Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Oct 1.
Published in final edited form as: J Invest Dermatol. 2014 Dec 10;135(4):1177–1180. doi: 10.1038/jid.2014.517

A Single SNP Surrogate for Genotyping HLA-C*06:02 in Diverse Populations

Philip E Stuart 1, Trilokraj Tejasvi 1,7, Pakeeza A Shaiq 2, Preya Kullavanijaya 3, Raheel Qamar 4,5, Ghazala K Raja 2, Yanming Li 6, John J Voorhees 1, Goncalo R Abecasis 6, James T Elder 1,7, Rajan P Nair 1
PMCID: PMC4366324  NIHMSID: NIHMS647821  PMID: 25493653

Over forty-one genetic susceptibility loci of genome-wide significance (P < 5 × 10−8) are known for psoriasis, a common complex genetic disease characterized by epidermal hyperproliferation and cutaneous inflammation. The most strongly associated of these loci maps to the HLA-C gene in the major histocompatibility complex (MHC) on chromosome 6p21.3 (Tsoi et al., 2012; Zhang et al., 2009). Recent fine mapping studies have identified multiple independent association signals in the MHC, and the strongest signal is associated with HLA-C*06:02 (previous designations: HLA-Cw6, HLA-Cw*0602) or SNPs that are near-perfect surrogates for this allele (Das et al., 2014; Feng et al., 2009; Knight et al., 2012; Okada et al., 2014). HLA-C*06:02 has been known to be psoriasis-associated since the 1970s, and most world populations studied have shown strong evidence of association (Okada et al., 2014; Shaiq et al., 2013; Stuart et al., 2010; Zhang et al., 2009). Yet, it is difficult to perform a routine affordable laboratory test for the presence or absence of HLA-C* 06:02 because DNA-based testing is complicated both by the high degree of polymorphism of HLA-C (2375 alleles encoding 1677 protein variations; July 2014 release of IMGT/HLA database) (Robinson et al., 2013) and by the sequence similarity of HLA-C* 06:02 to other HLA-C as well as HLA-A and HLA-B alleles. We previously used a 7- SNP genotyping system to unambiguously define HLA-C*06:02 and several other HLA-C alleles (Nair et al., 2006). Others have used allele-specific amplification followed by electrophoresis (Bunce et al., 1995), PCR amplification followed by restriction enzyme digestion (Tazi Ahnini et al., 1999), a combination of four surrogate SNPs that are amenable to Taqman genotyping (Nikamo and Stahle, 2012), and a 3-SNP haplotype (rs1576-rs130076-rs2523619) known to be in strong linkage disequilibrium (LD) with HLA-C*06:02 (Huffmeier et al., 2009). Imputation of classical HLA alleles including HLA-C*06:02 is another widely-used approach (Jia et al., 2013; Leslie et al., 2008), but this requires high density genotyping of the sample for SNPs throughout the MHC region, as well as a reference panel drawn from the same population that has been typed for both classical HLA genes and a high density of MHC SNPs.

During the course of our genome-wide association studies of psoriasis and fine mapping of MHC loci, we discovered that the A allele of SNP rs4406273, located 28.73 kb centromeric of HLA-C, is a near-perfect surrogate for HLA-C*06:02 allele. Notably, this SNP was the most strongly associated variant in the largest genome-wide association study of psoriasis to date (Tsoi et al., 2012). Since rs4406273 is only 3 bases away from another SNP, it is not amenable to the commonly-used Taqman (Applied Biosystems, Foster City, CA) genotyping assay design. However, it can be genotyped using single base extension methods. In this study, we examined the adequacy of genotyping rs4406273 as a single marker surrogate for HLA-C*06:02 in three different populations–5,009 European-ancestry samples collected in Michigan, 835 samples from Pakistan, and 307 samples from Thailand. All DNA samples used in this study were prepared from peripheral blood obtained following protocols approved by the ethics boards of participating institutions and adhering to the Declaration of Helsinki principles. Written informed consent was obtained from all study participants. Reference HLA-C*06:02 genotypes were generated by our previously reported 7-marker method (Nair et al., 2006), and rs4406273 was genotyped using the single base extension method implemented in the Applied Biosystems Snapshot Assay. Briefly, this assay involved (1) amplification of a 237 bp segment of DNA encompassing rs4406273 using PCR primers CTGGAAAGGGTGAGGAAACA and TGACCTCCCTACTGCAGCTT, (2) inactivation of unused primers and deoxynucleotide triphosphates by treatment with a mixture of shrimp alkaline phosphatase and exonuclease, (3) performing the primer extension reaction using an aliquot of the PCR product and probe GAGCCTCAGAAGAAATGCAGCTSTGAC that would be extended by one base corresponding to the allele(s) of rs4406273 (A and/or G), (4) inactivation of unused probe by treatment with alkaline phosphatase, and (5) identification of the added base by electrophoresis on an Applied Biosystems capillary electrophoresis apparatus using LIZ120 size standard ladder (Applied Biosystems, Foster City, CA).

The utility of the rs4406273-A allele as a surrogate for HLA-C*06:02 was assessed using various metrics (Table 1). Allele frequencies were very similar in all three cohorts, with the A allele of rs4406273 slightly less abundant in the Michigan and Pakistani samples and slightly more abundant in the Thai sample than HLA-C*06:02. LD between the two variants, as measured by the D′ and r2 coefficients, was 0.95 or greater in all three samples. Genotype concordances were also uniformly high (0.984–0.996). The correspondence of cross-classified allele counts for the rs4406273 A and C alleles on the one hand and HLA-C* 06:02 and non-C:06:02 alleles on the other hand were also assessed by six different measures for the performance of a binary classification test—sensitivity, specificity, positive predictive value, negative predictive value, accuracy, and the Matthews correlation coefficient (Matthews, 1975), which is the Pearson correlation coefficient between two binary classifications. Values for these performance measures were very high, ranging from 0.990–0.999 for the Michigan sample, 0.965–0.998 for the Pakistani sample, and 0.976–1.000 for the Thai sample.

Table 1.

Performance of the rs4406273-A allele as a surrogate for HLA-C*06:02.

Variable Michigan sample (10,018 alleles) Pakistan sample (1,670 alleles) Thailand sample (614 alleles)
frequency HLA-C*06:02 0.1624 (0.1553–0.1698)1 0.1725 (0.1551–0.1913) 0.1303 (0.1060–0.1592)
frequency rs4406273-A 0.1612 (0.1541–0.1685) 0.1683 (0.1511–0.1870) 0.1336 (0.1089–0.1628)
D′ measure of LD 0.9963 (0.9927–0.9993) 0.9870 (0.9710–1.0000) 1.0000 (1.0000–1.0000)
r2 measure of LD 0.9839 (0.9769–0.9903) 0.9456 (0.9150–0.9722) 0.9706 (0.9255–1.0000)
genotype concordance 0.9956 (0.9934–0.9971) 0.9844 (0.9736–0.9909) 0.9935 (0.9766–0.9988)
sensitivity 0.9896 (0.9833–0.9935) 0.9653 (0.9373–0.9810) 1.0000 (0.9542–1.0000)
specificity 0.9994 (0.9986–0.9997) 0.9978 (0.9936–0.9994) 0.9963 (0.9864–0.9993)
PPV 0.9969 (0.9928–0.9987) 0.9893 (0.9691–0.9971) 0.9756 (0.9154–0.9957)
NPV 0.9980 (0.9968–0.9987) 0.9928 (0.9868–0.9961) 1.0000 (0.9928–1.0000)
accuracy 0.9978 (0.9967–0.9985) 0.9922 (0.9867–0.9954) 0.9967 (0.9882–0.9994)
MCC 0.9919 (0.9885–0.9953) 0.9726 (0.9579–0.9875) 0.9859 (0.9667–1.0000)
Open in a new tab

Abbreviations: LD, linkage disequilibrium; PPV, positive predictive value; NPV, negative predictive value; MCC, Matthews correlation coefficient

1

95% confidence intervals shown in parentheses for all values

In Table 2A, we compare the results of a logistic regression test for association between psoriasis and dosage of the HLA-C*06:02 and rs4406273-A alleles. In all three cohorts, the odds ratio (OR) estimates and p-values for rs4406273 are slightly conservative compared to those of HLA-C*06:02, suggesting that this marker is unlikely to yield false positive results. Conditional haplotype testing of independent effects (Table 2B) shows that residual effects after conditioning are negligible compared to the association p-values.

Table 2.

A. Comparison of the association of HLA-C*06:02 and rs4406273-A with psoriasis for samples successfully typed for both markers.
Cohort n HLA-C*06:02
rs4406273-A
allele frequency
OR p-value allele frequency
OR p-value
cases controls cases controls
Michigan 5009 0.2327 0.0900 3.41 8.5 × 10−83 0.2307 0.0896 3.38 1.8 × 10−81
Pakistan 835 0.2484 0.1257 2.42 1.8 × 10−10 0.2390 0.1248 2.32 1.6 × 10−9
Thailand 307 0.1766 0.0425 5.38 7.5 × 10−6 0.1791 0.0472 4.91 1.0 × 10−5
B. Conditional haplotype testing of independent effects for samples successfully typed for both HLA-C*06:02 and rs4406273
Test marker Conditioning marker Independent effects p-value
Michigan Pakistan Thailand
HLA-C*06:02 rs4406273 0.0052 0.011 0.20
rs4406273 HLA-C*06:02 0.20 0.11 0.82
Open in a new tab

We also assessed the performance of rs4406273 as a surrogate for 928 individuals from 13 different populations in phase 1 of the 1000 Genomes Project (Abecasis et al., 2012) for which sequence-based genotypes of HLA-C and rs4406273 were available (Gourraud et al., 2014); ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/working/20140725_hla_genotypes/ and ftp://ftp-trace.ncbi.nih.gov/1000genomes/ftp/release/20110521/). LD was very strong between rs4406273 and HLA-C*06:02 in four populations of European descent from the United States, Finland, Great Britain and Italy (r2 = 0.984) and in three Asian populations from Japan and China (r2 = 1.000). LD values were somewhat lower but still strong in two African populations from Nigeria and Kenya (r2 = 0.929) and in four American populations from Puerto Rico, Colombia, and the United States (r2 = 0.909).

The results presented here demonstrate that genotyping rs4406273 can be used as an excellent substitute for more elaborate and expensive genotyping of HLA-C*06:02 in people of European, Pakistani, Thai, Chinese, or Japanese ancestry. This SNP may also be a serviceable surrogate for HLA-C*06:02 in some African and American populations. Caution is warranted, however, when applying this method to genetic isolates or more distantly related populations. While not amenable to the popular Taqman assay due to the presence of proximal SNPs, any method employing primer extension can be used to genotype rs4406273. For high-throughput genotyping projects using commercial microarrays, this SNP can be added on as a custom marker if not already present as part of the standard set.

Acknowledgments

We thank all the psoriasis patients and normal controls who contributed samples to this study. This work was supported by NIH Grants R01AR042742, R01AR054966, R01AR050511, R01AR050266 and R01AR062382, and the Babcock Memorial Trust.

Abbreviations

LD

linkage disequilibrium

MHC

major histocompatibility complex

Footnotes

CONFLICT OF INTEREST

The authors state no conflict of interest.

References

  1. Abecasis GR, Auton A, Brooks LD, et al. An integrated map of genetic variation from 1,092 human genomes. Nature. 2012;491:56–65. doi: 10.1038/nature11632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bunce M, O’Neill CM, Barnardo MC, et al. Phototyping: comprehensive DNA typing for HLA-A, B, C, DRB1, DRB3, DRB4, DRB5 & DQB1 by PCR with 144 primer mixes utilizing sequence-specific primers (PCR-SSP) Tissue Antigens. 1995;46:355–367. doi: 10.1111/j.1399-0039.1995.tb03127.x. [DOI] [PubMed] [Google Scholar]
  3. Das S, Stuart PE, Ding J, et al. Fine mapping of eight psoriasis susceptibility loci. Eur J Hum Genet. 2014 doi: 10.1038/ejhg.2014.172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Feng BJ, Sun LD, Soltani-Arabshahi R, et al. Multiple Loci within the major histocompatibility complex confer risk of psoriasis. PLoS Genet. 2009;5:e1000606. doi: 10.1371/journal.pgen.1000606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Gourraud PA, Khankhanian P, Cereb N, et al. HLA diversity in the 1000 genomes dataset. PLoS One. 2014;9:e97282. doi: 10.1371/journal.pone.0097282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Huffmeier U, Lascorz J, Bohm B, et al. Genetic variants of the IL-23R pathway: association with psoriatic arthritis and psoriasis vulgaris, but no specific risk factor for arthritis. J Invest Dermatol. 2009;129:355–358. doi: 10.1038/jid.2008.233. [DOI] [PubMed] [Google Scholar]
  7. Jia X, Han B, Onengut-Gumuscu S, et al. Imputing amino acid polymorphisms in human leukocyte antigens. PLoS One. 2013;8:e64683. doi: 10.1371/journal.pone.0064683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Knight J, Spain SL, Capon F, et al. Conditional analysis identifies three novel major histocompatibility complex loci associated with psoriasis. Hum Mol Genet. 2012;21:5185–5192. doi: 10.1093/hmg/dds344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Leslie S, Donnelly P, McVean G. A statistical method for predicting classical HLA alleles from SNP data. Am J Hum Genet. 2008;82:48–56. doi: 10.1016/j.ajhg.2007.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Matthews BW. Comparison of the predicted and observed secondary structure of T4 phage lysozyme. Biochim Biophys Acta. 1975;405:442–451. doi: 10.1016/0005-2795(75)90109-9. [DOI] [PubMed] [Google Scholar]
  11. Nair RP, Stuart PE, Nistor I, et al. Sequence and haplotype analysis supports HLA-C as the psoriasis susceptibility 1 gene. Am J Hum Genet. 2006;78:827–851. doi: 10.1086/503821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Nikamo P, Stahle M. Cost-effective HLA-Cw06:02 typing in a Caucasian population. Exp Dermatol. 2012;21:221–223. doi: 10.1111/j.1600-0625.2011.01423.x. [DOI] [PubMed] [Google Scholar]
  13. Okada Y, Han B, Tsoi LC, et al. Fine mapping major histocompatibility complex associations in psoriasis and its clinical subtypes. Am J Hum Genet. 2014;95:162–172. doi: 10.1016/j.ajhg.2014.07.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Robinson J, Halliwell JA, McWilliam H, et al. The IMGT/HLA database. Nucleic Acids Res. 2013;41:D1222–1227. doi: 10.1093/nar/gks949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Shaiq PA, Stuart PE, Latif A, et al. Genetic associations of psoriasis in a Pakistani population. Br J Dermatol. 2013;169:406–411. doi: 10.1111/bjd.12313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Stuart PE, Nair RP, Hiremagalore R, et al. Comparison of MHC class I risk haplotypes in Thai and Caucasian psoriatics shows locus heterogeneity at PSORS1. Tissue Antigens. 2010;76:387–397. doi: 10.1111/j.1399-0039.2010.01526.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Tazi Ahnini R, Camp NJ, Cork MJ, et al. Novel genetic association between the corneodesmosin (MHC S) gene and susceptibility to psoriasis. Hum Mol Genet. 1999;8:1135–1140. doi: 10.1093/hmg/8.6.1135. [DOI] [PubMed] [Google Scholar]
  18. Tsoi LC, Spain SL, Knight J, et al. Identification of 15 new psoriasis susceptibility loci highlights the role of innate immunity. Nat Genet. 2012;44:1341–1348. doi: 10.1038/ng.2467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Zhang XJ, Huang W, Yang S, et al. Psoriasis genome-wide association study identifies susceptibility variants within LCE gene cluster at 1q21. Nat Genet. 2009;41:205–210. doi: 10.1038/ng.310. [DOI] [PubMed] [Google Scholar]

RESOURCES