Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2015 Mar 16;10(3):e0120464. doi: 10.1371/journal.pone.0120464

A Locked Nucleic Acid (LNA)-Based Real-Time PCR Assay for the Rapid Detection of Multiple Bacterial Antibiotic Resistance Genes Directly from Positive Blood Culture

Lingxiang Zhu 1,2, Dingxia Shen 3, Qiming Zhou 4, Zexia Li 2, Xiangdong Fang 1, Quan-Zhen Li 2,*
Editor: Bruno Verhasselt5
PMCID: PMC4361058  PMID: 25775001

Abstract

Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA)-based quantitative real-time PCR (LNA-qPCR) method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1–10 colony forming units (CFU) per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4%) were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.

Introduction

The spread of drug-resistant bacterial strains has become a great threat to public health [1]. The mechanism of drug resistance is related with the acquisition of enzymes that inactivate antibiotic molecules or target gene mutation. A series of drug resistance genes have been identified, including mecA, vanA, and vanB in gram-positive bacteria [2–4] and extended-spectrum β-lactamase (ESBL) genes, plasmid-acquired AmpC lactamases (pAmpC) genes [5,6], and carbapenemase genes [7–11] in gram-negative bacteria. The rapid and accurate detection of drug resistance genes prior to treatment is very important for the selection of effective antibiotics to control infection.

The traditional method for detecting drug-resistant bacterial strains is antimicrobial susceptibility testing (AST). This method is based on bacterial cultivation, which requires 1–3 days for a susceptibility report and is also labor—intensive and time consuming. Many molecular methods, such as multiplex PCR, real-time PCR or microarray assay, have emerged recently for the detection of antimicrobial resistance genes, including mecA [12], vanA or vanB [13–15], ESBLs or pAmpC [16–22], and carbapenemase genes such as bla KPC, bla NDM-1, bla VIM or bla IMP [23–27]. Although some of these assays have been used in clinical detection and diagnosis [14,21,28], little has been reported about the simultaneous detection of multiple drug resistance genes directly from positive blood culture. In this study, we developed a locked nucleic acid (LNA)-based quantitative real-time PCR assay (LNA-qPCR) [29] for the rapid detection of thirteen antibiotic resistance genes that confer drug resistance in most of the common clinical bacterial strains.

Materials and Methods

Bacterial strains and specimens

The reference strains used in this study are listed in Table 1, including 13 strains harboring resistance genes detected in the PCR assay, 14 strains containing resistance genes not detected in the PCR assay, and 13 frequently encountered bacterial species in the clinical setting. Most of the reference strains were purchased from American Type Culture Collection (Rockville, Maryland, USA), and two strains were purchased from HPA Culture Collections (London, United Kingdom). Moreover, one A. baumannii AC 54/97 strain harboring IMP-2 and one E. coli DH5α strain harboring the bla CTX-M-14 gene were kind gifts from Prof. Gian M Rossolini. Three clinical strains, one each harboring bla CTX-M-8, bla CTX-M-15, or bla CTX-M-16, were kind gifts from Prof. James H. Jorgensen. Four E. coli strains, J53–2/pMG229, J53–2/pUD18, J53–2/pUD21, and C1 NalR/pAFF2, harboring the bla SHV-2, bla SHV-3, bla SHV-4, bla SHV-5 genes, respectively, were kind gifts from Prof. George Jacoby.

Table 1. Reference strains in this study.

Species Strain No. Drug resistance gene
Staphylococcus aureus ATCC 43300 mecA
Enterococcus faecium ATCC 51559 vanA
Enterococcus faecalis ATCC 51299 vanB
Citrobacter freundii ATCC 8090 chromosomal AmpC (bla CMY-2)
Morganella morganii ATCC 25830 chromosomal AmpC (bla DHA-1)
Escherichia coli DH5α/bla CTX-M-14 bla CTX-M-14
Escherichia coli 03–1814 bla CTX-M-15
Acinetobacter baumannii AC-54/97 bla IMP-2
Klebsiella pneumoniae ATCC BAA-1705 bla KPC-2
Klebsiella pneumoniae ATCC BAA-2146 bla NDM-1
Acinetobacter baumannii NCTC 13301 bla OXA-23
Pseudomonas aeruginosa NCTC 13437 bla VIM-10
Escherichia coli DH5α/T-OXA-58 bla OXA-58
Escherichia coli ATCC 35218 bla TEM-1
Klebsiella pneumoniae ATCC 13883 bla SHV-1
Klebsiella pneumoniae ATCC 700603 bla SHV-18
Escherichia coli J53–2/pMG229 bla SHV-2
Escherichia coli J53–2/pUD18 bla SHV-3
Escherichia coli J53–2/pUD21 bla SHV-4
Escherichia coli C1 NalR/pAFF2 bla SHV-5
Klebsiella oxytoca 03–1921 bla CTX-M-16
Klebsiella pneumoniae 05–918 bla CTX-M-8
Pseudomonas aeruginosa ATCC 27853 chromosomal AmpC
Acinetobacter baumannii ATCC 19606 chromosomal AmpC
Serratia marcescens ATCC 8100 chromosomal AmpC
Enterobacter aerogenes ATCC 13048 chromosomal AmpC
Enterobacter cloacae ATCC 13047 chromosomal AmpC
Enterococcus casseliflavus ATCC 700327
Staphylococcus aureus ATCC 25923
Escherichia coli ATCC 25922
Klebsiella oxytoca ATCC 700324
Staphylococcus haemolyticus ATCC 29970
Staphylococcus epidermidis ATCC 12228
Enterococcus faecium ATCC 19434
Proteus mirabilis ATCC 7002
Proteus vulgaris ATCC 13315
Acinetobacter calcoaceticus ATCC 23055
Stenotrophomonas maltophilia ATCC 13637
Burkholderia cepacia ATCC 25416
Candida albicans ATCC 11006
Open in a new tab

Thirty-seven non-repetitive, phenotypically resistant clinical isolates and thirty-five phenotypically susceptible clinical isolates were selected to verify the LNA-qPCR assays. These strains were collected from General Hospital of PLA (Beijing, China) and isolated from diverse sources from clinical patients during routine care, including strains of Acinetobacter baumannii (n = 4), Escherichia coli (n = 22), Enterococcus faecalis (n = 1), E. faecium (n = 4), Klebsiella pneumoniae (n = 6), Pseudomonas aeruginosa (n = 11), Staphylococcus aureus (n = 6), S. epidermidis (n = 12), S. haemolyticus (n = 5) and S. hominis (n = 1). All isolates were identified to the species level using the Vitek-2 system (bioMe´rieux, Marcy l’Etoile, France). Antimicrobial susceptibility testing (AST) was performed by the agar disk diffusion method according to Clinical and Laboratory Standards Institute (CLSI) guidelines [30]. Enterobacteriaceae isolates were screened for ESBL production by the CLSI phenotypic confirmatory method using disks containing 30 μg of cefotaxime and 30 μg of ceftazidime alone and in combination with 10 μg of clavulanate [30]. The minimal inhibitory concentrations (MICs) of several antibiotics, including cefotaxime, ceftazidime alone or in association with clavulanate (4 μg/ml), imipenem, oxacillin, and vancomycin, were determined for the clinical isolates by the agar dilution method with Muëller-Hinton agar (Tiantan biotechnology Co., Ltd., Beijing, China) using an inoculum of 104 colony forming units (CFU) per spot [31].

In addition, 47 positive blood culture specimens were collected from General Hospital of PLA (Beijing, China) during the period of September 2011 to October 2011 for the detection of drug resistance genes using the LNA-qPCR assay. The samples from positive blood culture bottles were inoculated onto 5% sheep blood agar plates (BD Diagnostics, Sparks, MD) for primary isolation. Biochemical identification to the species level was performed using the Vitek-2 system (bioMe´rieux, France). Antimicrobial susceptibility testing was performed by the agar disk diffusion method according to CLSI guidelines [30]. E. coli ATCC25922, K. pneumoniae ATCC700603, P. aeruginosa ATCC27853, S. aureus ATCC25923 and ATCC 43300 were used as quality control strains for the AST experiments.

Primer design and LNA TaqMan probe selection

The target-specific sequences of the desired antibiotic resistance genes were obtained from GenBank, and the representative sequences are listed in S1 Table. The primers and LNA probes were designed by multiple alignment analysis of the varieties using CLUSTAL W and are listed in Table 2. Primers were synthesized by Integrated DNA Technologies (Coralville, IA). The LNA probes were selected from the Universal ProbeLibrary (Roche Applied Science) based on online ProbeFinder Assay Design Software (http://qpcr.probefinder.com/) and were ordered from Roche Applied Science. All the nucleotides in the LNA probes are LNA nucleotides. The uniqueness of the primer sequences designed based on each target gene was evaluated with a BLAST search. Some primer and probe sets were designed to detect PCR products containing major substitutions for the identification of various β-lactamases, as follows: bla CTX-M-1-group ESBLs including bla CTX-M-1, bla CTX-M-3, bla CTX-M-10–12, bla CTX-M-15, bla CTX-M-23, bla CTX-M-55, bla CTX-M-57 and bla CTX-M-79; bla CTX-M-9-group ESBLs including bla CTX-M-9, bla CTX-M-13–14, bla CTX-M-17–19 and bla CTX-M-21; bla CMY-2 group pAmpCs including bla CMY-2, bla CMY-3–7, bla CMY-12–18, bla CMY-20–41, bla CMY-43–44 and bla CMY-49; bla DHA-1 group pAmpCs including bla DHA-1–3, bla DHA-6 and bla DHA-7; the bla OXA-23 group including bla OXA-23 and bla OXA-27; the bla IMP group including bla IMP-2, bla IMP-8, bla IMP-19–20 and bla IMP-24; the bla VIM group including bla VIM-2–3, bla VIM-6, bla VIM-8–11, bla VIM-15–18 and bla VIM-23; the bla NDM-1 group including bla NDM-1 and bla NDM-2; and the bla KPC-2 group including bla KPC-2–10.

Table 2. Sequences of primers and LNA probes.

Target Gene LNA Probe No. LNA Probe Sequence a Primer Name Primer Sequence (5′-3′) Amplicon size (bp)
bla CTX-M-1 group #119 ttggtggt ctx-m-1-f TGGGTTGTGGGGGATAAA 77
ctx-m-1-r CGATCTTTTGGCCAGATCAC
bla CTX-M-9 group #119 ttggtggt ctx-m-9-f TACCGACGTCGTGGACTG 79
ctx-m-9-r GGCCAGATCACCGCAATA
bla CMY-2 #59 cagtggca cmy-f CTGGCCAGAACTGACAGGCA 68
cmy-r TAAGTGCAGCAGGCGGATA
bla DHA-1 #59 cagtggca dha-f TGCGGATCTGCTGMAYTTCTA 96
dha-r GCACCAAACAGGCCGATA
bla KPC-2 #40 gcctgctg kpc-f CTGTGCAGCTCATTCAAG 199
kpc-r CGGCGTTATCACTGTATTG
bla NDM-1 #56 ggacagca ndm-f TATCACCGTTGGGATCGAC 84
ndm-r AGATTGCCGAGCGACTTG
bla OXA-23 #56 ggacagca oxa-23-f CGTATTGGTTTCGGTAATGCT 70
oxa-23-r CCTTTAATGGTCCTACCAACCA
bla VIM-2 #9 tggtgatg vim-f TCTACCCGTCCAATGGTCTC 66
vim-r CCCACGCTGTATCAATCAAA
bla OXA-58 #9 tggtgatg oxa-58-f CAAGTGGTGGCATTTGCTT 94
oxa-58-r CCAACTTATCTAGCACATCTAAAGACA
bla IMP-2 #119 ttggtggt imp-f TTAACGGTTGGGGTGTTGTT 70
imp-r TCAATCAGATAGGCGTCAGTGT
mecA #150 gaacagca mecA-f TTTAGACCGAAACAATGTGGAA 65
mecA-r TTGGAACGATGCCTATCTCA
vanA #87 ggtggcag vanA-f CCCGCCTTTTGGGTTATTA 76
vanA-r CCGGCTTAACAAAAACAGGA
vanB #82 cagaggag vanB-f TTATAACCGTTCCCGCAGAC 62
vanB-r TTTTGCCGTTTCCTGTATCC
16S rRNA #69 ggaggaag 16S-Uf YAACGAGCGCAACCC 117
16S-Ur AAGGGSCATGATGAYTTGACG
Open in a new tab

a: The sequence of the LNA probe was completely shown and all the nucleotides in the LNA probe were LNA nucleotides.

DNA extraction

Bacterial DNA was extracted using a previously described rapid mechanical vortex method [29]. Briefly, 5 μl of positive blood culture sample was inoculated into 1 ml of TE (Tris-EDTA) buffer and mixed; 100 μl of the suspended cells was transferred into a lysis tube with glass beads (Sigma). The lysis tube was subjected to vortexing for 5 min at high speed, centrifuged briefly, and incubated at 95°C for 5 min to inactivate possible PCR inhibitors. The extracted DNA was stored at -20°C until use.

LNA-qPCR assay and data analysis

A panel of 11 LNA-qPCR assays was set up for the parallel detection of multiple drug resistance genes, including two assays (mecA and vanA/vanB genes) for gram-positive bacteria, eight assays (bla CTX-M-1 /bla CTX-M-9, bla CMY-2/bla DHA-1, bla KPC-2, bla NDM-1, bla OXA-23, bla OXA-58, bla VIM and bla IMP genes) for gram-negative bacteria, and one assay for the 16S rRNA gene as a positive external control. Positive (DNA mixtures with all the detected targets) and negative (sterilized water) PCR controls were prepared and included with each run.

The PCR reaction was optimized by testing different concentrations of each primer pair and the LNA probe, as well as the buffer component. Each PCR mixture (20 μl) contained 1× MasterMix (Applied Biosystems), with 5-carboxy-X-rhodamine succinimidyl ester (ROX) as an internal reference dye, deoxynucleoside triphosphates (including dUTP), and uracil-N-glycosylase. One microliter of lysate supernatant was added as a template. PCR was carried out using a 7900HT Fast Real-Time PCR System (Applied Biosystems) with two steps of amplification: an initial denaturation step at 94°C for 10 min, followed by 40 cycles of 94°C for 15 s and 60°C for 60 s.

The real-time PCR data were analyzed using ABI SDS2.3 software, and the average Ct (threshold cycle) value was generated for each sample. Based on our experiment with spike-in controls, a Ct value of 40 was set as a cut-off value for positivity. An assay was considered positive if the Ct value was less than 40. For each sample, 13 drug resistance genes and 16S rRNA gene were assayed in parallel. Samples with a Ct value below 40 for a resistance gene and the 16S rRNA gene were considered positive. Samples with a Ct value below 40 only for the 16S rRNA gene were also considered positive but without the detection of a resistance gene. Samples with a Ct value of 40 or higher for both a resistance gene and the 16S rRNA gene were considered negative. Samples with a Ct value below 40 for a resistance gene but with a Ct value of 40 or higher for the 16S rRNA gene were considered as uninterpretable.

The sensitivity of the LNA-qPCR assay was determined using serially diluted bacterial DNA from reference strains, which was spiked into pooled negative blood culture specimens. The concentration of microorganisms was determined and adjusted by standard counting of colony forming units (CFU) after plating suspensions on solid media. The spike-in concentrations were 5×105, 5×104, 5×103, 500 and 50 CFU/ml (equivalent to 104, 1000, 100, 10 and 1 CFU/reaction).

Sequencing analysis

The presence of drug resistance genes was examined by regular PCR and further confirmed by DNA sequencing. The primers used for the PCR and DNA sequencing analysis are shown in S2 Table. The amplified PCR products were purified using the QIAquick PCR Purification Kit (QIAGEN Sciences, Maryland), and direct sequencing of the purified PCR products was performed using the BigDye Terminator 3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA). Each sequence was then compared with known drug resistance gene sequences by multiple-sequence alignment using the BLAST program.

Results

Optimization and analytical sensitivity

The assays were designed for the parallel detection of 13 bacterial antibiotic resistance genes. After optimizing the amplification conditions for each assay, amplicons of the expected sizes were obtained by regular PCR from all reference strains, confirming the specificity of the primers (data not shown). The LNA-qPCR assay for each resistance gene was then optimized using different concentrations of the primers, probes, and BSA in the reaction mixture. The concentrations for the best detection limits were 200 nM for all LNA probes, 400 nM for all primer pairs (except for the vanA gene, which was 600 nM), and 0.5% bovine serum albumin (BSA) as the reliever of PCR inhibition.

Linear-regression curves were generated for the detection of the serially diluted bacterial strains at concentrations from 104 CFU to 1 or 10 CFU, and all strains showed a high correlation, with an R2 value of more than 0.97. The Ct and R2 values of each assay for the detection of different concentrations of bacterial strains are listed in S3 Table. All assays showed positive signals for the detection of bacterial cells at 10 CFU per reaction, with Ct value ranges of 16.0–35.9 and 16.6–34.5 for saline dilution experiments and negative blood culture spike-in experiments, respectively. When the bacterial concentration was diluted to 1 CFU per reaction, 8 assays (bla CTX-M-1 /bla CTX-M-9, bla CMY-2/bla DHA-1, bla KPC-2, bla NDM-1, bla OXA-58, bla IMP, mecA, vanA/vanB) showed positive signals. The bla VIM assay and bla OXA-23 assays did not show any positive signal in either the saline dilution or spike-in experiments. Therefore, the detection limits of all the assays were 1–10 CFU per reaction, which was similar for saline dilution and negative blood culture specimens. The Ct value was also comparable in the saline dilution and negative blood culture spike-in experiments, indicating that the blood culture medium has no significant effect on the analytical sensitivity of the real-time PCR assay. The three duplex PCR assays for vanA/vanB, bla CTX-M-1/bla CTX-M-9 and bla CMY-2/bla DHA-1 were able to detect 1 CFU per reaction, indicating the high amplification efficiency of these three duplex assays.

The specificity of LNA-qPCR

The specificity of the LNA-qPCR assay was tested on the 14 resistant reference bacterial strains containing other resistance genes (Table 1). No cross-reaction with bacterial DNA among the different strains was observed, and all assays were positive for the 16S rRNA gene. The specificity and cross-reaction were further tested on 13 ATCC strains harboring no drug resistance genes but reported to be associated with nosocomial infections (Table 1). None of these 13 ATCC strains showed any cross-reaction with the ten resistance gene-specific LNA-qPCR assays, and all gave positive signals for the 16S rRNA gene assay. Furthermore, specificity was tested using another 77 frozen, archived negative blood culture specimens, and no false positive result was detected, indicating 100% specificity for the LNA-qPCR assays.

Evaluation of LNA-qPCR using clinical isolates

To further verify the feasibility of the LNA-qPCR assay, 37 phenotypically resistant clinical isolates and 35 phenotypically susceptible clinical isolates were selected according to their phenotypic susceptibility profiles. DNA was extracted from a single colony picked from a solid medium plate. The results are shown in Table 3. All the isolates were positive for the external control (16S rRNA gene). All 35 susceptible isolates were negative for drug resistance genes by LNA-qPCR. Of the 37 drug-resistant clinical isolates, 27 were positive for one drug resistance gene, including bla CTX-M-1/9-type ESBL genes in gram-negative bacteria (10 E. coli, 2 K. pneumoniae), the mecA gene in gram-positive bacteria (n = 11), the bla CMY-2/bla DHA-1 gene (1 E. coli), the bla OXA-23 gene (2 A. baumannii), and the bla VIM-2 gene (1 P. aeruginosa). In addition, three strains harbored two different types of drug resistance genes, including one E. coli (bla CTX-M-1/9-type and bla CMY-2/bla DHA-1) and two A. baumannii strains (bla CTX-M-1/9-type and bla OXA-23; bla OXA-23 and bla OXA-58). The average Ct value range for these clinical isolates was 13.5–25.1. No bla NDM-1, bla KPC-2 or bla IMP-type carbapenemase genes or vanA or vanB gene were detected in the collected clinical isolates. All the LNA-qPCR results were confirmed by direct DNA sequencing, which showed that bla CTX-M-79 (4 strains), bla CTX-M-15 (4 strains), bla CTX-M-55 (2 strains), bla CTX-M-3 (1 strain), bla CTX-M-9 (2 strains) and bla CTX-M-14 (1 strain) accounted for the bla CTX-M type ESBLs, and bla CMY-2/bla DHA-1 type pAmpC were bla CMY-2 and bla DHA-1 (1 strain for each gene). Overall, the concordance between LNA-qPCR results and AST results was 81.1% (30/37). However, 4 carbapenem-resistant P. aeruginosa strains, 1 cephalosporin-resistant E. coli strain, 1 cephalosporin-resistant K. pneumoniae strain, and 1 oxacillin-resistant S. aureus strain were negative by the LNA-qPCR assay.

Table 3. Real-time PCR testing of 37 clinically phenotypically resistant isolates.

Resistance genes detected by PCR Clinical isolates Phenotypic susceptibility a DNA sequencing results
bla CMY-2 /bla DHA-1 1 E. coli CAZ R , CTX R , IMP S , MEM S bla DHA-1
bla CTX-M-1 /bla CTX-M-9 10 E. coli, 2 K. pneumoniae CAZS, CTX R , IMP S , MEM S CTX-M-79 (n = 4), -15 (n = 3), -55 (n = 1), -3 (n = 1), CTX-M-9 (n = 2) and-14 (n = 1)
  bla OXA-23 2 A. baumannii CAZ R , IMP R , MEM R bla OXA-23
  bla VIM-2 1 P. aeruginosa CAZ R , IMP R , MEM R bla VIM-2
  mecA 2 S. aureus, 4 S. haemolyticus, 5 S. epidermidis OXA R mecA
bla CMY-2 /bla DHA-1 and bla CTX-M-1 /bla CTX-M-9 1 E. coli CAZ R , CTX R bla CMY-2, CTX-M-15
bla CTX-M-1 /bla CTX-M-9 and bla OXA-23 1 A. baumannii CAZ R , IMP R , MEM R bla OXA-23, CTX-M-55
bla OXA-23 and bla OXA-58 1 A. baumannii CAZ R , IMP R , MEM R bla OXA-23, bla OXA-58
Not detected resistance gene 4 P. aeruginosa CAZ R , IMP R , MEM R
1 E. coli, 1 K. pneumoniae CAZ R , CTX R , IMP S , MEM S
1 S. aureus OXA R
Total 37
Open in a new tab

a: CAZ, ceftazidime; CTX, cefotaxime; IPM, imipenem; MEM, meropenem; OXA, oxacillin; VAN, vancomycin;

R: resistant;

S: susceptible.

Performance test for clinically positive blood culture

Forty-seven positive blood culture samples were analyzed by LNA-qPCR for the parallel detection of 13 drug resistance gene. The external control (16S rRNA gene) was positive for all the blood culture samples, with a Ct value range of 16.2–25.9, indicating that the positive blood culture contained bacterial DNA. The concordance between LNA-qPCR and AST are shown in Table 4, S4 and S5 Tables. The average Ct value range of the LNA-qPCR assay for the positive blood culture samples was 18.2–30.3 (S4 Table).

Table 4. Analysis of positive blood culture samples by real-time PCR.

Antibiotic resistance gene Blood culture Gram stain AST resistant and PCR positive AST susceptible and PCR negative Only PCR positive Only AST resistant Concordance [%]
ß-Lactamase genes a Gram-negative rods 9 (8 Eco, 1 Kpn) b 10(7 Eco, 3 Kpn) 1 (1 Kpn) 0 95.0 (19/20)
Carbapenemase genes Gram-negative rods 0 17 (12 Eco, 5 Kpn) 0 3 (3 Eco) 85.0 (17/20)
mecA gene Gram-positive cocci 6 (1 Sau, 3 Sep, 2 Sha) 12 (3 Sau, 5 Sep, 1Sho, 2 Efm, 1 Efs) 3 (3 Sep) 0 85.7 (18/21)
vanA / vanB gene c Gram-positive cocci 0 21 (2 Efm, 1 Efs, 18 Staph) 0 0 100 (21/21)
Total 15 60 4 3 91.5 (75/82)
Sensitivity 80.0%
Specificity 90.0%
Open in a new tab

Note: the positive blood culture samples containing P. aeruginosa are not included in Table 4.

a: ß-lactamase: bla CTX-M-1/bla CTX-M-9 ESBLs or bla CMY-2/bla DHA-1 pAmpC gene.

b: Eco, Escherichia coli; Kpn, Klebsiella pneumoniae; Pae: Pseudomonas aeruginosa; Sau, Staphylococcus aureus; Sep, S. epidermidis; Sha, S. haemolyticus; Sho, S. hominis, Efm, Enterococcus faecium; Efs, E. faecalis; and Staph, Staphylococcus.

c: vanA and vanB were not detected in the collected cultures.

