Skip to main content
PLOS One logoLink to PLOS One
. 2015 Mar 16;10(3):e0118668. doi: 10.1371/journal.pone.0118668

Non-Protein Coding RNA Genes as the Novel Diagnostic Markers for the Discrimination of Salmonella Species Using PCR

Ravichantar Nithya 1, Siti Aminah Ahmed 1, Chee-Hock Hoe 1, Subash C B Gopinath 1,2,*, Marimuthu Citartan 1, Suresh V Chinni 3, Li Pin Lee 1, Timofey S Rozhdestvensky 4, Thean-Hock Tang 1,*
Editor: Baochuan Lin5
PMCID: PMC4361174  PMID: 25774907

Abstract

Salmonellosis, a communicable disease caused by members of the Salmonella species, transmitted to humans through contaminated food or water. It is of paramount importance, to generate accurate detection methods for discriminating the various Salmonella species that cause severe infection in humans, including S. Typhi and S. Paratyphi A. Here, we formulated a strategy of detection and differentiation of salmonellosis by a multiplex polymerase chain reaction assay using S. Typhi non-protein coding RNA (sRNA) genes. With the designed sequences that specifically detect sRNA genes from S. Typhi and S. Paratyphi A, a detection limit of up to 10 pg was achieved. Moreover, in a stool-seeding experiment with S. Typhi and S. Paratyphi A, we have attained a respective detection limit of 15 and 1.5 CFU/mL. The designed strategy using sRNA genes shown here is comparatively sensitive and specific, suitable for clinical diagnosis and disease surveillance, and sRNAs represent an excellent molecular target for infectious disease.

Introduction

Non-protein coding RNAs (npcRNAs or sRNAs) are RNA transcripts capable of performing specific functions but are not translated into protein. sRNAs have been found to play crucial roles in regulating DNA replication, transcription, and mRNA stability [1, 2]. By different experimental strategies, large numbers of sRNA candidates have been identified and shown to be involved in the pathogenesis and cellular regulation [3–7]. Human pathogens including Helicobacter pylori [8] and Vibrio cholerae [9, 10] have been the subject of immense interest towards the discovery of sRNAs. Previous studies carried out by our group have lead to the discovery of 97 sRNAs from the human pathogen Salmonella Typhi, a causative agent of salmonellosis [11].

Salmonellosis a communicable disease caused by Salmonella species, remains a constant and non-negligible threat to humans and animals. Exposure to Salmonella pathogens is prevalent in a region with poor hygiene/sanitation and improper water treatment. Infection typically occurs through the consumption of Salmonella-contaminated food, causing typhoid fever, paratyphoid fever, and non-typhoidal infections [12]. Typhoid/enteric fever is a systemic illness caused by Salmonella enterica serovar Typhi (S. Typhi) and S. enterica serovar Paratyphi A (S. Paratyphi A). Globally, S. Typhi and S. Paratyphi A account for more than 21.7 million and 5.4 million infections per year, respectively [12]. These pathogens cause severe health problems and the mortality rate of typhoid fever is 10–30%, mainly among children below 5 years of age [13–16]. Unfortunately, there is no current paratyphoid vaccine, and administration of S. Typhi vaccine provides little to no protection against S. Paratyphi A [17, 18]. Therefore, there is a fundamental need to develop a rapid diagnostic test for acute clinical management, contact tracing, and identification of convalescent/chronic fecal carriers. Most importantly, detection and differentiation of S. Typhi and S. Paratyphi A is required for more effective vaccine administration.

Among several proposed diagnostic tests, protein-coding sequence based PCR-amplification is predominantly used, especially for bacterial detections [19]. Sensitivities of 1.8 pg and 1 x 103 of leptospires/mL were achieved via PCR amplification by Ahmed et al. [20]. Similarly, Tang et al [21] have demonstrated sensitivity and specificity of 93.1% and 89.6%, respectively, using multiplex polymerase chain reaction (mPCR) amplification in detecting M. tuberculosis. On the other hand, a series of sRNAs were discovered in a number of microorganisms that harbour potential diagnostic markers [10]. Chinni et al. have reported the discovery of distinct species-specific sRNAs in Salmonella [11]. The specificity of these sRNAs for certain Salmonella species, including S. Typhi and S. Paratyphi A, suggest that they might be a potential target for diagnostics. In the present study, we have designed suitable sequences to selectively amplify the sRNAs by mPCR for the detection and differentiation of salmonellosis to be used as molecular markers for the diagnosis of infectious disease.

Materials and Methods

Bacterial isolates and genomic DNA extraction

Twenty-two Salmonella species and 15 other bacterial strains (Gram-negative and Gram-positive) were obtained from both the Veterinary Research Institute, Ipoh, Malaysia and Advanced Medical and Dental Institute, Universiti Sains Malaysia. Genomic DNA extraction was performed using an in-house protocol. In brief, the bacterial strains were cultured in Luria–Bertani (LB) broth for 16 h (37°C, 200 rpm). Subsequently, 1.5 mL of each culture was centrifuged (13,000 rpm, 1 min), and the supernatants were discarded. The pellets were resuspended in 200 μL of Solution I (20% sucrose, 50 mM Tris-HCl [pH 8.0], 1% SDS, 0.2 M NaOH, 25 mM EDTA [pH 8.0], and 0.1 M NaCl), which was followed by addition of 200 μL of Solution II (3 M sodium acetate, pH 6.4). The tubes were gently inverted, incubated for 5 min at room temperature, and centrifuged (13,000 rpm, 5 min). The supernatants containing DNA were then transferred to fresh tubes. One mL of 100% ethanol was added to each tube, followed by 40 μL of 3 M sodium acetate (pH 5.2) to precipitate the genomic DNA. The tubes were then incubated at—80°C for 20 min and centrifuged (13,000 rpm at 4°C, 13 min). The DNA pellets were washed with 1 mL of 70% ethanol, air-dried, and dissolved in 50 μL sterile distilled water.

Strategy for PCR-based diagnostic targeting of sRNA genes for the detection and differentiation of salmonellosis

The mPCR was designed to amplify three sRNA genes (StyR-3, StyR-36, StyR-143) and a control plasmid DNA. StyR-3 is present in all Salmonella species. StyR-36 is S. Typhi specific, whereas StyR-143 are shared by S. Typhi and S. Paratyphi A. Thus, in cases of S. Typhi infection, StyR-3, StyR-36 and StyR-143 should be amplified, whereas only StyR-3 and StyR-143 should be detected in S. Paratyphi A-infected samples. To rule out false negative results due to the presence of PCR inhibitors, an internal amplification control (IAC) plasmid (pL50) that yields a 650bp product was included in the reactions.

mPCR amplification and PCR product analysis

PCR amplification was performed in a 20 μL reaction volume, which contained the following: 0.25 μM each forward and reverse primer for StyR-3, StyR-36, StyR-143, as well as pL50 (Bio Basic Inc., Toronto, Canada); 200 μM dNTPs; 3 mM MgCl2; 2 U Taq DNA polymerase (Biotools, Spain) in 1X PCR buffer (10 mM Tris-HCl, [pH 8.3], 50 mM KCl). For template DNA, we used 1 μL (100 ng) of genomic DNA extracted from bacterial cultures or 2 μL of DNA extracted from spiked stool samples. PCR was performed in a Bio-RAD (USA) thermocycler with an initial denaturation at 95°C for 1 min, followed by 30 amplification cycles (30 s denaturation at 95°C, 30 s annealing at 66°C, 30 s extension at 72C), and a final elongation of 2 min at 72°C. The PCR products were analyzed by electrophoresis using a 2% agarose gel in TAE buffer (40 mM Tris acetate, 1 mM EDTA [pH 8.0]) containing 0.5 μg/mL of ethidium bromide. The PCR reaction products (20 μL) were electrophoresed at 60 V for 60 min and visualized using a gel-imaging system (Bio-RAD, USA).

Optimization of the mPCR

Optimization of the mPCR was carried out to maintain a balanced amplification of all the targeted regions of the genomic DNA. To begin with, a range of annealing temperature from 60 to 70°C was used for the amplification. To optimize the concentration of MgCl2, different concentrations used were within the range from 0.5 to 4.5 mM, in increments of 0.5 mM. Taq Polymerase optimization was also carried out, whereby different amounts of 1.0, 1.5, 2.0 and 2.5 units were employed for amplification.

Sensitivity and specificity of the mPCR assay

We used 37 different bacterial strains to assess the analytical specificity of the optimized mPCR assay. The analytical sensitivity represents the lowest concentration of template DNA that can be amplified to produce visible bands upon gel electrophoresis. To determine assay sensitivity, genomic DNA from S. Typhi, S. Paratyphi A, and S. Paratyphi B (i.e., non-S. Typhi and non-S. Paratyphi A) was extracted and serially diluted 10-fold. An artificial stool contamination experiment (stool spiking) was also carried out based on a method described by Kongmoung et al. [22], with slight modification. Single colonies of S. Typhi and S. Paratyphi A were inoculated and grown overnight in LB broth. The bacterial cultures were adjusted to 0.5 of MacFarland turbidity standard, which is equivalent to 1.5 x 108 CFU/mL. A ten-fold serial dilution was performed, and 1 mL of each dilution was spiked into 0.2 g of healthy human stool (confirmed to be Salmonella negative through culturing). The infected feces were then mixed with 9 mL of selenite cysteine broth. The spiked stool samples (before and after enrichment) were processed for PCR amplification. In brief, 1.5 mL of each spiked stool sample was centrifuged (13,000 rpm, 1 min). The supernatants were then discarded, and the pellets were washed with 500 μL of 0.01 M phosphate-buffered saline (PBS). Next, 50 μL of chelex slurry (10% 200–400 mesh, Bio-RAD, USA) was added and boiled for 10 min. Following centrifugation (13,000 rpm, 15 min), 2 μL of each of the supernatants was used as template in the mPCR assay.

Results and Discussion

Small non-protein coding RNAs are ~18–500 nts long, untranslated RNAs that participate in various cellular processes, from housekeeping to virulence and pathogenesis. Moreover, some of these molecules have been suggested as molecular markers of genetic diseases and cancer [23–30]. Although growing evidence has indicated that sRNAs can serve as biological markers for human diseases, investigation into the use of small sRNAs as targets for the diagnosis of infectious agents has not been explored exhaustively.

Previous PCR-based assays for diagnosing salmonellosis chiefly have been based on the detection of protein-coding genes or 16S rRNA genes [31–35]. In the present study, we have demonstrated the efficacy of using sRNA genes as molecular targets for detecting and differentiating S. Typhi and S. Paratyphi A. Specifically, we have tested three previously identified sRNA candidates as potential markers for Salmonella infection. Notably, these sRNAs have been reported to be specific for all-Salmonella species, S. Typhi only, or both S. Typhi and S. Paratyphi A. Taking advantage of the differing specificities of these sRNA gene candidates, we were able to detect salmonellosis and further differentiate S. Typhi and S. Paratyphi A by mPCR assay.

Selection of the candidate sRNA diagnostic markers and development of the mPCR assay

To investigate the efficacy of using sRNA genes as molecular markers for salmonellosis, three sRNA genes (StyR-3, StyR-36, StyR-143) were selected for mPCR development (Table 1). StyR-3 (GenBank accession no: FJ746361.1) [11] is a promoter-associated sRNA gene that is co-transcribed with the ramA gene (mediates multidrug resistance) and overlaps with the DNA binding site of the RamR repressor (Fig. 1a). The 144-nt StyR-3 RNA was shown to be present in all Salmonella species via bio-computational analysis. On the other hand, StyR-36 (175 nt) is present only in S. Typhi and located between nucleotides 2746553 and 2746379 overlapping the 5’-UTR of hypothetical protein-coding t2658 gene (S. typhi Ty2 genome GenBank accession no: AE014613) [36] (Fig. 1b). Therefore, detection of StyR-36 in our mPCR assay specifically indicates S. Typhi infection. The third biomarker candidate analyzed in this study was StyR-143 (144 nt) (GenBank accession no: FJ746389.1) [11], which is present in both S. Typhi and S. Paratyphi A. StyR-143 is antisense to the 3'-end of the open reading frame (ORF) of the hypothetical protein-coding t4293 gene (Fig. 1c). Using mfold programme, the secondary structures of the sRNAs were predicted (1d-f).

Table 1. StyR-3, StyR-36 and StyR-143 sRNA gene sequences.

sRNA gene candidates Sequence (5’–3’)
StyR-3 TTACTCACTCATAATCAAGGGCTGCCGCATGAAGTGGTAGAAAAGCATATTGCAGGCCATGCGATAAGCCGTCTCACAATTTGTGTGGTTATTACTATGCTTATTGCTGTTGCCGTAAATGTGCGGTGCGGGAGCCGCTGACGA
StyR-36 CCATGCGCTTGCGCTAAGAGACGTCAGGTATCTATGGAGGAACAAGTTATGGATACAAACGAACTTGGCTTAGTTAAGGCGCGTGTTGAACTGATCACCGCTATGCTCAAATGCGCAACCGCGTTTGTTGGCTTAGTTGGTGCGGTTTACGCCGTTCTTAACATGGCCTTCAACT
StyR-143 ATTCTTACTCAAAAAGACAAGGGAGGAATGCCGCAAGAAACCAAAGAAAATCATGGGTTTCATTAAACTTCATTATTGAAGAGGTTTAATAAAGCTGGTTCTATAGGTGCGCGCCTGCTCGTCTTTCATTGTGCCAGCTTTTCT

Fig 1. Genomic location and predicted secondary structures of non-protein coding RNAs.

Fig 1

(a-c) Schematic representations of S. typhi sRNA genes. Coordinates of depicted genes are based on the completed genome of S. typhi Ty2 (AE014613). Drawings are not according to scale. (d-f) Predicted secondary structures of StyR-3, StyR-36 and StyR-143 sRNAs, respectively using mfold programme.

Subsequent to this, the analyses of GC content of these sRNA genes were also computed. The percentage of GC content is 47.91, 39.58 and 48.58% for StyR-3, StyR-143 and StyR-36, respectively. This implies the high efficiency of PCR amplification associated with these genes, as the PCR amplification efficiency increases with lower GC content (less than 50%). PCR amplification of the 475bp product that corresponds to the StyR-3 gene indicates the presence of Salmonella species within the sample, whereas detection of the StyR-143 band (304bp) demonstrates the presence of S. Typhi and/or S. Paratyphi A. S. Typhi can be specifically identified through a 204bp product, which is amplified from the S. Typhi-specific StyR-36. Our strategy for differentiating S. Typhi and S. Paratyphi A is based on the fact that the StyR-3, StyR-143 and StyR-36 bands should be detected for S. Typhi-infected samples (475bp, 304bp and 204bp bands, respectively). However, in the case of S. Paratyphi A infection, only the 475bp (StyR-3) and 304bp bands (StyR-143) should be observed.

Furthermore, to rule out false negative results due to the presence of PCR inhibitors, an IAC plasmid was incorporated into the PCR to yield a 650bp product (Table 2). PCR inhibitors (such as bilirubin and bile salts) are known to be present in fecal samples. For this reason, we utilized a 10% chelex solution during genomic DNA extraction. Chelex prevents DNA degradation and removes PCR inhibitors from samples to avoid false negative results [37]. Fig. 2 summarized the PCR strategy used in this study.

Table 2. Primers used in the mPCR.

Target gene Primer nameSequence (5’–3’) Target serovars Amplicon size (bp)
StyR-3 StyR-3 F
ACCTTTGAAAAGTACCTTGACGGCGTAC
StyR-3 R
GCTGCGAATCAAAACCATACTTGAGACC
Salmonella genus 475
StyR-36 StyR-36 F
TGCCATGTAATCGGACGCCGAC
StyR-36 R
AGCCAACAAACGCGGTTGCG
Salmonella Typhi 204
StyR-143 StyR-143 F
CGCTCCTCCACATCCAACAGTGAG
StyR-143 R
ATGAACAAGTGGAAACCTGGCACG
Salmonella Typhi and Salmonella Paratyphi A 304
Plasmid pL50 L50F
GTCTACCAGGCATTCGCTTCAT
L50R
CTGTGAATGCTGCGACTACGAT
Internal Amplification Control 650

Fig 2. Summarized strategy of mPCR.

Fig 2

Overnight cultures of the bacterial strains were subjected to (i) genomic DNA extraction to determine specificity and sensitivity of the mPCR assay (ii) determination of detection limit in spiked fecal samples. Following genomic DNA extraction, PCR amplification was carried out using primers designed based on pL50 (IAC), StyR-3, StyR-143 and StyR-36 genes and analyzed by gel electrophoresis.

Standardization of mPCR

mPCR consists of one or more different amplicon systems combined in a single run. Hence, the parameters chosen must be optimal to ensure an even amplification efficiency for all the systems involved. An important criterion in developing mPCR is annealing temperature optimization. In this study, the mPCR developed involves the annealing of three different sets of primers against the genomic DNA template. The result showed that the optimum annealing temperature for amplification of all primers was 66°C, which is the highest temperature of the range from 60 to 66°C (lane 4, Fig. 3a). Compared to uniplex PCR analysis, mPCR is associated with higher concentration of MgCl2, as more primers used requires even more extensive neutralization action of the phosphate group's negative charges by Mg2+ ions. In this study, optimization of PCR was carried out with different concentrations of magnesium chloride from 0.5mM to 4.5mM. An even amplification was observed from 2.5mM to 4.5mM (lane 5–9, Fig. 3b) while concentrations lower than 2.5mM showed an uneven amplification of the targets (lane 1–4, Fig. 3b). The optimal MgCl2 concentration for this mPCR was determined to be 3mM (lane 6, Fig. 3b). This value was chosen over the other values as too much of free Mg2+ may increase nonspecific products. Although this concentration produced similar amplification efficiency compared to 2.5mM, 3.0mM was chosen, taking into consideration of the incorporation of IAC in the future. This value is also in concordance with several studies that involves mPCR [38–41]. Subsequent to this, optimization of Taq polymerase was carried out with the inclusion of plasmid DNA (100ng of pL50 plasmid). The amounts of Taq polymerase driving the PCR ranged from 1.0 to 2.5 U (lane 1–4, Fig. 3c). A visible and clear amplification of all targets including the IAC was observed with 2.0 U and 2.5 U of Taq polymerase (lane 3–4, Fig. 3c). The results demonstrated that 2.0 U of Taq polymerase was the optimal concentration for amplification (lane 3, Fig. 3c). This is corroborated by the finding that a high PCR efficiency is achieved when concentration of Taq polymerase falls within the range of 2 U in a 25 μL of PCR reaction volume [39] (lane 3, Fig. 3c).

Fig 3. Standardization of multiplex PCR.

Fig 3

(a) Optimization of annealing temperature. Lane M: 100 bp DNA ladder (Promega), Lane 1: 70°C, lane 2: 69.2°C, lane 3: 68°C, lane 4: 66°C, lane 5: 63.7°C, lane 6: 61.9°C, lane 7: 60.7°C, lane 8: 60.0°C, lane N: Negative control (b) Optimization of MgCl 2 concentration. Lane M: 100 bp DNA ladder (Promega), Lane 1: 0.5 mM, lane 2: 1.0 mM, lane 3: 1.5 mM, lane 4: 2.0 mM, lane 5: 2.5 mM, lane 6: 3.0 mM, lane 7: 3.5 mM, lane 8: 4.0 mM, lane 9: 4.5 mM, lane N: Negative control (c) Optimization of the amount of Taq polymerase. Lane M: 100 bp DNA ladder (Promega), Lane 1: 1.0 unit, lane 2: 1.5 unit, lane 3: 2.0 unit, lane 4: 2.5 unit, lane N: negative control.

Determination of genomic DNA detection limit

The mPCR assay developed involves three different regions of genomic DNA (gDNA), namely the loci of StyR-3, StyR-143 and StyR-36 RNAs, targeted by three different primer pairs. The limit of detection was determined for each of these different regions of gDNA. In order to determine the detection limit, mPCR was performed using different concentrations of template genomic DNA (S. Typhi, S. Paratyphi A and S. Paratyphi B) serially diluted ranging from 100ng to 1pg. The results indicated that the limit of detection of the optimized mPCR test is about 10pg of template DNA (S. Typhi, S. Paratyphi A and S. Paratyphi B) (lane 5, Fig. 4a-c). This is equivalent to approximately 103 bacteria (assuming that one bacterium contains 3.48 fg of genomic DNA) [42,43] and is in accordance with previous studies [44–47].

Fig 4. Analytical sensitivity of serially diluted genomic DNA on 2% agarose gel electrophoresis.

Fig 4

a) S. Typhi. Lane M: 100 bp DNA ladder (Promega), Lane 1–6: Serially diluted gDNA from 100 ng to 1 pg, Lane N: negative control b) S. Paratyphi A. Lane M: 100 bp DNA ladder (Promega), Lane 1–6: Serially diluted gDNA from 100 ng to 1 pg, Lane 7: S. Typhi gDNA, Lane N: negative control and c) S. Paratyphi B. Lane M: 100 bp DNA ladder (Promega), Lane 1–7: Serially diluted gDNA from 100 ng to 100 fg, Lane 8: S. Typhi gDNA, Lane N: negative control.

Determination of mPCR assay specificity and sensitivity

We tested the specificity of our mPCR assay by examining a total of 37 bacterial strains (Table 3). We found that the mPCR assay successfully amplified DNA from all of the Salmonella strains tested (lanes 1–24, Fig. 5), which was detected through the Salmonella species-specific StyR-3 amplicon (475bp). Furthermore, S. Typhi infections were specifically detected through amplification of the 204-bp product from the StyR-36 gene (lanes 5 and 15, Fig. 5). The StyR-143 PCR product (304bp) was present in both S. Typhi- and S. Paratyphi A-positive samples. Therefore, amplification of the StyR-143 gene indicates infection with S. Typhi and/or S. Paratyphi A (lanes 5, 10, 15, and 20; Fig. 5). For this reason, amplification of both StyR-36 and StyR-143 can distinguish S. Typhi- and S. Paratyphi A-infected samples. A common laboratory test often misses the detection of S. Paratyphi A as this microorganism does not produce hydrogen sulfide. Hence, specific detection of S.Paratyphi A by PCR based on the specificity of StyR-143 is important for the accurate diagnosis of paratyphoid fever. This PCR-based test can also obviate the usage of the Widal test that is dependent on the production of antibodies over a period of 2–3 weeks. Fifteen non-Salmonella species tested showed no amplification for StyR-3, StyR-36 and StyR-143, with only the IAC detected, indicating an optimal degree of specificity for our assay (Fig. 6). Repeated PCR testing of the sensitivity and specificity of the primers revealed similar reproducible results.

Table 3. Bacterial samples used for the evaluation of primer specificity in the mPCR assay and the results.

sRNA genes
Bacterial sample StyR-3 StyR-143 StyR-36
Salmonella enterica Serovar
Pullorom + - -
Jawa + - -
Kedougou + - -
Mikawashima + - -
Typhi + + +
Give + - -
Hadar + - -
Corvallis + - -
Rissen + - -
Paratyphi A + + -
Bareilly + - -
Newport + - -
Agona + - -
Tennessee + - -
Typhimurium + - -
Weltevreden + - -
Enteritidis + - -
Albany + - -
Paratyphi B + - -
Paratyphi C + - -
Braenderup + - -
Infantis + - -
Non-salmonella species
Klebsiella pneumonia - - -
Pseudomonas aeruginosa - - -
Escherichia coli - - -
Shigella flexnari - - -
Vibrio cholerae - - -
Acenitobacter baumannii - - -
Aeromonas hydrophila - - -
Neisseria meningitidis - - -
Streptococcus spp - - -
Staphylococcus epidermidis - - -
Providencia spp - - -
Enterococcous feacalis - - -
Citrobacter freundii - - -
Proteus mirabilis - - -
Serratia marcerscens - - -

+ presence,

- absence

Fig 5. Representative agarose gel of amplified mPCR products using genomic DNA from Salmonella strains.

Fig 5

Lane M: 100bp ladder (Promega), lane N: Negative control, lane 1: S. Pullorum, lane 2: S. Jawa, lane 3: S. Kedougou, lane 4: S. Mikawashima, lane 5: S. Typhi, lane 6: S. Give, lane 7: S. Hadar, lane 8: S. Corvallis, lane 9: S. Rissen, lane 10: S. Paratyphi A, lane 11: S. Bareilly, lane 12: S. Newport, lane 13: S. Agona, lane 14: S. Tennessee, lane 15: S. Typhi, lane 16: S. Typhimuruim, lane 17: S. Weltevreden, lane 18: S. Enteritidis, lane 19: S. Albany, lane 20: S. Paratyphi A, lane 21: S. Paratyphi B, lane 22: S. Paratyphi C, lane 23: S. Braenderup, lane 24: S. Infantis.

Fig 6. Representative agarose gel of amplified mPCR product using genomic DNA from non-salmonella species.

Fig 6

Lane M: 100bp ladder (Promega), lane N: Negative control, lane 1: Klebsiella pneumonia; lane 2: Pseudomonas aeruginosa, lane 3: Escherichia coli, lane 4: Shigella flexnari, lane 5: Salmonella Typhi, lane 6: Vibrio cholerae, lane 7: Acenitobacter baumannii, lane 8: Aeromonas hydrophila, lane 9: Neisseria meningitidis, lane 10: Salmonella Paratyphi A, lane 11: Streptococcus spp, lane 12: Staphylococcus epidermidis, lane 13: Providencia spp, lane 14: Enterococcus feacalis, lane 15: Citrobacter freundii, lane 16: Proteus mirabilis, lane 17: Serratia marcerscens.

Determination of the mPCR detection limit for spiked fecal samples

Stool spiking was performed to emulate clinical samples. Performance of the mPCR on the spiked samples is vital to evaluate the utility of mPCR for the direct detection of S. Typhi and S. Paratyphi A in fecal samples. The detection limit for both S. Typhi- and S. Paratyphi A-spiked feces was 1.5 x 106 CFU/mL before enrichment (lane 3, Fig. 7a & b). However, with 4 h of enrichment in selenite cysteine broth, the sensitivity increased to 15 CFU/mL (lane 8, Fig. 8a) and 1.5 CFU/mL (lane 9, Fig. 8b) for S. Typhi and S. Paratyphi A, respectively. Notably, these detection limits are better than results obtained in other recent studies, which ranged from 1.0 x 102 to 5.5 x 104 CFU/mL [48,34,49]. The ability to identify Salmonella in fecal samples is advantageous because it allows for diagnosis of asymptomatic carriers. Indeed, 5% of typhoid patients become chronic carriers, shedding the organism in their feces after recovery [50]. Upon ingestion of the organisms, the likelihood and the severity of infection depend on the ingestion dose, the virulence of the Salmonella strain, and the status of host defense mechanisms. Usually, an infectious dose of 103 and 105 of non-typhoidal serovars and enteric serovars, respectively, are required to produce clinical infection in normal hosts [51]. Therefore, the sensitivity of the mPCR obtained conveys its potentiality of detecting salmonella in infected patients at the genomic DNA level.

Fig 7. Analytical sensitivity of serially diluted overnight grown bacterial culture spiked in human feces prior to enrichment on 2% agarose gel electrophoresis.

Fig 7

a) S. Typhi. Lane M: 100bp DNA ladder (Promega), Lane 1–9: represents DNA extracted from human feces spiked with different concentrations of S. Typhi before 4hrs of enrichment (1.5 X 108 CFU/ml—1.5 X 100 CFU/ml), Lane 10: DNA of unspiked human feces, lane 11: S. Typhi gDNA, Lane N: Negative control and b) S. Paratyphi A. Lane M: 100bp DNA ladder (Promega), Lane 1–9: represents DNA extracted from human feces spiked with different concentration of S. Paratyphi A before 4hrs of enrichment (1.5 X 108 CFU/ml—1.5 X 100 CFU/ml), lane 10: DNA of unspiked human feces, lane 11: S. Paratyphi A gDNA, lane 12: S. Typhi gDNA. Lane N: Negative control.

Fig 8. Analytical sensitivity of serially diluted overnight grown bacterial culture spiked in human feces after 4h of enrichment on 2% agarose gel electrophoresis.

Fig 8

a) S. Typhi. Lane M: 100bp DNA ladder (Promega), Lane 1–9: represents DNA extracted from human feces spiked with different concentration of S. Typhi after 4hrs of enrichment (1.5 X 108 CFU/ml—1.5 X 100 CFU/ml), Lane 10: DNA of unspiked human feces, lane 11: S. Typhi gDNA, Lane N: Negative control and b) S. Paratyphi A. Lane M: 100bp DNA ladder (Promega), Lane 1–9: represents DNA extracted from human feces spiked with different concentrations of S. Paratyphi A after 4hrs of enrichment (1.5 X 108 CFU/ml—1.5 X 100 CFU/ml), lane 10: DNA of unspiked human feces, lane 11: S. Paratyphi A gDNA, lane 12: S. Typhi gDNA. Lane N: Negative control.

Here, we have reported the efficacy of using novel sRNA genes (StyR-3, StyR-36, and StyR-143) as targets in mPCR to detect and differentiate salmonellosis. sRNAs represent superior candidates for molecular targeting assays, especially in PCR and reverse-transcription quantitative real-time PCR diagnostics (RT-qPCR). Indeed, we have demonstrated that mPCR is useful for specific microbiological detection of S. Typhi. Efficient diagnosis of S. Typhi is essential for successful treatment and disease surveillance programs including monitoring and transmission [49]. The increased infection rate of S. Paratyphi A in developing countries, especially among typhoid-vaccinated travelers, has led to more cases of enteric fever globally. Therefore, the sRNA-based mPCR assays shown here, offer excellent specificity and represent a way to improve control and surveillance strategies for these enteric pathogens.

Conclusions

Collectively, our findings demonstrate that sRNA genes serve as excellent molecular biomarkers for the effective diagnosis of bacterial infections. In particular, our novel, sRNA-based mPCR assay may represent an alternate method for the surveillance of clinically important Salmonella strains. The results of the present study support the use of sRNA genes in other molecular-based diagnostic methods, such as nucleic acid sequence-based amplification (NASBA) [52]. Similarly, it can also be applied in other isothermal-based nucleic acid amplification strategies such as strand displacement amplification (SDA) and loop-mediated isothermal amplification [53]. Furthermore, sRNA candidates are amenable for use in real-time detection of live Salmonella species via RT-qPCR diagnostics [54].

Acknowledgments

We thank the Department of Microbiology & Parasitology, USMCK, Kelantan, and Division of Mircobiology, VRI (Ipoh, Malaysia) for bacterial samples. We thank Prof Jürgen Brosius for the critical reading of the manuscript.

Data Availability

All relevant data are within the paper.

Funding Statement

This work was funded by the Advanced Medical and Dental Institute Postgraduate Research Grant Scheme and by the National Genome Research Network (grant #NGFNIII 01GS0808). The authors would like to thank the Universiti Sains Malaysia Graduate Assistant Scheme for funding Nithya Ravichantar. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116: 281–297. [DOI] [PubMed] [Google Scholar]
  • 2. Huttenhofer A, Schattner P, Polacek N. Non-coding RNAs: hope or hype?. Trends Genet. 2005;21: 289–297. [DOI] [PubMed] [Google Scholar]
  • 3. Gopinath SC, Wadhwa R, Kumar PK. Expression of noncoding vault RNA in human malignant cells and its importance in mitoxantrone resistance. Mol Cancer Res. 2010;8: 1536–1546. 10.1158/1541-7786.MCR-10-0242 [DOI] [PubMed] [Google Scholar]
  • 4. Storz G. An expanding universe of noncoding RNAs. Science. 2002;296: 1260–1263. [DOI] [PubMed] [Google Scholar]
  • 5. Washietl S, Hofacker IL, Lukasser M, Hüttenhofer A, Stadler PF. Mapping of conserved RNA secondary structures predicts thousands of functional noncoding RNAs in the human genome. Nat Biotechnol. 2005;23: 1383–1390. [DOI] [PubMed] [Google Scholar]
  • 6. Yong FL, Law CW, Wang CW. Potentiality of a triple microRNA classifier: miR-193a-3p, miR-23a and miR-338–5p for early detection of colorectal cancer. BMC Cancer. 2013;13: 280 10.1186/1471-2407-13-280 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Zhou Y, Xie J. The roles of pathogen small RNAs. J Cell Physiol. 2011;226: 968–973. 10.1002/jcp.22483 [DOI] [PubMed] [Google Scholar]
  • 8. Sharma CM, Hoffmann S, Darfeuille F, Reignier J, Findeiss S, Sittka A, et al. The primary transcriptome of the major human pathogen Helicobacter pylori. Nature. 2010;464: 250–255. 10.1038/nature08756 [DOI] [PubMed] [Google Scholar]
  • 9. Livny J, Waldor MK. Mining regulatory 5'UTRs from cDNA deep sequencing datasets. Nucleic Acids Res. 2010;38: 1504–1514. 10.1093/nar/gkp1121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Raabe CA, Hoe CH, Randau G, Brosius J, Tang TH, Roz hdestvensky TS. The rocks and shallows of deep RNA sequencing: Examples in the Vibrio cholerae RNome. RNA. 2011;17: 1357–1366. 10.1261/rna.2682311 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Chinni SV, Raabe CA, Zakaria R, Randau G, Hoe CH, Zemann A, et al. Experimental identification and characterization of 97 novel npcRNA candidates in Salmonella enterica serovar Typhi. Nucleic Acids Res. 2010;38: 5893–5908. 10.1093/nar/gkq281 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Crump JA, Luby SP, Mintz ED. The global burden of typhoid fever. Bull World Health Organ. 2004;82: 346–353. [PMC free article] [PubMed] [Google Scholar]
  • 13. Buckle GC, Walker CL, Black RE. Typhoid fever and paratyphoid fever: Systematic review to estimate global morbidity and mortality for 2010. J Glob Health. 2012;2: 10401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Connor BA, Schwartz E. Typhoid and paratyphoid fever in travellers. Lancet Infect Dis. 2005;5: 623–628. [DOI] [PubMed] [Google Scholar]
  • 15. Maskey AP, Basnyat B, Thwaites GE, Campbell JI, Farrar JJ, Zimmerman MD. Emerging trends in enteric fever in Nepal: 9124 cases confirmed by blood culture 1999–2003. Trans R Soc Trop Med Hyg. 2008;102: 91–95. [DOI] [PubMed] [Google Scholar]
  • 16. Ochiai RL, Wang X, von Seidlein L, Yang J, Bhutta ZA, Bhattacharya SK, et al. Salmonella paratyphi A rates, Asia. Emerg Infect Dis. 2005;11: 1764–1766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Pokharel BM, Koirala J, Dahal RK, Mishra SK, Khadga PK, Tuladhar NR. Multidrug-resistant and extended-spectrum beta-lactamase (ESBL)-producing Salmonella enterica (serotypes Typhi and Paratyphi A) from blood isolates in Nepal: surveillance of resistance and a search for newer alternatives. Int J Infect Dis. 2006;10: 434–438. [DOI] [PubMed] [Google Scholar]
  • 18. Tankhiwale SS, Agrawal G, Jalgaonkar SV. An unusually high occurrence of Salmonella enterica serotype paratyphi A in patients with enteric fever. Indian J Med Res. 2003;117: 10–12. [PubMed] [Google Scholar]
  • 19. Gopinath SCB, Tang TH, Yeng C, Citartan M, Lakshmipriya T. Bacterial sensing: microscope to smart phone. Biosens Bioelectron. 2014;60C: 332–342. [DOI] [PubMed] [Google Scholar]
  • 20. Ahmed SA, Sandai DA, Musa S, Hoe CH, Riadzi M, Lau KL, et al. Rapid diagnosis of leptospirosis by multiplex PCR. Malays J Med Sci. 2012;19: 9–16. [PMC free article] [PubMed] [Google Scholar]
  • 21. Tang TH, Ahmed SA, Musa M, Zainuddin ZF. Rapid detection of Mycobacterium tuberculosis in clinical samples by multiplex polymerase chain reaction (mPCR). World J Microb Biotechnol. 2013;29: 2389–2395. 10.1007/s11274-013-1407-0 [DOI] [PubMed] [Google Scholar]
  • 22. Kongmuang U, Luk JM, Lindberg AA. Comparison of three stool processing methods for detection of Salmonella serogroups B, C2, and D by PCR. J Clin Microbiol. 1994;32: 3072–3074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Calin GA, Liu CG, Sevignani C, Ferracin M, Felli N, Dumitru CD, et al. MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc Natl Acad Sci U S A. 2004;101: 11755–11760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Costa FF. Non-coding RNAs: new players in eukaryotic biology. Gene. 2005;357: 83–94. [DOI] [PubMed] [Google Scholar]
  • 25. Esteller M. Non-coding RNAs in human disease. Nat Rev Genet. 2011;12: 861–874. 10.1038/nrg3074 [DOI] [PubMed] [Google Scholar]
  • 26. Hall PA, Russell SH. New perspectives on neoplasia and the RNA world. Hematol Oncol. 2005;23: 49–53. [DOI] [PubMed] [Google Scholar]
  • 27. Meng X, Wu J, Pan C, Wang H, Ying X, Zhou Y, et al. Genetic and epigenetic down-regulation of microRNA-212 promotes colorectal tumor metastasis via dysregulation of MnSOD. Gastroenterology. 2013;145: 426–436. 10.1053/j.gastro.2013.04.004 [DOI] [PubMed] [Google Scholar]
  • 28. Ren S, Wang F, Shen J, Sun Y, Xu W, Lu J, et al. Long non-coding RNA metastasis associated in lung adenocarcinoma transcript 1 derived miniRNA as a novel plasma-based biomarker for diagnosing prostate cancer. Eur J Cancer. 2013;49: 2949–2959. 10.1016/j.ejca.2013.04.026 [DOI] [PubMed] [Google Scholar]
  • 29. Rozhdestvensky TS, Crain PF, Brosius J. Isolation and posttranscriptional modification analysis of native BC1 RNA from mouse brain. RNA Biol. 2007;4: 11–15. [DOI] [PubMed] [Google Scholar]
  • 30. Tang TH, Polacek N, Zywicki M, Huber H, Brugger K, Garrett R, et al. Identification of novel non-coding RNAs as potential antisense regulators in the archaeon Sulfolobus solfataricus . Mol Microbiol. 2005; 55: 469–481. [DOI] [PubMed] [Google Scholar]
  • 31. Aziah I, Ravichandran M, Ismail A. Amplification of ST50 gene using dry-reagent-based polymerase chain reaction for the detection of Salmonella typhi. Diagn Microbiol Infect Dis. 2007;59: 373–377. [DOI] [PubMed] [Google Scholar]
  • 32. Hirose K, Itoh K, Nakajima H, Kurazono T, Yamaguchi M, Moriya K, et al. Selective amplification of tyv (rfbE), prt (rfbS), viaB, and fliC genes by multiplex PCR for identification of Salmonella enterica serovars Typhi and Paratyphi A. J Clin Microbiol. 2002;40: 633–636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Massi MN, Shirakawa T, Gotoh A, Bishnu A, Hatta M, Kawabata M. Rapid diagnosis of typhoid fever by PCR assay using one pair of primers from flagellin gene of Salmonella typhi. J Infect Chemother. 2003;9: 233–237. [DOI] [PubMed] [Google Scholar]
  • 34. Ngan GJ, Ng LM, Lin RT, Teo JW. Development of a novel multiplex PCR for the detection and differentiation of Salmonella enterica serovars Typhi and Paratyphi A. Res Microbiol. 2010;161: 243–248. 10.1016/j.resmic.2010.03.005 [DOI] [PubMed] [Google Scholar]
  • 35.Thong KL, Chua KH. WIPO Patent WO2013070060 A1; 2013.
  • 36. Deng W, Liou SR, Plunkett G 3rd, Mayhew GF, Rose DJ, Burland V, et al. Comparative genomics of Salmonella enterica serovar Typhi strains Ty2 and CT18. J Bacteriol. 2003;185: 2330–2337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. de Gruyter W. Molecular diagnostics of infectious disease, 3rd ed. Graz, Austria; 2010. [Google Scholar]
  • 38. Baele M, Van Den Bulck K, Decostere A, Vandamme P, Hanninen ML, Ducatelle R, et al. Multiplex PCR assay for differentiation of Helicobacter felis, H. bizzozeronii, and H. salomonis. J Clin Microbiol. 2004;42: 1115–1122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Henegariu O, Heerema NA, Dlouhy S, Vance GH, Vogt PH. Multiplex PCR: critical parameters and step-by-step protocol. Biotechniques. 1997;23: 504–511. [DOI] [PubMed] [Google Scholar]
  • 40. Tantawiwat S, Tansuphasiri U, Wongwit W, Wongchotigul V, Kitayaporn D. Development of multiplex PCR for the detection of total coliform bacteria for Escherichia coli and Clostridium perfringens in drinking water. Southeast Asian J Trop Med Public Health. 2005;36: 162–169. [PubMed] [Google Scholar]
  • 41. Valerio E, Chambel L, Paulino S, Faria N, Pereira P, Tenreiro R. Molecular identification, typing and traceability of cyanobacteria from freshwater reservoirs. Microbiology. 2009;155: 642–656. 10.1099/mic.0.022848-0 [DOI] [PubMed] [Google Scholar]
  • 42. Cocolin L, Manzano M, Astori G, Botta GA, Cantoni C, Comi G. A highly sensitive and fast non-radioactive methodfor the detection of polymerase chain reaction products from Salmonella serovars, such as Salmonella typhi, in blood specimens. FEMS Immunol Med Microbiol. 1998;22: 233–239. [DOI] [PubMed] [Google Scholar]
  • 43. Zhu Q, Lim CK, Chan YN. Detection of Salmonella typhi by polymerase chain reaction. J Appl Bacteriol. 1996;80: 244–251. [DOI] [PubMed] [Google Scholar]
  • 44. JanYi W, Ichen Y, Yuchang C, Yuling L, Yangchih S. Simultaneous detection of five food-poisoning pathogens by multiplex PCR. Taiwanese Journal of Agricultural Chemistry and Food Science. 2009;47: 17–24. [Google Scholar]
  • 45. Jeong ES, Lee KS, Heo SH, Seo JH, Choi YK. Triplex PCR for the simultaneous detection of Pseudomonas aeruginosa, Helicobacter hepaticus, and Salmonella typhimurium. Exp Anim. 2011;60: 65–70. [DOI] [PubMed] [Google Scholar]
  • 46. Upadhyay BP, Utrarachkij F, Thongshoob J, Mahakunkijcharoen Y, Wongchinda N, Suthienkul O, et al. Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction. Southeast Asian J Trop Med Public Health. 2010;41: 426–435. [PubMed] [Google Scholar]
  • 47. Wei B, Cha SY, Kang M, Park IJ, Moon OK, Park CK, et al. Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks. Poult Sci. 2013;92: 1164–1170. 10.3382/ps.2012-02823 [DOI] [PubMed] [Google Scholar]
  • 48. Ho CC, Wu AK, Tse CW, Yuen KY, Lau SK, Woo PC. Automated pangenomic analysis in target selection for PCR detection and identification of bacteria by use of ssGeneFinder Webserver and its application to Salmonella enterica serovar Typhi. J Clin Microbial. 2012;50: 1905–1911. 10.1128/JCM.06843-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Teh CS, Chua KH, Puthucheary SD, Thong KL. Further evaluation of a multiplex PCR for differentiation of Salmonella paratyphi A from other salmonellae. Jpn J Infect Dis. 2008;61: 313–314. [PubMed] [Google Scholar]
  • 50. Jay JM. Foodborne gastroenteritis caused by Salmonella and Shigella In Modern Food Microbiology, 6th ed. Gaithersburg, Md.: Aspen Publishers; 2010. pp. 511–528. [Google Scholar]
  • 51. Bronze MS, Greenfield RA (Ed.). Biodefence: Principles and Pathogens Horizon Bioscience; 2005. [Google Scholar]
  • 52. Compton J. Nucleic acid sequence-based amplification. Nature. 1991;350: 91–92. [DOI] [PubMed] [Google Scholar]
  • 53. Chang CC, Chen CC, Wei SC, Lu HH, Liang YH, Lin CW. Diagnostic devices for isothermal nucleic acid amplification. Sensors (Basel). 2012;12: 8319–8337. 10.3390/s120608319 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. González-Escalona N, Hammack TS, Russell M, Jacobson AP, De Jesús AJ, Brown EW, et al. Detection of live Salmonella sp. cells in produce by a TaqMan-based quantitative reverse transcriptase real-time PCR targeting invA mRNA. Appl Environ Microbiol. 2009;75: 3714–3720. 10.1128/AEM.02686-08 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES