Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Apr 1.
Published in final edited form as: Dev Biol. 2015 Jan 29;400(1):132–138. doi: 10.1016/j.ydbio.2015.01.022

BMP-Smad4 signaling is required for precartilaginous mesenchymal condensation independent of Sox9 in the mouse

Joohyun Lim 1,2, Xiaolin Tu 3,*, Kyunghee Choi 4, Haruhiko Akiyama 5, Yuji Mishina 6, Fanxin Long 1,2,3,7,**
PMCID: PMC4361319  NIHMSID: NIHMS662621  PMID: 25641697

Abstract

Bone morphogenetic proteins (BMPs) regulate multiple aspects of skeletal development in vertebrates. Although exogenously applied BMPs can induce chondrogenesis de novo, the role and mechanism of physiologic BMP signaling during precartilaginous mesenchymal condensation is not well understood. By deleting the type I BMP receptors or the transcription factor Smad4 in the limb bud mesenchyme, we find that loss of BMP-Smad signaling abolishes skeletal development due to a failure in mesenchymal condensation. In the absence of Smad4, expression of Sox9, an essential transcription factor for chondrogenesis, initiates normally in the proximal mesenchyme of the limb bud, but fails to maintain its level or expand to the more distal territory at the later stages. However, forced-expression of Sox9 does not restore cartilage formation in the Smad4-deficeint embryo. In vitro micromass cultures show that the Smad4-deficient cells fail to condense in a cell-autonomous manner, even though they express several cell adhesion molecules either normally or even at a higher level. Thus, BMP-Smad signaling critically controls mesenchymal condensation to initiate skeletal development likely through a Sox9-independent mechanism.

Keywords: BMP, Bmpr1a, Bmpr1b, Acvr1, Alk2, Alk3, Alk6, Smad4, Sox9, cartilage, mesenchymal condensation, mouse

Introduction

Vertebrate limb skeletal development occurs through a series of precisely coordinated events. Initially, mesenchymal progenitors in the limb bud aggregate to form symmetrical structures with defined outer perimeters, known as mesenchymal condensations (Hall and Miyake, 2000). Subsequently, cells within the condensations differentiate into chondrocytes forming cartilage templates. Chondrocytes within the template initially uniformly proliferate but subsequently undergo progressive maturation to reach the hypertrophic state; the hypertrophic cartilage is eventually replaced by bone and bone marrow through endochondral ossification (Long and Ornitz, 2013).

BMP signaling has been shown to play critical roles in endochondral skeletal development (Liu and Niswander, 2005; Urist, 1965; Wozney et al., 1988; Wu and Hill, 2009). Mechanistically, BMP ligands bind to a multimeric complex of type I (Acvr1, Bmpr1a, Bmpr1b, also known as Alk2, 3, 6, respectively) and type II receptors to activate downstream signaling through Smad-dependent or -independent mechanisms. In the Smad-dependent pathway, BMPs activate Smad1, 5 or 8 through phosphorylation, and the activated Smads interact with Smad4 to regulate gene expression in the nucleus (Massagué, 2008; Wharton and Derynck, 2009; Wu and Hill, 2009). Targeted deletion of Alk3 and Alk6 with Col2-Cre caused severe chondrodysplasia (Yoon et al., 2005). Likewise, combinatorial removal of Smad1, 5 and 8 by the same approach led to a similar phenotype (Retting et al., 2009). However, similar disruption of Smad4 had a relatively mild effect on cartilage development, raising the possibility that Smad4 may not be essential for BMP signaling in chondrocytes (Zhang et al., 2005).

BMP signaling has also been implicated in the regulation of mesenchymal condensation prior to overt chondrocyte differentiation. Micromass cultures treated with the BMP inhibitors Noggin or Gremlin failed to form mesenchymal condensations in vitro (Barna and Niswander, 2007). Combined deletion of BMP2 and BMP4 in the limb bud mesenchyme caused a failure to form certain cartilage anlagen in the mouse (Bandyopadhyay et al., 2006). More recently, deletion of Smad4 in the limb bud mesenchyme resulted in the loss of the entire limb skeleton (Benazet et al., 2012). The severe phenotype is remarkably similar to that caused by deletion of the essential chondrogenic transcription factor Sox9, but the potential role of Sox9 in mediating the regulation of chondrogenesis by BMP has not been tested genetically (Akiyama et al., 2002).

In this study, we provide evidence that BMP-Smad4 signaling is essential for mesenchymal condensation in the mouse embryo. Deletion of either the type I BMP receptors or Smad4 in the limb bud mesenchyme abolished cartilage formation due to the failure in mesenchymal condensation. Further genetic experiments indicate that the essential role of Smad4 in mesenchymal condensation is likely independent of the regulation of Sox9.

Materials and Methods

Mouse strains

Prx1-Cre (Logan et al., 2002), Rosa-mT/mG (Muzumdar et al., 2007), Smad4f/f (Yang et al., 2002), Alk2f/f (Kaartinen and Nagy, 2001), Alk3f/f (Mishina et al., 2002), CAG-Sox9 (Kim et al., 2011), Alk2+/− (Mishina et al., 1999), Alk3+/− (Mishina et al., 1995), Alk6+/− (Yi et al., 2000) mouse strains are as previously described. The Animal Studies Committee at Washington University approved all mouse procedures.

Analyses of mice

Skeletal preparations of embryos were performed by Alcian-blue/Alizarin Red S staining as previously described (McLeod, 1980). Embryos were fixed in 10% neutral-buffered formalin and embedded in agar-gelatin (Jones and Calabresi, 2007) then sectioned with Leica microtome. Whole-mount in situ hybridization (Wilkinson, 1998), BrdU labeling (Joeng and Long, 2009) and PNA staining (Delise and Tuan, 2002) was performed as previously described. For BrdU experiments, labeling within similar areas of the core limb bud mesenchyme was quantified on 2 sections per embryo for 3 embryos per genotype.

Cell culture and qRT-PCR

High-density mouse embryonic limb bud cultures were performed as previously described (Stott et al., 1999). Briefly, limb buds of E11.5 stage mouse embryos were isolated and dissociated into single cell suspension. Cells were reconstituted into 2 × 107 cells/ml and 20 μl were plated in each well of 6-well plates. RNA was isolated by Trizol (Invitrogen) extraction and purified using RNeasy columns (Qiagen). cDNA was synthesized using 1 μg RNA per reaction using Superscript III reverse transcriptase (Invitrogen). Quantitative real time PCR was performed with FastStart SYBR-green (Roche). The following primers were used for qRT-PCR: Type II Collagen (F: GGCTCCCAACACCGCTAAC, R: GATGTTCTGGGAGCCCTCAGT), Aggrecan (F: CCTGCTACTTCATCGACCCC, R: AGATGCTGTTGACTCGAACCT), NCAM1 (F: GTACTCGGTACGACTGGCG, R: TGGAGGAGGGCTATGGACTG), NCAM2 (F: CTGCTCGGGTTGCTTGTCA, R: CCCACACTAAGCTCTACTTTGCT), Cdh2 (F: AGCGCAGTCTTACCGAAGG, R: TCGCTGCTTTCATACTGAACTTT).

Immunofluorescence and TUNEL staining

Tissues were fixed with 4% paraformaldehyde, embedded in OCT then sectioned at 6 μm with Leica cryostat (CM1950). Immunofluorescence was performed on sections using a primary antibody against Smad4, Sox9 (Santa Cruz) or GFP (Abcam), and an Alexa Fluor (488 or 594, Invitrogen) secondary antibody. TUNEL staining was performed with In Situ Cell Death Detection kit (Roche). Images were acquired using Nikon confocal microscope.

Results

BMP-Smad signaling is essential for embryonic limb skeletal development

Previous studies have shown active BMP-Smad signaling in the limb bud mesenchyme during mouse embryogenesis (Javier et al., 2012). To examine the potential role of BMP-Smad signaling during early development of the limb skeleton, we deleted Smad4 in the limb bud mesenchyme by breeding the conditional mice for Smad4 (Smad4f/f) with Prx1-Cre transgenic mice to generate mice with the genotype of Prx1-Cre;Smad4f/f (hereafter PS4). PS4 mice were born with essentially no forelimbs and only hindlimb rudiments (Fig. 1A). The differential effects on forelimb versus hindlimb could be due to a temporal difference in the onset of Prx1-Cre expression between the two domains (Logan et al., 2002). Whole-mount skeletal staining of newborn mice confirmed the absence of any forelimb bones but the presence of vestigial pelvic elements (Fig. 1C). The PS4 newborns also lacked the parietal, interparietal bones and showed a split sternum (Fig. 1C, C’). All of the skeletal defects were observed in regions targeted by Prx1-Cre (Logan et al., 2002). Thus, Smad4 is likely directly required for skeletogenesis during mouse embryonic development.

Figure 1. Conditional deletion of Smad4 or Alk2/3/6 in the limb mesenchyme causes severe skeletal defects.

Figure 1

Open in a new tab

(A) Gross morphology of wild type (WT) or Prx1-Cre; Smad4f/f (PS4) mice at birth. (B-F) Whole-mount skeletal staining of newborn mice with the genotype of wild type (B), Prx1-Cre; Smad4f/f (C), Prx1-Cre; Alk3f/− (D), Prx1-Cre; Alk3f/−; Alk6+/− (E) or Prx1-Cre; Alk2f/−; Alk3f/−; Alk6+/− (F). (B’-F’) Higher magnification of the sternum region from the corresponding skeleton above. Arrows denote defects at the skull, sternum and hindlimb. (G) Whole-mount skeletal staining of E16.5 embryos with the genotype of wild type (WT) or Prx1-Cre;Alk3f/− (PA3). (H) H&E staining of a longitudinal section through the humerus of the wild-type (WT) or the forelimb of the Prx1-Cre; Alk2f/−; Alk3f/− littermate embryo (PA23) at E16.5. (I) H&E staining of a longitudinal section through the humerus of the wild-type (WT) or the forelimb of the Prx1-Cre; Smad4f/f littermate embryo (PS4) at P0. Red arrow: vestigial cartilage.

Because Smad4 mediates both BMP and TGF signaling, we next seek to establish the specific role of BMP signaling. To this end, we deleted in the limb bud mesenchyme the type I BMP receptor Alk3 alone or in combination with Alk2 and/or Alk6. The Prx1-Cre; Alk3f/− (hereafter PA3) newborn mice exhibited under-mineralized parietal and interparietal bones, absence of multiple phalanges, dysmorphic shortening of all remaining limb elements, as well as a partially split sternum (Fig. 1D, D’). Additional deletion of one Alk6 allele on the PA3 background (termed PA36 mice) eliminated the ulnar, all the more distal elements in the forelimb, as well as the entire hindlimb skeleton beyond the rudimentary pelvic bones (Fig. 1E). The PA36 mice also exhibited a completely split sternum, similar to PS4 mice (Fig. 1E’). Finally, deletion of both Alk2 and Alk3 in mice harboring either one or two alleles of Alk6 (Prx1-Cre; Alk2f/−; Alk3f/−; Alk6+/− or Prx1-Cre; Alk2f/−; Alk3f/−, hereafter PA236 or PA23, respectively) caused severe hypomineralization of the skull, a split sternum, and more importantly, essentially eliminated all forelimb elements as well as the hindlimb bones distal to the pelvic girdle (Fig. 1F, F’, G). The skeletal phenotypes of the PA23 or PA236 mice are virtually identical to those of PS4 mice in both spectrum and severity. Histological sections through the forelimb confirmed that both PA23 and PS4 mice possessed only vestigial cartilage at the most proximal region (Fig. 1H, I). In contrast, previous studies showed that deletion of Tgfbr2 with Prx1-Cre caused only minor skeletal abnormalities (Seo and Serra, 2007). Thus, BMP-Smad signaling is critical for embryonic skeletal formation, and Alk2, 3 and 6 play both redundant and non-overlapping roles in specific limb elements.

Smad4 is required for mesenchymal condensation and cell survival in the limb bud

Mesenchymal progenitors in the limb bud initially undergo condensation preceding chondrocyte commitment. Thus we assessed whether mesenchymal condensation was affected in the limb bud of PS4 embryo. Histological analyses indicated that at E10.5 the limb bud mesenchyme appeared to be similar between wild type and PS4 littermates (Fig. 2A). However, at E11.5, the PS4 limb bud lacked the well-defined condensation readily visible at the core of the wild type limb bud (Fig. 2B, upper). Staining with peanut agglutinin (PNA), a marker for mesenchymal condensation confirmed the defect in the PS4 limb bud at E11.5 (Fig. 2B, lower). Thus, deletion of Smad4 results in a defect in mesenchymal condensation in vivo.

Figure 2. Smad4 deletion abolishes mesenchymal condensation and increases apoptosis.

Figure 2

Open in a new tab

(A, B) H&E or PNA staining of sagittal sections through wild type (WT) or Prx1-Cre; Smad4f/f (PS4) forelimb buds at E10.5 (A) or E11.5 (B). (C) Representative images (left) and quantification (right) for BrdU staining of paraffin-embedded sagittal sections of forelimbs at E11.5. BrdU signal in brown. (D) Representative images (left) and quantification (right) for TUNEL staining of frozen sections of forelimbs at E11.5. Apoptotic signals in green. N=3. *p<0.05. Boxes denote areas for quantification.

We next addressed whether changes in cell proliferation or apoptosis contributed to the lack of mesenchymal condensation in the absence of Smad4. At E11.5, BrdU labeling index within the mesenchymal core of the limb bud was similar between wild type and PS4 embryos (Fig. 2C). However, a significant increase in apoptosis was detected by TUNEL staining within the mesenchymal core of the mutant limb bud (Fig. 2D). It is not known at present whether the increase in apoptosis is the cause for, or merely the effect of the condensation failure.

Smad4 is required for mesenchymal condensation in vitro

To gain further insights about the role of Smad4 in mesenchymal condensation, we performed micromass cultures with mesenchymal cells isolated from E11.5 limb buds. Wild-type cells formed condensations identifiable under a light microscope within 2-3 days of culture, and cartilage nodules detectable by alcian blue staining by day 5 (Fig. 3A, upper). In contrast, the Smad4-deficient cells completely failed to form either obvious condensations or alcian blue-positive cartilage nodules (Fig. 3A, lower). Thus, Smad4 in mesenchymal progenitors is essential for the formation of condensations.

Figure 3. Smad4-deficient limb bud mesenchymal cells fail to undergo condensation in micromass cultures.

Figure 3

Open in a new tab

(A) PNA or alcian blue staining of wild type (WT) or Smad4-deficient (PS4) cultures at 2, 3 or 5 days after plating. Insets showing high magnification of a representative alcian blue-positive nodule present in WT but not PS4 cultures. (B) Direct fluorescence images of micromass cultures from mixed wild type (WT, red) and Smad4-deficient (PS4, green) cells, or Smad4-deficient (PS4, green) cells alone, at 6 days post plating. Single-channel images for RFP or GFP shown at grey scale to the right of color overlay images.

The results above suggest that Smad4 may be required for mesenchymal condensation in a cell-autonomous manner. To test this possibility directly, we performed micromass cultures with a mixture of wild type and Smad4-deficient limb bud mesenchymal cells. The wild-type cells from the mT/mG reporter embryo expressed mTomato; the mutant cells were isolated from the Prx1-Cre;Smad4f/f; mT/mG embryos and expressed mGFP. Remarkably, condensations were formed exclusively by the wild-type red cells, whereas the Smad4-deficent green cells were found to fill the space between the nodules (Figure 3B, upper). When the green Smad4-deficient cells were cultured alone, as expected they never formed recognizable nodules even after 6 days (Figure 3B, lower). Thus, Smad4 appears to be cell-autonomously required for precartilaginous mesenchymal condensation.

We next explored potential downstream effectors of Smad4 during mesenchymal condensation. Previous studies showed that the cell-surface adhesion molecules Cdh2 and NCAM1/2 were induced by BMP signaling in micromass cultures (Delise and Tuan, 2002; Jiang et al., 1993). Moreover, neutralizing antibodies to Cdh2 blocked mesenchymal condensation in micromass cultures, indicating that upregulation of the cell adhesion molecules may be necessary for the process (Oberlender and Tuan, 1994) . To test the potential that the adhesion molecules may mediate Smad4 function, we performed RT-qPCR experiments with micromass cultures of wild-type versus PS4 limb bud cells. These experiments confirmed the chondrogenic defect of PS4 cells, as the chondrocyte markers Col2 1 and aggrecan were never induced throughout the culture (Fig. 4A, B). However, Cdh2 was expressed normally by the PS4 cells after either 1 day or 5 days of micromass cultures (Fig. 4C). NCAM1 or NCAM2 levels were normal in the mutant cells after 1 day of culture, but unexpectedly higher than normal after 5 days (Fig. 4D, E). Thus, the cell adhesion molecules examined here do not seem to be the main mediator for Smad4 to regulate mesenchymal condensation.

Figure 4. Loss of Smad4 abolishes chondrogenesis but does not diminish expression of cell adhesion molecules.

Figure 4

Open in a new tab

(A-E) qRT-PCR analysis of Col2a1 (A), Aggrecan (B), Cdh2 (C), NCAM1 (D) and NCAM2 (E) in micromass cultures at 1 or 5 days post plating. Relative expression normalized to GAPDH. *: p<0.05, n=3. Error bars: Stdev.

Smad4 controls mesenchymal condensation independent of Sox9

Previous work has implicated Sox9 in mediating BMP regulation of chondrogenesis (Pan et al., 2008; Zehentner et al., 1999). Moreover, deletion of Sox9 in the limb bud mesenchyme, like that of Smad4, abolished limb skeletal formation (Akiyama et al., 2002; Akiyama et al., 2005; Bi et al., 1999). To determine whether Sox9 mediates the function of Smad4 during mesenchymal condensation, we examined Sox9 expression in the wild type and PS4 limb buds. Whole-mount in situ hybridization showed that Sox9 expression in the PS4 limb buds was relatively normal at E10.5 (Fig. 5A, upper row). However, at E12.0 when Sox9 expression normally demarcated the zeugopod and autopod elements, it was largely undetectable in these regions in the PS4 limb even though it was present more proximally at a level lower than normal (Fig. 5A, lower row). To gain further insight about Sox9 expression, we performed immunofluorescence experiments on limb sections. At E11.5, Sox9 protein was detected in the normal domain in the PS4 limb bud, even though Smad4 protein was largely undetectable (Fig. 5B). By E13.5, however, Sox9 was absent in the presumptive digit arrays, and also notably reduced in the areas with remaining expression (Fig. 5C). Thus, Smad4 appears to be dispensable for the initial induction of Sox9 but necessary for maintenance of the expression.

Figure 5. Smad4 is dispensable for initiation of Sox9 expression in proximal limb mesenchyme.

Figure 5

Open in a new tab

(A) Whole-mount in situ hybridization for Sox9 in forelimb buds at E10.5 or E12. A: autopod signal; Z: zeugopod signal. Arrow: signal in proximal mesenchyme. (B, C) Confocal images of Smad4 and Sox9 immunofluorescence on sagittal sections of E11.5 forelimbs (B) or frontal section of E13.5 forelimbs (C). Smad4 signal in red, Sox9 signal in green.

To address the potential role of Sox9 directly, we force-expressed Sox9 in the limb mesenchyme of PS4 embryos. Specifically, we generated embryos with the genotype of Prx1-Cre; Smad4f/f; CAG-Sox9 (PS4-Sox9). In this design, Sox9 was overexpressed from the CAG-Sox9 allele following Cre recombination (Kim et al., 2011). Because GFP was co-expressed with Sox9 from the transgene, we first confirmed activation of the transgene in chondrocytes by monitoring GFP expression in embryos with the genotype of Prx1-Cre; CAG-Sox9 (Fig. S1). The PS4-Sox9 embryos exhibited an identical skeletal phenotype as PS4 at E16.5, including complete absence of forelimb elements, lack of hindlimb elements beyond the pelvic girdle, and a under-mineralized and split sternum (Fig. 6A-C). Thus, Smad4 appears to be required for the initial steps of cartilage formation independent of Sox9 expression.

Figure 6. Sox9 overexpression fails to rescue skeletal development in Smad4-deficient mouse embryos.

Figure 6

Open in a new tab

(A) Whole-mount skeletal preparations of wild-type (WT), Prx1-Cre; Smad4f/f (PS4) or Prx1-Cre; Smad4f/f; CAG-Sox9 (PS4-Sox9) littermate embryos at E16.5. (B) Higher magnification images of the hindlimb region. (C) Higher magnification of the thoracic region. pu: pubis; is: ischium; il: ilium; st: sternum.

Discussion

In this study, we used mouse genetic approaches to investigate the role of BMP signaling during early limb skeletal development. Conditional deletion of either Smad4 or the BMP type I receptors in the limb bud mesenchyme abolished the formation of the limb skeleton. Detailed analyses of the Smad4-deficient embryos revealed a cell-autonomous requirement for Smad4 in precartilaginous mesenchymal condensation. Thus, BMP-Smad signaling in the mesenchymal progenitors critically controls the initiation of endochondral skeletal development.

Several of our key findings are consistent with the previous report by others who also deleted Smad4 with Prx1-Cre, these including the failure of mesenchymal condensation and the normal initiation of Sox9 expression in the mesenchymal progenitors (Benazet et al., 2012). In the present study, we further demonstrate that the requirement for Smad4 during mesenchymal condensation is cell-autonomous. Moreover, we show that combinatorial deletion of the BMP-specific type I receptors such as Alk2 and Alk3 recapitulates the Smad4 phenotype, therefore providing evidence that BMP-Smad4 signaling alone is essential for chondrogenesis, and cannot be compensated by TGF -Smad4 signaling.

The present study, for the first time to our knowledge, directly tested the functional importance of Sox9 in mediating BMP-induced chondrogenesis. Sox9 expression initiated normally but failed to maintain within the proximal limb mesenchyme when Smad4 was absent. Furthermore, no Sox9 expression was detected within the distal limb mesenchyme at any time point. These results raised the possibility that the lack of sustained Sox9 expression may underlie the failure of chondrogenesis in the Smad4 mutant embryo. However, Sox9 overexpression failed to restore cartilage formation in the Smad4 mutant embryo, arguing that Smad4 controls mesenchymal condensation likely independent of Sox9. We should note that although we confirmed expression of the Sox9 transgene in our system, we cannot rule out that the Sox9 expression level may be below the threshold necessary for rescuing mesenchymal condensation in the Smad4 mutant. Nonetheless, our conclusion is consistent with a previous study showing that Sox9-null cells formed mesenchymal condensations in vitro normally but failed to maintain the differentiated cellular morphology at a later stage (Barna and Niswander, 2007). Our conclusion may also explain why deletion of Smad4 but not Sox9 impairs intramembranous ossification in the skull, a process that requires mesenchymal condensation but not chondrogenesis. It'll be of interest to examine in the future whether BMP-Smad4 signaling also controls mesenchymal condensation during the development of non-skeletal tissues.

Despite previous evidence about the role of Cdh2 and NCAMs in BMP-induced mesenchymal condensation, we found no indication that the expression of these molecules was impaired in the absence of Smad4 (DeLise et al., 2000). In fact, the NCAMs were expressed at a higher level in the mutant cells than normal by day 5 of micromass culture; this is likely a result of failed condensation as these molecules normally downregulate following mesenchymal condensation (Stott et al., 1999). Therefore, future studies are necessary to identify the downstream effectors responsible for the critical role of BMP-Smad4 signaling in precartilaginous mesenchymal condensation.

Supplementary Material

Highlights.

  • Deletion of Smad4 or type I Bmp receptors in limb bud mesenchyme abolishes appendicular skeleton

  • Loss of Smad4 prevents precartilaginous mesenchymal condensation in a cell-autonomous manner

  • Smad4 deletion does not impair expression of Ncad, Ncam1 and Ncam2 in limb mesenchymal cells

  • Forced-expression of Sox9 does not restore limb skeleton in the absence of Smad4

Acknowledgement

This work is supported by NIH grants DK065789 and AR055923 (FL). The confocal microscopy experiments were supported in part by the NIH funded George O'Brien Center for Kidney Disease Research (P30DK079333), Kidney translational Research Core and the Renal Division at the Washington University School of Medicine. We thank Masato Hoshi of the Sanjay Jain lab for technical assistance with the confocal microscope.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Reference

  1. Akiyama H, Chaboissier MC, Martin JF, Schedl A, de Crombrugghe B. The transcription factor Sox9 has essential roles in successive steps of the chondrocyte differentiation pathway and is required for expression of Sox5 and Sox6. Genes Dev. 2002;16:2813–2828. doi: 10.1101/gad.1017802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Akiyama H, Kim J-E, Nakashima K, Balmes G, Iwai N, Deng JM, Zhang Z, Martin JF, Behringer RR, Nakamura T, de Crombrugghe B. Osteo-chondroprogenitor cells are derived from Sox9 expressing precursors. Proceedings of the National Academy of Sciences of the United States of America. 2005;102:14665–14670. doi: 10.1073/pnas.0504750102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bandyopadhyay A, Tsuji K, Cox K, Harfe BD, Rosen V, Tabin CJ. Genetic analysis of the roles of BMP2, BMP4, and BMP7 in limb patterning and skeletogenesis. PLoS Genet. 2006;2:e216. doi: 10.1371/journal.pgen.0020216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Barna M, Niswander L. Visualization of cartilage formation: insight into cellular properties of skeletal progenitors and chondrodysplasia syndromes. Dev Cell. 2007;12:931–941. doi: 10.1016/j.devcel.2007.04.016. [DOI] [PubMed] [Google Scholar]
  5. Benazet JD, Pignatti E, Nugent A, Unal E, Laurent F, Zeller R. Smad4 is required to induce digit ray primordia and to initiate the aggregation and differentiation of chondrogenic progenitors in mouse limb buds. Development. 2012;139:4250–4260. doi: 10.1242/dev.084822. [DOI] [PubMed] [Google Scholar]
  6. Bi W, Deng JM, Zhang Z, Behringer RR, Crombrugghe B.d. Sox9 is required for cartilage formation. Nature Genetics. 1999;22:85–89. doi: 10.1038/8792. [DOI] [PubMed] [Google Scholar]
  7. DeLise AM, Fischer L, Tuan RS. Cellular interactions and signaling in cartilage development. Osteoarthritis Cartilage. 2000;8:309–334. doi: 10.1053/joca.1999.0306. [DOI] [PubMed] [Google Scholar]
  8. Delise AM, Tuan RS. Analysis of N-cadherin function in limb mesenchymal chondrogenesis in vitro. Developmental dynamics : an official publication of the American Association of Anatomists. 2002;225:195–204. doi: 10.1002/dvdy.10151. [DOI] [PubMed] [Google Scholar]
  9. Hall BK, Miyake T. All for one and one for all: condensations and the initiation of skeletal development. Bioessays. 2000;22:138–147. doi: 10.1002/(SICI)1521-1878(200002)22:2<138::AID-BIES5>3.0.CO;2-4. [DOI] [PubMed] [Google Scholar]
  10. Javier AL, Doan LT, Luong M, Reyes de Mochel NS, Sun A, Monuki ES, Cho KW. Bmp indicator mice reveal dynamic regulation of transcriptional response. PloS one. 2012;7:e42566. doi: 10.1371/journal.pone.0042566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Jiang T-X, Yi J-R, Ying S-Y, Chuong C-M. Activin Enhances Chondrogenesis of Limb Bud Cells: Stimulation of Precartilaginous Mesenchymal Condensations and Expression of NCAM. Developmental Biology. 1993;155:545–557. doi: 10.1006/dbio.1993.1051. [DOI] [PubMed] [Google Scholar]
  12. Joeng KS, Long F. The Gli2 transcriptional activator is a crucial effector for Ihh signaling in osteoblast development and cartilage vascularization. Development. 2009;136:4177–4185. doi: 10.1242/dev.041624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Jones MV, Calabresi PA. Agar-gelatin for embedding tissues prior to paraffin processing. BioTechniques. 2007;42:569–570. doi: 10.2144/000112456. [DOI] [PubMed] [Google Scholar]
  14. Kaartinen V, Nagy A. Removal of the floxed neo gene from a conditional knockout allele by the adenoviral Cre recombinase in vivo. Genesis. 2001;31:126–129. doi: 10.1002/gene.10015. [DOI] [PubMed] [Google Scholar]
  15. Kim Y, Murao H, Yamamoto K, Deng JM, Behringer RR, Nakamura T, Akiyama H. Generation of transgenic mice for conditional overexpression of Sox9. J Bone Miner Metab. 2011;29:123–129. doi: 10.1007/s00774-010-0206-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Liu A, Niswander LA. Bone morphogenetic protein signalling and vertebrate nervous system development. Nature reviews. Neuroscience. 2005;6:945–954. doi: 10.1038/nrn1805. [DOI] [PubMed] [Google Scholar]
  17. Logan M, Martin JF, Nagy A, Lobe C, Olson EN, Tabin CJ. Expression of Cre Recombinase in the developing mouse limb bud driven by a Prxl enhancer. Genesis. 2002;33:77–80. doi: 10.1002/gene.10092. [DOI] [PubMed] [Google Scholar]
  18. Long F, Ornitz DM. Development of the endochondral skeleton. Cold Spring Harb Perspect Biol. 2013;5:a008334. doi: 10.1101/cshperspect.a008334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Massagué J. TGFbeta in Cancer. Cell. 2008;134:215–230. doi: 10.1016/j.cell.2008.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. McLeod MJ. Differential staining of cartilage and bone in whole mouse fetuses by alcian blue and alizarin red S. Teratology. 1980;22:299–301. doi: 10.1002/tera.1420220306. [DOI] [PubMed] [Google Scholar]
  21. Mishina Y, Crombie R, Bradley A, Behringer RR. Multiple roles for activin-like kinase-2 signaling during mouse embryogenesis. Developmental biology. 1999;213:314–326. doi: 10.1006/dbio.1999.9378. [DOI] [PubMed] [Google Scholar]
  22. Mishina Y, Hanks MC, Miura S, Tallquist MD, Behringer RR. Generation of Bmpr/Alk3 conditional knockout mice. Genesis. 2002;32:69–72. doi: 10.1002/gene.10038. [DOI] [PubMed] [Google Scholar]
  23. Mishina Y, Suzuki A, Ueno N, Behringer RR. Bmpr encodes a type I bone morphogenetic protein receptor that is essential for gastrulation during mouse embryogenesis. Genes Dev. 1995;9:3027–3037. doi: 10.1101/gad.9.24.3027. [DOI] [PubMed] [Google Scholar]
  24. Muzumdar MD, Tasic B, Miyamichi K, Li L, Luo L. A global double-fluorescent Cre reporter mouse. Genesis. 2007;45:593–605. doi: 10.1002/dvg.20335. [DOI] [PubMed] [Google Scholar]
  25. Oberlender SA, Tuan RS. Expression and functional involvement of N-cadherin in embryonic limb chondrogenesis. Development. 1994;120:177–187. doi: 10.1242/dev.120.1.177. [DOI] [PubMed] [Google Scholar]
  26. Pan Q, Yu Y, Chen Q, Li C, Wu H, Wan Y, Ma J, Sun F. Sox9, a key transcription factor of bone morphogenetic protein-2-induced chondrogenesis, is activated through BMP pathway and a CCAAT box in the proximal promoter. J Cell Physiol. 2008;217:228–241. doi: 10.1002/jcp.21496. [DOI] [PubMed] [Google Scholar]
  27. Retting KN, Song B, Yoon BS, Lyons KM. BMP canonical Smad signaling through Smad1 and Smad5 is required for endochondral bone formation. Development. 2009;136:1093–1104. doi: 10.1242/dev.029926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Seo H-S, Serra R. Deletion of Tgfbr2 in Prx1-cre expressing mesenchyme results in defects in development of the long bones and joints. Developmental Biology. 2007;310:304–316. doi: 10.1016/j.ydbio.2007.07.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Stott NS, Jiang TX, Chuong CM. Successive formative stages of precartilaginous mesenchymal condensations in vitro: modulation of cell adhesion by Wnt-7A and BMP-2. J Cell Physiol. 1999;180:314–324. doi: 10.1002/(SICI)1097-4652(199909)180:3<314::AID-JCP2>3.0.CO;2-Y. [DOI] [PubMed] [Google Scholar]
  30. Urist MR. Bone: formation by autoinduction. Science. 1965;150:893–899. doi: 10.1126/science.150.3698.893. [DOI] [PubMed] [Google Scholar]
  31. Wharton K, Derynck R. TGF family signaling: novel insights in development and disease. Development. 2009;136:3691–3697. doi: 10.1242/dev.040584. [DOI] [PubMed] [Google Scholar]
  32. Wilkinson DG. In situ hybridization : a practical approach. 2nd ed. Oxford University Press; Oxford ; New York: 1998. [Google Scholar]
  33. Wozney JM, Rosen V, Celeste AJ, Mitsock LM, Whitters MJ, Kriz RW, Hewick RM, Wang EA. Novel regulators of bone formation: molecular clones and activities. Science (New York, N.Y.) 1988;242:1528–1534. doi: 10.1126/science.3201241. [DOI] [PubMed] [Google Scholar]
  34. Wu MY, Hill CS. Tgf-beta superfamily signaling in embryonic development and homeostasis. Developmental cell. 2009;16:329–343. doi: 10.1016/j.devcel.2009.02.012. [DOI] [PubMed] [Google Scholar]
  35. Yang X, Li C, Herrera P-L, Deng C-X. Generation of Smad4/Dpc4 conditional knockout mice. Genesis (New York, N.Y.: 2000) 2002;32:80–81. doi: 10.1002/gene.10029. [DOI] [PubMed] [Google Scholar]
  36. Yi SE, Daluiski A, Pederson R, Rosen V, Lyons KM. The type I BMP receptor BMPRIB is required for chondrogenesis in the mouse limb. Development. 2000;127:621–630. doi: 10.1242/dev.127.3.621. [DOI] [PubMed] [Google Scholar]
  37. Yoon BS, Ovchinnikov DA, Yoshii I, Mishina Y, Behringer RR, Lyons KM. Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo. Proc Natl Acad Sci U S A. 2005;102:5062–5067. doi: 10.1073/pnas.0500031102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zehentner BK, Dony C, Burtscher H. The transcription factor Sox9 is involved in BMP-2 signaling. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research. 1999;14:1734–1741. doi: 10.1359/jbmr.1999.14.10.1734. [DOI] [PubMed] [Google Scholar]
  39. Zhang J, Tan X, Li W, Wang Y, Wang J, Cheng X, Yang X. Smad4 is required for the normal organization of the cartilage growth plate. Dev Biol. 2005;284:311–322. doi: 10.1016/j.ydbio.2005.05.036. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

NIHMS662621-supplement.docx (26.2MB, docx)

RESOURCES