Among 47 positive blood culture samples, 20 were identified as Enterobacteriaceae, including 15 E. coli and 5 K. pneumoniae. The LNA-qPCR results showed that nine samples (8 E. coli and 1 K. pneumoniae) contained bla CTX-M-1/9-type β-lactamase genes; one sample contained two types of β-lactamase genes (bla CTX-M-1/9-type and bla CMY-2/DHA-1-type), and other 10 samples did not contain any drug resistance genes. The LNA-qPCR results were 95% consistent with the results of phenotypic susceptibility for extended-spectrum cephalosporin resistance in Enterobacteriaceae, except that one K. pneumoniae strain harboring bla CTX-M-15 ESBL and bla DHA-1 pAmpC genes verified by DNA sequencing was susceptible to all the detected ß-lactam antibiotics, including ceftazidime and cefotaxime. For carbapenem resistance among Enterobacteriaceae, the concordance between real-time PCR results and traditional AST results was 85%. Three E. coli strains resistant to imipenem and/or meropenem were negative in LNA-qPCR (Table 4). In addition, six P. aeruginosa strains were identified from 47 positive blood culture samples. Among them, two P. aeruginosa strains resistant to ceftazidime, imipenem and meropenem were negative by LNA-qPCR.

Four S. aureus strains, 14 coagulase-negative staphylococci strains (including 11 S. epidermidis, 2 S. haemolyticus and 1 S. hominis), and three Enterococcus isolates (including two E. faecium and one E. faecalis) were subcultured and identified from 47 positive blood culture samples. Among them, nine samples (1 S. aureus, 6 S. epidermidis and 2 S. haemolyticus) contained mecA genes, though the other samples did not contain resistance genes, as detected by the LNA-qPCR assay. The LNA-qPCR results were 85.7% consistent with the susceptibility results for oxacillin resistance, except that 3 mecA-positive S. epidermidis samples were susceptible to oxacillin. Overall, the concordance between the LNA-qPCR assay and AST results was 91.5%. The sensitivity and specificity were 80% and 90.4%, respectively (Table 4).

Discussion

The rapid identification of drug resistance genes directly from positive blood cultures is critical for the selection of appropriate antibiotics for the treatment of nosocomial infections, especially sepsis. Traditional phenotypic susceptibility results usually take an additional 1–2 days after a blood culture is reported to be positive. Some rapid susceptibility testing assays, such as shortened incubation of susceptibility tests by microfluidic system [32] and the use of functional mass spectrometry assays [33], have been used to improve the speed of AST results. However, a growth-based method may in some instances not detect resistant pathogens, e.g. methicillin resistance in Staphylococcus when using oxacillin, due to the known heterogeneous expression of the mecA gene [34–36].

In this study, we developed an LNA-based quantitative PCR assay (LNA-qPCR) to detect 13 clinically prevalent and important antibiotic resistance genes in bacteria: mecA, vanA, vanB and the bla CTX-M-1 group, bla CTX-M-9 group, bla CMY-2 group, bla DHA-1 group, bla KPC-2 group, bla NDM-1 group, bla OXA-23 group, bla OXA-58, bla IMP group and bla VIM group. The reason for the selection of these thirteen antibiotic resistance genes is that these genes are the most important contributing factors to resistance against antibiotics and are the most common in bacteria found in Chinese hospitals [37–43]. It should be noted that there are other drug resistance genes, as well as other mechanisms of antimicrobial resistance. In the future, the detection panel will be expanded for the extensive detection of additional clinically important antibiotic resistance genes, such as bla OXA-48, bla SHV-2, bla SHV-5, and bla SHV-12 ESBLs. It would be convenient to add resistance genes to the detection panel. However, each adaptation of the panel will require the multiplex LNA-qPCR technique to be optimized and validated again, before clinical application is possible.

The LNA probes used in the LNA-qPCR are short (8–9 nt) LNA-modified nucleotides labeled with fluorescein and can be used as hydrolysis probes in real-time PCR. The LNA-qPCR assay can be performed using extracted DNA obtained directly from positive blood bottles. The overall consistency between phenotypic susceptibility and the LNA-qPCR assay was 81.1% and 91.5% for clinically resistant isolates and positive blood cultures, respectively. The main discrepancy is with regard to carbapenem-resistant isolates, though no carbapenemase genes were detected, especially for P. aeruginosa. In total, only one of seven carbapenem-resistant P. aeruginosa strains contained bla VIM-2, as detected by the LNA-qPCR assay. Moreover, three carbapenem-resistant E. coli strains were also negative by LNA-qPCR. In addition to carbapenemase, a carbapenem-resistant phenotype in Enterobacteriaceae can be caused by decreased outer membrane permeability, which usually results in imipenem resistance, with low resistance or susceptibility to meropenem [44]. We observed two such E. coli strains. In the case of P. aeruginosa, reduced susceptibility to carbapenem can be due to non-carbapenemase resistance mechanisms, including the up-regulation of multidrug efflux pump systems such as MexAB-OprM or the loss of the outer membrane porin OprD [45].

Other discrepancies between AST and LNA-qPCR occurred mainly with Enterobacteriaceae, including two cephalosporin-resistant clinical isolates that were PCR negative, and one E. coli strain harboring bla CTX-M-15 and bla DHA-1 (confirmed by DNA sequencing) was susceptible to all the detected antibiotics. Considering the inducibility of the DHA-type enzyme, a greater risk of a poor therapeutic outcome based on its apparent susceptibility may occur. Moreover, three mecA PCR-positive S. epidermidis isolates were susceptible to oxacillin, perhaps due to the heterogeneous expression of the mecA gene [34].

We further simplified the assays for the detection of drug resistance in gram-negative bacteria by performing multiplex reactions as follows: one quadruplex reaction (bla CTX-M-1 /bla CTX-M-9/bla CMY-2/bla DHA-1) and three duplex reactions (bla OXA-23/bla OXA-58, bla IMP/bla VIM, bla NDM-1/bla KPC-2). The sensitivity and specificity was not affected by using reference strains, and these assays can accurately detect the target drug resistance genes (data not shown). By the evaluation of multiplex reactions using 47 positive blood culture samples, we showed that these multiplex PCR results were consistent with those of singleplex PCR. Our novel assay will greatly simplify technical operations and will be cost-efficient and easy to use in traditional clinical laboratories. PCR-positive results can provide clues for narrowing antimicrobial therapy, though isolates containing a drug resistance gene can be susceptible in AST [46–49] which points to the need to perform phenotypic testing. Although PCR-negative results are be insufficient to guide initial targeted antibiotic therapy due to undetected antibiotic resistance, such negative PCR results can support antibiotic choice for certain species if the latter is identified by a rapid method such as PCR [29] or mass spectrometry assays [50,51].

In summary, we developed an LNA-qPCR assay for the rapid (within 2 hours) detection of multiple bacterial antibiotic resistance genes directly from positive blood cultures. The LNA-qPCR assays have the potential to be used in addition to conventional microbiological methods for clinical susceptibility testing.

Supporting Information

S1 Table. The GenBank accession numbers used in the study.

(DOCX)

Click here for additional data file. (15.6KB, docx)
S2 Table. The primer sequences used for PCR and DNA sequencing.

(DOCX)

Click here for additional data file. (13.5KB, docx)
S3 Table. The analytical sensitivity of LNA-qPCR assay.

(DOCX)

Click here for additional data file. (16.4KB, docx)
S4 Table. The information of 47 positive blood culture samples.

(DOCX)

Click here for additional data file. (16.9KB, docx)
S5 Table. Drug susceptibility in clinical isolates from 47 positive blood culture samples.

(XLSX)

Click here for additional data file. (23.8KB, xlsx)

Acknowledgments

We thank Gian M Rossolini, James H. Jorgensen, and George A. Jacoby and their teams for very kindly providing us certain bacterial reference strains. We also thank General Hospital of PLA for providing clinical isolates and blood culture samples.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This study was supported by the National Institutes of Health grant R03 AR055778 (http://grants.nih.gov/grants/funding/r03.htm) and the Nature Science Foundation of China (81270852) (http://www.nsfc.gov.cn/nsfc/cen/00/kxb/hxb/images/1000.htm). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Zhu L, Yan Z, Zhang Z, Zhou Q, Zhou J, Wakeland EK, et al. Complete genome analysis of three Acinetobacter baumannii clinical isolates in China for insight into the diversification of drug resistance elements. PLoS ONE. 2013;8: e66584 10.1371/journal.pone.0066584 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Hartman BJ, Tomasz A. Low-affinity penicillin-binding protein associated with beta-lactam resistance in Staphylococcus aureus . J Bacteriol. 1984;158: 513–516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Dutka-Malen S, Molinas C, Arthur M, Courvalin P. The VANA glycopeptide resistance protein is related to D-alanyl-D-alanine ligase cell wall biosynthesis enzymes. Mol Gen Genet. 1990;224: 364–372. [DOI] [PubMed] [Google Scholar]
  • 4. Wielders CL, Fluit AC, Brisse S, Verhoef J, Schmitz FJ. mecA gene is widely disseminated in Staphylococcus aureus population. J Clin Microbiol. 2002;40: 3970–3975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Rossolini GM D ‘Andrea MM, Mugnaioli C. The spread of CTX-M-type extended-spectrum beta-lactamases. Clin Microbiol Infect. 2008;14 Suppl 1: 33–41. [DOI] [PubMed] [Google Scholar]
  • 6. Jacoby GA. AmpC beta-lactamases. Clin Microbiol Rev. 2009;22: 161–182. 10.1128/CMR.00036-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, et al. Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 2009;53: 5046–5054. 10.1128/AAC.00774-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Queenan AM, Bush K. Carbapenemases: the versatile beta-lactamases. Clin Microbiol Rev. 2007;20: 440–458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Nordmann P, Poirel L, Carrer A, Toleman MA, Walsh TR. How to detect NDM-1 producers. J Clin Microbiol. 2011;49: 718–721. 10.1128/JCM.01773-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Walsh TR. Emerging carbapenemases: a global perspective. Int J Antimicrob Agents. 2010;36 Suppl 3: S8–14. 10.1016/S0924-8579(10)70004-2 [DOI] [PubMed] [Google Scholar]
  • 11. Alvargonzalez JJC, Hernando AV, Martín MDR, Casas CM, Iglesias JO, Marín MF, et al. Sequential outbreaks in a Spanish hospital caused by multiresistant OXA-58-producing Acinetobacter baumannii ST92. J Med Microbiol. 2014;63: 1093–1098. 10.1099/jmm.0.067280-0 [DOI] [PubMed] [Google Scholar]
  • 12. Zhu L, Zhang Z, Wang C, Yang H, Jiang D, Zhang Q, et al. Use of a DNA microarray for simultaneous detection of antibiotic resistance genes among staphylococcal clinical isolates. J Clin Microbiol. 2007;45: 3514–3521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Palladino S, Kay ID, Flexman JP, Boehm I, Costa AM, Lambert EJ, et al. Rapid detection of vanA and vanB genes directly from clinical specimens and enrichment broths by real-time multiplex PCR assay. J Clin Microbiol. 2003;41: 2483–2486. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Steindor M, Weizenegger M, Harrison N, Hirschl AM, Schweickert B, Göbel UB, et al. Use of a commercial PCR-based line blot method for identification of bacterial pathogens and the mecA and van genes from BacTAlert blood culture bottles. J Clin Microbiol. 2012;50: 157–159. 10.1128/JCM.06086-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Beal SG, Ciurca J, Smith G, John J, Lee F, Doern CD, et al. Evaluation of the nanosphere verigene gram-positive blood culture assay with the VersaTREK blood culture system and assessment of possible impact on selected patients. J Clin Microbiol. 2013;51: 3988–3992. 10.1128/JCM.01889-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Brolund A, Wisell KT, Edquist PJ, Elfstrom L, Walder M, Giske CG. Development of a real-time SYBRGreen PCR assay for rapid detection of acquired AmpC in Enterobacteriaceae . J Microbiol Methods. 2010;82: 229–233. 10.1016/j.mimet.2010.06.006 [DOI] [PubMed] [Google Scholar]
  • 17. Oxacelay C, Ergani A, Naas T, Nordmann P. Rapid detection of CTX-M-producing Enterobacteriaceae in urine samples. J Antimicrob Chemother. 2009;64: 986–989. 10.1093/jac/dkp336 [DOI] [PubMed] [Google Scholar]
  • 18. Zhu L, Zhang Z, Liang D, Jiang D, Wang C, Du N, et al. Multiplex asymmetric PCR-based oligonucleotide microarray for detection of drug resistance genes containing single mutations in Enterobacteriaceae . Antimicrob Agents Chemother. 2007;51: 3707–3713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Roschanski N, Fischer J, Guerra B, Roesler U. Development of a multiplex real-time PCR for the rapid detection of the predominant beta-lactamase genes CTX-M, SHV, TEM and CIT-type AmpCs in Enterobacteriaceae. PLoS ONE. 2014;9: e100956 10.1371/journal.pone.0100956 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Ellem J, Partridge SR, Iredell JR. Efficient direct extended-spectrum beta-lactamase detection by multiplex real-time PCR: accurate assignment of phenotype by use of a limited set of genetic markers. J Clin Microbiol. 2011;49: 3074–3077. 10.1128/JCM.02647-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Bogaerts P, Hujer AM, Naas T, de Castro RR, Endimiani A, Nordmann P, et al. Multicenter evaluation of a new DNA microarray for rapid detection of clinically relevant bla genes from beta-lactam-resistant gram-negative bacteria. Antimicrob Agents Chemother. 2011;55: 4457–4460. 10.1128/AAC.00353-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Dallenne C, Da Costa A, Decre D, Favier C, Arlet G. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae . J Antimicrob Chemother. 2010;65: 490–495. 10.1093/jac/dkp498 [DOI] [PubMed] [Google Scholar]
  • 23. Hindiyeh M, Smollan G, Grossman Z, Ram D, Robinov J, Belausov N, et al. Rapid detection of bla KPC carbapenemase genes by internally controlled real-time PCR assay using bactec blood culture bottles. J Clin Microbiol. 2011;49: 2480–2484. 10.1128/JCM.00149-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Ong DC, Koh TH, Syahidah N, Krishnan P, Tan TY. Rapid detection of the bla NDM-1 gene by real-time PCR. J Antimicrob Chemother. 2011;66: 1647–1649. 10.1093/jac/dkr184 [DOI] [PubMed] [Google Scholar]
  • 25. Naas T, Ergani A, Carrer A, Nordmann P. Real-time PCR for detection of NDM-1 carbapenemase genes from spiked stool samples. Antimicrob Agents Chemother. 2011;55: 4038–4043. 10.1128/AAC.01734-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Naas T, Cuzon G, Bogaerts P, Glupczynski Y, Nordmann P. Evaluation of a DNA microarray (Check-MDR CT102) for rapid detection of TEM, SHV, and CTX-M extended-spectrum beta-lactamases and of KPC, OXA-48, VIM, IMP, and NDM-1 carbapenemases. J Clin Microbiol. 2011;49: 1608–1613. 10.1128/JCM.02607-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Tojo M, Fujita T, Ainoda Y, Nagamatsu M, Hayakawa K, Mezaki K, et al. Evaluation of an automated rapid diagnostic assay for detection of Gram-negative bacteria and their drug-resistance genes in positive blood cultures. PLoS ONE. 2014;9: e94064 10.1371/journal.pone.0094064 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Grobner S, Dion M, Plante M, Kempf VA. Evaluation of the BD GeneOhm StaphSR assay for detection of methicillin-resistant and methicillin-susceptible Staphylococcus aureus isolates from spiked positive blood culture bottles. J Clin Microbiol. 2009;47: 1689–1694. 10.1128/JCM.02179-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Zhu L, Shen DX, Zhou Q, Liu CJ, Li Z, Fang X, et al. Universal Probe Library based real-time PCR for rapid detection of bacterial pathogens from positive blood culture bottles. World J Microbiol Biotechnol. 2014;30: 967–975. [DOI] [PubMed] [Google Scholar]
  • 30. CLSI. Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved Standard—Eleventh Edition CLSI document M02-A11. Wayne, PA: Clinical and Laboratory Standards Institute; 2012. [Google Scholar]
  • 31. CLSI. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; Approved Standard—ninth Edition CLSI document M07-A9. Wayne, PA: Clinical and Laboratory Standards Institute; 2012. [Google Scholar]
  • 32. Choi J, Jung YG, Kim J, Kim S, Jung Y, Na H, et al. Rapid antibiotic susceptibility testing by tracking single cell growth in a microfluidic agarose channel system. Lab Chip. 2013;13: 280–287. 10.1039/c2lc41055a [DOI] [PubMed] [Google Scholar]
  • 33. Machen A, Drake T, Wang YF. Same day identification and full panel antimicrobial susceptibility testing of bacteria from positive blood culture bottles made possible by a combined lysis-filtration method with MALDI-TOF VITEK mass spectrometry and the VITEK2 system. PLoS ONE. 2014;9: e87870 10.1371/journal.pone.0087870 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. He W, Chen H, Zhao C, Zhang F, Wang H. Prevalence and molecular typing of oxacillin-susceptible mecA-positive Staphylococcus aureus from multiple hospitals in China. Diagn Microbiol Infect Dis. 2013;77: 267–269. 10.1016/j.diagmicrobio.2013.07.001 [DOI] [PubMed] [Google Scholar]
  • 35. Saeed K, Ahmad N, Dryden M, Cortes N, Marsh P, Sitjar A, et al. Oxacillin-susceptible methicillin-resistant Staphylococcus aureus (OS-MRSA), a hidden resistant mechanism among clinically significant isolates in the Wessex region/UK. Infection. 2014;42: 843–847. 10.1007/s15010-014-0641-1 [DOI] [PubMed] [Google Scholar]
  • 36. Pu W, Su Y, Li J, Li C, Yang Z, Deng H, et al. High incidence of oxacillin-susceptible mecA-positive Staphylococcus aureus (OS-MRSA) associated with bovine mastitis in China. PLoS ONE. 2014;9: e88134 10.1371/journal.pone.0088134 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Ma L, Siu LK, Lin JC, Wu TL, Fung CP, Wang JT, et al. Updated molecular epidemiology of carbapenem-non-susceptible Escherichia coli in Taiwan: first identification of KPC-2 or NDM-1-producing E. coli in Taiwan. BMC Infect Dis. 2013;13: 599 10.1186/1471-2334-13-599 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Li B, Xu XH, Zhao ZC, Wang MH, Cao YP. High prevalence of metallo-β-lactamase among carbapenem-resistant Klebsiella pneumoniae in a teaching hospital in China. Can J Microbiol. 2014;60: 691–695. 10.1139/cjm-2014-0291 [DOI] [PubMed] [Google Scholar]
  • 39. Yang J, Ye L, Guo L, Zhao Q, Chen R, Luo Y, et al. A nosocomial outbreak of KPC-2-producing Klebsiella pneumoniae in a Chinese hospital: dissemination of ST11 and emergence of ST37, ST392 and ST395. Clin Microbiol Infect. 2013;19: E509–515. 10.1111/1469-0691.12275 [DOI] [PubMed] [Google Scholar]
  • 40. Zhou G, Guo S, Luo Y, Ye L, Song Y, Sun G, et al. NDM-1-producing strains, family Enterobacteriaceae, in hospital, Beijing, China. Emerg Infect Dis. 2014;20: 340–342. 10.3201/eid2002.121263 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Li Y, Guo Q, Wang P, Zhu D, Ye X, Wu S, et al. Clonal dissemination of extensively drug-resistant Acinetobacter baumannii producing an OXA-23 β-lactamase at a teaching hospital in Shanghai, China. J Microbiol Immunol Infect. 2014. [DOI] [PubMed] [Google Scholar]
  • 42. Ji S, Chen Y, Ruan Z, Fu Y, Ji J, Fu Y, et al. Prevalence of carbapenem-hydrolyzing class D β-lactamase genes in Acinetobacter spp. isolates in China. Eur J Clin Microbiol Infect Dis. 2014;33: 989–997. 10.1007/s10096-013-2037-z [DOI] [PubMed] [Google Scholar]
  • 43. Zhang C, Xu X, Pu S, Huang S, Sun J, Yang S, et al. Characterization of carbapenemases, extended spectrum β-lactamases, quinolone resistance and aminoglycoside resistance determinants in carbapenem-non-susceptible Escherichia coli from a teaching hospital in Chongqing, Southwest China. Infect Genet Evol. 2014;27: 271–276. 10.1016/j.meegid.2014.07.031 [DOI] [PubMed] [Google Scholar]
  • 44. Pasteran F, Lucero C, Soloaga R, Rapoport M, Corso A. Can we use imipenem and meropenem Vitek 2 MICs for detection of suspected KPC and other-carbapenemase producers among species of Enterobacteriaceae? J Clin Microbiol. 2011;49: 697–701. 10.1128/JCM.01178-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Livermore DM. Multiple mechanisms of antimicrobial resistance in Pseudomonas aeruginosa: our worst nightmare? Clin Infect Dis. 2002;34: 634–640. [DOI] [PubMed] [Google Scholar]
  • 46. Morrissey I, Bouchillon SK, Hackel M, Biedenbach DJ, Hawser S, Hoban D, et al. Evaluation of the Clinical and Laboratory Standards Institute phenotypic confirmatory test to detect the presence of extended-spectrum β-lactamases from 4005 Escherichia coli, Klebsiella oxytoca, Klebsiella pneumoniae and Proteus mirabilis isolates. J Med Microbiol. 2014;63: 556–561. 10.1099/jmm.0.068981-0 [DOI] [PubMed] [Google Scholar]
  • 47. McWilliams CS, Condon S, Schwartz RM, Ginocchio CC. Incidence of extended-spectrum-β-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates that test susceptible to cephalosporins and aztreonam by the revised CLSI breakpoints. J Clin Microbiol. 2014;52: 2653–2655. 10.1128/JCM.03613-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Gupta G, Tak V, Mathur P. Detection of AmpC β Lactamases in Gram-negative Bacteria. J Lab Physicians. 2014;6: 1–6. 10.4103/0974-2727.129082 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Chaudhary M, Payas A. False susceptibility of antibitoics to carbapenemase producers and means to overcome. IOSR J Pharm Biol Sci (IOSR-JPBS). 2014;9: 155–161. [Google Scholar]
  • 50. Fothergill A, Kasinathan V, Hyman J, Walsh J, Drake T, Wang YF. Rapid identification of bacteria and yeasts from positive-blood-culture bottles by using a lysis-filtration method and matrix-assisted laser desorption ionization-time of flight mass spectrum analysis with the SARAMIS database. J Clin Microbiol. 2013;51: 805–809. 10.1128/JCM.02326-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Foster AG. Rapid Identification of microbes in positive blood cultures by use of the vitek MS matrix-assisted laser desorption ionization-time of flight mass spectrometry system. J Clin Microbiol. 2013;51: 3717–3719. 10.1128/JCM.01679-13 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. The GenBank accession numbers used in the study.

(DOCX)

Click here for additional data file. (15.6KB, docx)
S2 Table. The primer sequences used for PCR and DNA sequencing.

(DOCX)

Click here for additional data file. (13.5KB, docx)
S3 Table. The analytical sensitivity of LNA-qPCR assay.

(DOCX)

Click here for additional data file. (16.4KB, docx)
S4 Table. The information of 47 positive blood culture samples.

(DOCX)

Click here for additional data file. (16.9KB, docx)
S5 Table. Drug susceptibility in clinical isolates from 47 positive blood culture samples.

(XLSX)

Click here for additional data file. (23.8KB, xlsx)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES