejphar.2007.12.024. [DOI] [PubMed] [Google Scholar]
  23. Harada M, Magara-Koyanagi K, Watarai H, et al. IL-21-induced Bepsilon cell apoptosis mediated by natural killer T cells suppresses IgE responses. J Exp Med. 2006;203:2929–2937. doi: 10.1084/jem.20062206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Mehta DS, Wurster AL, Whitters MJ, Young DA, Collins M, Grusby MJ. IL-21 induces the apoptosis of resting and activated primary B cells. J Immunol. 2003;170:4111–4118. doi: 10.4049/jimmunol.170.8.4111. [DOI] [PubMed] [Google Scholar]
  25. Parrish-Novak J, Dillon SR, Nelson A, et al. Interleukin 21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature. 2000;408:57–63. doi: 10.1038/35040504. [DOI] [PubMed] [Google Scholar]
  26. Suto A, Nakajima H, Hirose K, et al. Interleukin 21 prevents antigen-induced IgE production by inhibiting germ line C(epsilon) transcription of IL-4-stimulated B cells. Blood. 2002;100:4565–4573. doi: 10.1182/blood-2002-04-1115. [DOI] [PubMed] [Google Scholar]
  27. Coquet JM, Kyparissoudis K, Pellicci DG, et al. IL-21 is produced by NKT cells and modulates NKT cell activation and cytokine production. J Immunol. 2007;178:2827–2834. doi: 10.4049/jimmunol.178.5.2827. [DOI] [PubMed] [Google Scholar]
  28. Ma J, Ma D, Ji C. The role of IL-21 in hematological malignancies. Cytokine. 2011;56:133–139. doi: 10.1016/j.cyto.2011.07.011. [DOI] [PubMed] [Google Scholar]
  29. Spolski R, Leonard WJ. Interleukin-21: basic biology and implications for cancer and autoimmunity. Annu Rev Immunol. 2008;26:57–79. doi: 10.1146/annurev.immunol.26.021607.090316. [DOI] [PubMed] [Google Scholar]
  30. Hiromura Y, Kishida T, Nakano H, et al. IL-21 administration into the nostril alleviates murine allergic rhinitis. J Immunol. 2007;179:7157–7165. doi: 10.4049/jimmunol.179.10.7157. [DOI] [PubMed] [Google Scholar]
  31. Cui J, Watanabe N, Kawano T, et al. Inhibition of T helper cell type 2 cell differentiation and immunoglobulin E response by ligand-activated Valpha14 natural killer T cells. J Exp Med. 1999;190:783–792. doi: 10.1084/jem.190.6.783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Shang XZ, Ma KY, Radewonuk J, et al. IgE isotype switch and IgE production are enhanced in IL-21-deficient but not IFN-gamma-deficient mice in a Th2-biased response. Cell Immunol. 2006;241:66–74. doi: 10.1016/j.cellimm.2006.07.011. [DOI] [PubMed] [Google Scholar]
  33. Shang XZ, Armstrong J, Yang GY, et al. Regulation of antigen-specific versus by-stander IgE production after antigen sensitization. Cell Immunol. 2004;229:106–116. doi: 10.1016/j.cellimm.2004.06.007. [DOI] [PubMed] [Google Scholar]
  34. Kurosaki M, Horiguchi S, Yamasaki K, et al. Migration and immunological reaction after the administration of αGalCer-pulsed antigen-presenting cells into the submucosa of patients with head and neck cancer. Cancer Immunol Immunother. 2011;60:207–215. doi: 10.1007/s00262-010-0932-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Matsuda H, Suda T, Sato J, et al. alpha-Galactosylceramide, a ligand of natural killer T cells, inhibits allergic airway inflammation. Am J Respir Cell Mol Biol. 2005;33:22–31. doi: 10.1165/rcmb.2004-0010OC. [DOI] [PubMed] [Google Scholar]
  36. Meyer EH, Goya S, Akbari O, et al. Glycolipid activation of invariant T cell receptor+ NK T cells is sufficient to induce airway hyperreactivity independent of conventional CD4+ T cells. Proc Natl Acad Sci USA. 2006;103:2782–2787. doi: 10.1073/pnas.0510282103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Bilenki L, Yang J, Fan Y, Wang S, Yang X. Natural killer T cells contribute to airway eosinophilic inflammation induced by ragweed through enhanced IL-4 and eotaxin production. Eur J Immunol. 2004;34:345–354. doi: 10.1002/eji.200324303. [DOI] [PubMed] [Google Scholar]
  38. Matsuda H, Takeda K, Koya T, et al. Plasticity of invariant NKT cell regulation of allergic airway disease is dependent on IFN-gamma production. J Immunol. 2010;185:253–262. doi: 10.4049/jimmunol.0902301. [DOI] [PubMed] [Google Scholar]
  39. Brimnes J, Kildsgaard J, Jacobi H, Lund K. Sublingual immunotherapy reduces allergic symptoms in a mouse model of rhinitis. Clin Exp Allergy. 2007;37:488–497. doi: 10.1111/j.1365-2222.2006.02624.x. [DOI] [PubMed] [Google Scholar]
  40. Okamoto Y, Fujikawa A, Kurosaki M, et al. Nasal submucosal administration of antigen-presenting cells induces effective immunological responses in cancer immunotherapy. Adv Otorhinolaryngol. 2011;72:149–152. doi: 10.1159/000324775. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES