Canonical Wnt signaling in dendritic cells regulates Th1/Th17 responses and suppresses autoimmune neuroinflammation

Abstract

Breakdown in immunological tolerance to self-antigens or uncontrolled inflammation results in autoimmune disorders. Dendritic cells (DCs) play an important role in regulating the balance between inflammatory and regulatory responses in the periphery. However, factors in the tissue microenvironment and the signaling networks critical for programming DCs to control chronic inflammation and promote tolerance are unknown. Here, we show that wnt ligand-mediated activation of β-catenin signaling in DCs is critical for promoting tolerance and limiting neuroinflammation. DC-specific deletion of key upstream (LRP5/6) or downstream mediators (β-catenin) of canonical wnt-signaling in mice exacerbated experimental autoimmune encephalomyelitis (EAE) pathology. Mechanistically, loss of LRP5/6-β-catenin-mediated signaling in DCs led to an increased Th1/ Th17 cell differentiation whereas reduced regulatory T cell response. This was due to increased production of pro-inflammatory cytokines and decreased production of anti-inflammatory cytokines such as IL-10 and IL-27 by DCs lacking LRP5/6-β-catenin signaling. Consistent with these findings, pharmacological activation of canonical wnt/β-catenin signaling delayed EAE onset and diminished CNS pathology. Thus, the activation of canonical wnt signaling in DCs limits effector T cell responses and represents a potential therapeutic approach to control autoimmune neuroinflammation.

Introduction

Multiple sclerosis (MS) is a chronic autoimmune inflammatory condition that leads to multifocal demyelination in white matter of the human CNS. Using EAE, a mouse model for MS, studies have shown that DCs play a critical role in initiation and development of CNS pathology(1–3). Accordingly, innate immune receptors, including Toll-like receptor-mediated signaling in DCs, play a critical role in the initiation of EAE. These receptors on DCs sense various danger signals and induce the activation of several signaling networks with secretion of cytokines that drive the differentiation of naïve CD4⁺ and CD8⁺ T cells to effector or regulatory T cells(4). Activation of most TLRs on DCs induces secretion of IL-12p70 that promotes an IFN-γ⁺ CD4⁺ T cell (Th1) response, whereas dectin-1 mediated signals in DCs induce strong production of IL-6 and IL-23 that promote an IL-17A⁺ CD4⁺ T cell (Th17) response(4, 5). Other microbial stimuli that activate TLR2 or TLR9 induce immune regulatory molecules such as IL-10, retinoic acid (RA), TGF-β and Indoleamine-pyrrole 2,3-dioxygenase (IDO) that promote IL-4-producing CD4⁺ (Th2) or regulatory T cell responses(5). Similarly, DCs contribute to CNS pathology through differentiation and activation of naive CD4⁺ T cells to myelin-specific Th1 and Th17 cells(6, 7). In addition to CD4⁺ effector T cells, CD8⁺ T cells also contribute to CNS pathology during EAE and MS(8, 9). Conversely, emerging evidence suggests that DCs are also critical in resolving inflammation and limiting immune-mediated pathology in EAE by producing immune regulatory factors and initiating regulatory T cell (Treg) activation(3, 5, 10). Thus, DCs play a key role in bridging innate and adaptive immunity. However, the receptors and signaling networks that program DCs to control inflammation and autoimmunity are not known. Thus, understanding these events may represent promising targets for therapeutic intervention of various autoimmune and chronic inflammatory conditions.

Low-density lipoprotein receptor-related protein 5 (LRP5) and LRP6 co-receptors are critical signaling mediators of the canonical wnt-signaling pathway(11). β-catenin, a transcriptional co-factor, is an important downstream mediator of LRP5 and LRP6 signaling(11). Alterations or defects in the LRP5 and LRP6-mediated signaling pathway are associated with several human inflammatory diseases(11, 12). Interestingly, increased wnt ligand expression is observed in several inflammatory diseases (13–17). Although DCs are present in low number in the CNS under homeostatic conditions, their numbers increase drastically during autoimmune inflammation, infection or trauma(18). However, the functional and biological significance of the wnt signaling pathway in regulating ongoing inflammation and establishing immune homeostasis is poorly understood. In this context, our previous study has shown that the β-catenin pathway in intestinal DCs plays an important role in limiting inflammation and promoting gut homeostasis(19). We have also shown that the activation of β-catenin via the TLR2-pathway in DCs can suppress neuroinflammation(20). So, we hypothesize that wnt ligands in the tissue microenvironment activates the LRP5/6-β-catenin pathway in DCs and programs them to limit inflammation and immune-mediated pathology.

In the present study, we report that, during the induction and effector phase of EAE, the canonical wnt-signaling pathway in DCs regulates the magnitude of inflammatory responses and limits collateral damage to the host. Accordingly, our data demonstrate that DC-specific deletion of both LRP5 and LRP6 co-receptors or the key downstream signal mediator, β-catenin, in mice results in severe EAE pathology. This was because of increased expression of pro-inflammatory cytokines by DCs lacking LRP5/6 or β-catenin with increased Th1 and Th17 cell polarization over regulatory T cell polarization by these DCs. In contrast, pharmacological activation of the β-catenin pathway significantly reduced EAE severity. Taken together, our data demonstrate that the canonical wnt/β-catenin pathway in DCs promotes Treg responses over pathogenic Th1 and Th17 cells in an LRP5/6 co-receptor dependent manner. Thus, manipulating wnt/β-catenin signaling may represent a convenient therapeutic approach to improve the outcome of MS and other inflammatory diseases.

Materials and Methods

Mice

C57BL/6 male mice 6–12 wk of age were purchased from The Jackson Laboratory (Bar Harbor, ME). LRP5 floxed mice(21) and LRP6 floxed mice(21) were kindly provided by Dr. Brat O Williams (Van Andel Research Institute, MI) and were crossbred to generate LRP5/6 floxed mice. TCF/LEF-reporter mice(22), β-catenin floxed mice(23), CD11c-cre(24) and 2D2 MOG specific TCR transgenic mice(25) were originally obtained from Jackson Laboratories and bred on-site. β-catenin floxed mice were crossed with transgenic mice expressing cre recombinase enzyme under the control of CD11c promoter to generate mice lacking β-catenin in DCs (β-cat^ΔDC). Successful cre-mediated deletion was confirmed by polymerase chain reaction (PCR) and protein expression analyses as previously described (19). LRP5/6 floxed mice were crossed to CD11c-cre mice to generate mice in which LRP5/6 (LRP5/6^ΔDC) were deficient in DCs. Successful cre-mediated deletion was confirmed by PCR as in our previous studies. β-Cat^flox(ex3) mice (26) were bred to CD11c-cre mice to generate mice that expresses active β-catenin specifically in DCs (Act-β-cat^DC). All the mice were housed under specific pathogen-free conditions in the Laboratory Animal Services of Georgia Regents University. Animal care protocols were approved by the Institutional Animal Care and Use Committee of Georgia Regents University.

Reagents and Antibodies

CD4 (RM4-5), IL-17 (TC11-18H10), IFN-γ (XMG1.2), anti-CD3 (145.2C11), anti-CD28 (37.51), and brefeldin A were purchased from BD Biosciences. Foxp3-PE (FJK-16s), CD11c (N418), and CD11b (M1/70) were purchased from eBioscience. MOG_35-55 peptide (MEVGWYRSPFSRVVHLYRNGK) was purchased from Anaspec. Antibodies against mouse CD4 (GK1.5), CD8a (53–6.7), CD45 (30-F11), Foxp3 (clone FJK-16s), IL-10 (JES5-16E3), CD11c (clone N418), CD90.1 (HIS51), IL-17 (TC11-18H10), and IFN-γ (XMG1.2) were purchased from eBioscience. Non-phospho active β-catenin, β-catenin, and TCF4 antibodies were obtained from Cell signaling technology. β-galactosidase (β-gal) antibody was purchased from Abcam. Wnt Agonist II/β-catenin Agonist (SKL2001) and Wnt inhibitor (Porcn Inhibitior II, C59) were purchased from Calbiochem. Recombinant Wnt3a, Wnt2b and Wnt5a were purchased from R&D systems.

EAE induction

EAE induction experiments were performed as described in our previous study (27). EAE was induced by s.c. immunization in the hind flanks on days 0 using 100 μg of MOG_35–55 emulsified in CFA containing 2.5 mg/ml heat-inactivated Mycobacterium tuberculosis (Difco). Mice also received 250 ng of pertussis toxin (List Biological Laboratories) i.p. on day 0 and 2 post immunization (pi). Disease severity was assessed on different days pi according to the following scale: 0, no disease; 1, flaccid tail; 2, hind limb weakness; 3, hind limb paralysis; 4, forelimb weakness; and 5, moribund. In some experiments, EAE-induced WT mice were treated with either Wnt inhibitor (5 mg/kg) on day 0, 3 and 5 pi or Wnt-agonist/β-catenin agonist (5mg/kg) on 2 days before EAE-induction followed by treatment on day 0, 3 and 5 pi. For therapeutic treatment, EAE-induced WT mice were treated with Wnt-agonist/β-catenin agonist (5mg/kg) on day 10 followed by treatment on day 13 and day 16 pi.

CNS Leukocyte Isolation

Mice were euthanized with CO₂ and perfused through the left ventricle with PBS. The brain and spinal cord were removed from each animal and dissected into small fragments followed by digestion with collagenase type 4 (1 mg/ml) in complete DMEM plus 2% FBS for 30 minutes at 37°C. Leukocytes were isolated using 40% Percoll (Sigma-Aldrich) and then were stained for CD4⁺ and CD8⁺ T cells expressing Foxp3 and different intracellular cytokines.

CD11c⁺ Cell Isolation

CD11c⁺ DCs were purified from the CNS, DLN or spleen as previously described (27). In brief, spleens or brain were cut into small fragments and then digested with collagenase type 4 (1 mg ml⁻¹) in complete DMEM plus 2% FBS for 30 min at 37 °C. Cells were washed twice and enriched for CD11c⁺ DCs with the CD11c-specific microbeads from Miltenyi Biotech. The resulting purity of CD11c⁺ DCs was approximately 95%.

Flow cytometry

Single cell suspensions from CNS leukocytes, DLN and spleen were resuspended in PBS containing 5% FBS. After incubation for 15 min at 4°C with the blocking antibody 2.4G2 (anti-FcγRIII/I), the cells were stained at 4°C for 30 min with the appropriately labeled antibodies. Samples were then washed two times in PBS containing 5% FBS. The samples were either immediately analyzed at this point or fixed in PBS containing 2% paraformaldehyde and stored at 4°C. Intracellular staining for β-catenin, active β-catenin, and β-galactosidase was performed using rabbit monoclonal antibody or with appropriate isotype control in TBS containing 1% bovine serum albumin, followed by incubation with Alexa Fluor 488-conjugated rabbit-anti-goat immunoglobulin or goat anti-rabbit immunoglobulin G (IgG; Molecular Probes, Eugene, OR). To measure cytokines, single-cell suspensions from the DLN or CNS were ex vivo stimulated with phorbol 12-myristate 13-acetate (PMA)/Ionomycin and brefeldinA/monensin (eBioscience) for 6 hours at 37 °C. The cells were then stained for CD4 and CD8 followed by intracellular staining of IFN-γ, IL-17A, TNF-α and IL-10. To measure Treg or β-catenin or β-gal expression, corresponding Abs were added after permeabilization and fixation of cells. Flow cytometric analyses were performed using a FACS LSRII system (BD Biosciences) and the data were analyzed using FlowJo software (Ashland, OR).

Tetramer Staining

MOG_38–49-IA^b tetramers (PE) were kindly provided by the National Institutes of Health Tetramer Core Facility at Emory University. CNS-infiltrating leukocytes were resuspended in PBS containing 5% FBS followed by tetramer staining for 1 h at 37°C as described in a previous study (28). After 1h, cells were stained with anti-CD4 (APC) and anti-CD45 (Alexa 700) for 30 min on ice. Cells were washed three times followed by acquisition on flow cytometer. A non-specific peptide tetramer was used as negative control. The percentage of tetramer-PE-positive cells was determined in CD4-positive populations based on negative control staining.

2D2 CD4⁺ T cell adoptive transfer

β-cat^fl/fl, β-cat^ΔDC and LRP5/6^ΔDC recipient mice were reconstituted with 2.5 x 10⁶ 2D2 TCR transgenic CD4⁺ T cells followed by EAE-immunization. Five days later, DLNs were removed and, after RBC lysis, in vitro recall responses were assayed by restimulating DLN cells (2×10⁶/ml) for 6 h with PMA/Ionomycin in the presence of brefeldin A for intracellular cytokine detection.

Mtb stimulation of APCs

CD11c⁺ splenic DCs (10⁶ cells/ml) were cultured with Mtb for 24 hours. The supernatants were collected for cytokine analysis by ELISA, whereas cells were collected for gene expression analysis by RT-PCR. For bone marrow derived DCs (BMDCs), single cell suspension from mouse bone marrow of WT or LRP5/6^ΔDC mice were cultured for 7 days in the presence of GM-CSF (10 ng/ml; Peprotech) and IL-4 (1ng/ml; peprotech) in 10% FBS containing RPMI. At end of 7 day stimulation, BMDCs were stimulated with Mtb for 24 hours followed by cytokine analysis in cell supernatants using ELISA.

In vitro culture of murine DCs and T cells

In vitro stimulation was performed as previously described (27). In brief, purified splenic CD11c⁺ DCs (10⁶ cells/ml) were stimulated with Mtb and washed with media three times. In some experiments, DCs were cultured with Wnt3a (R & D; 5 0.5μg/ml), DKK1 (0.5 μg/ml). Activated DCs (2 x 10⁴) were cultured together with naive 2D2 CD4⁺CD62L⁺ T cells (10⁵) in 200 μl RPMI complete medium in 96-well round-bottomed plates in the presence of MOG peptide (1 μg/ml). After 96 hours, cells were re-stimulated with PMA/Ionomycin for 6 h in the presence of brefeldin-A for intracellular cytokine detection.

Quantitative Real-time PCR (qRT-PCR)

Total RNA was isolated from purified splenic, DLN or CNS-infiltrating CD11c⁺ DCs using the Qiagen RNeasy Mini Kit, according to the manufacturer’s protocol (Qiagen). cDNA was generated using the superscript First-Strand Synthesis System for RT-PCR and random hexamer primers (Invitrogen), according to the manufacturer’s protocol. cDNA was used as a template for quantitative real-time PCR using SYBER Green Master Mix (Bio-Rad) and gene specific primers as described in our previous study (27), and gene expression was calculated relative to the housekeeping gene glyceraldehyde phosphate dehydrogenase (GAPDH). The following primers were used for analysis. wnt2b F-CCGAGGGTATGACACAACTC, R-GTGGAGGGAAGAATGAGGTT; wnt3 F-TGTGAGGACACTTGAGCAGA, R-TTTGGATACAGCAGGTTGGT; wnt5a F-GCAGGACTTTCTCAAGGACA, R-CCCTGCCAAAGACAGAAGTA; wnt5b F-GGATGGATGGATGGATGATA, R-CTAATCCCCACCTGTCTCCT; wnt7a F-CAAAGTTTTCTACGGCAGGA, R-CTCCCAGTCCTAGCAAGTCA; wnt8a F-CCTGAGCATGCTTTTCAGTT, R-CCACCTGTTTTTCCATTTTG; wnt8b F-GGGTAAGAGGTAACCCCAGA, R-GCCAACCTGCCTACTACAGA; wnt9a F-GGCACAGGGTTACAAACAAC, R-GGACAGAGGCAACTGAGAAA; wnt10a F-ATGAGTGCCAGCATCAGTTC, R-GCCTTCAGTTTACCCAGAGC; Ifn-g F-CTCTTCTTGGATATCTGGAGG, R- CCTGATTGTCTTTCAAGACTTC; IL17 F-AATGCCCTGGTTTTGGTTGAA, R-CATTGATGCAGCCTGAGTGTCT; IL22 F-TCCGAGGAGTCAGTGCTAAA, R-AGAACGTCTTCCAGGGTGAA; TNF-α F-ATCATCTTCTCAAAATTCGAGTGA, R-TTGAGATCCATGCCGTTGG; IL6 F-AGACAAAGCCAGAGTCCTTCAGAGA, R-GCCACTCCTTCTGTGACTCCAGC-3; IL1β F-TGTAATGAAAGACGGCACACC, R-TCTTCTTTGGGTATTGCTTGG; IL12p40 F-CAATCAGGGCTTCGTAGGTA, R-GGCCCTGGTTTCTTATCAAT; IL10 F- CAGAGCCACATGCTCCTAGA, R-TGTCCAGCTGGTCCTTTGTT; IL23 F-AATAATGTGCCCCGTATCCA, R-AGGCTCCCCTTTGAAGATGT; Gmcsf F-TTTACTTTTCCTGGGCATTG, R-TAGCTGGCTGTCATGTTCAA; Il-27p28, F-CTGAATCTCGATTGCCAGGAGTGA-39, R-AGCGAGGAAGCAGAGTCTCTCAGAG-39.

Histopathology

Spinal cords from EAE-induced mice were removed after perfusion and fixed using 10% formalin in PBS. Fixed spinal cords were embedded in paraffin followed by sectioning and staining with hematoxylin and eosin to study leukocyte infiltration and pathology as well as luxol fast blue staining to demonstrate CNS demyelination.

Statistical analysis

Statistical analyses were conducted using GraphPad Prism (Software for Science). Mean clinical scores were analyzed using the Mann-Whitney non-parametric t test. The statistical significance of differences in the means ± s.d. of cytokines released by cells of various groups was calculated with the Student’s t-test (one-tailed).

Results

Deletion of wnt co-receptors LRP5 and LRP6 in DCs exacerbates EAE pathology

To investigate the role of wnt/β-catenin signaling in regulating autoimmune neuroinflammation, we induced EAE by immunizing mice with myelin-oligodendrocyte glycoprotein (MOG_35-55) peptide emulsified in CFA as previously described(20, 27). First, we characterized wnt gene expression in draining lymph nodes (DLN) on day 2 (induction phase) and in the CNS on day 11 (effector phase) of EAE. We noted a significant increase in the expression of wnt3a and wnt5a in DLNs during the induction phase of EAE (Supplementary Fig. 1a). Similarly, there was a significant increase in the expression of wnt2b and wnt3a in the CNS during the effector phase of EAE (Supplementary Fig. 1b). Next, we determined whether or not DCs express co-receptors LRP5 and LRP6 that mediate canonical wnt signaling. Enriched splenic CD11c⁺ DCs from wild-type B6 mice (WT) showed both LRP5 and LRP6 expression under steady state conditions (Supplementary Fig. 1c).

To address the role of LRP5- and LRP6-mediated signaling in DC function during autoimmune neuro-inflammation, we generated DC-specific deletion of LRP5 or LRP6 by crossing LRP5 or LRP6 floxed mice (21) to CD11c-cre mice(24). We immunized mice specifically lacking LRP5 or LRP6 in DCs (LRP5^ΔDC or LRP6^ΔDC) and WT mice (littermate floxed mice; WT^FL/FL) to induce EAE, and disease progression was monitored at different days post-induction (pi). DC-specific deletion of either LRP5 or LRP6 individually had no effect on disease progression and severity compared to WT control mice (data not shown). Since it is possible that LRP5 and LRP6 may play a compensatory role in DCs in response to inflammation, we then crossed LRP5^ΔDC and LRP6^ΔDC together to generate DC-specific deletion of both LRP5 and LRP6 (LRP5/6^ΔDC). Next, we induced EAE in WT and LRP5/6^ΔDC mice and disease severity was compared at different days pi. In contrast to WT control mice, LRP5/6^ΔDC mice were more susceptible and developed a more severe form of EAE (Fig. 1a). The histopathological analysis of CNS showed a marked increase in leukocyte infiltration and intense demyelination in LRP5/6^ΔDC mice compared to WT mice (Fig. 1b).

Figure 1. Loss of LRP5 and LRP6 in DCs exacerbates EAE.

(a) WT^FL/FL (LRP5/6 ^FL/FL) and LRP5/6^ΔDC mice were immunized with 100 μg MOG_35-55 in CFA on day 0. Mice also received 250 ng of pertussis toxin on days 0 and 2 pi. The EAE disease progression was monitored at various days pi. Mean clinical EAE score in WT^FL/FL and LRP5/6^ΔDC mice. (b) Hematoxylin and eosin (H&E) and luxol fast blue staining of spinal cords of WT^FL/FL and LRP5/6^ΔDC mice representative of mean EAE scores on day 16 pi. Original magnification, 20X. (c) Total number of CD4⁺ and CD8⁺ T cells isolated from CNS of WT^FL/FL and LRP5/6^ΔDC mice on day 16 pi. (d) Representative FACS plot and (e) frequencies of MOG_35-55 tetramer-specific CD4⁺ T cells isolated from CNS of WT^FL/FL and LRP5/6^ΔDC mice on day 16 pi. (f) Representative FACS plots for IFN-γ (top panels), IL-17A (middle panels), and TNF-α (Bottom panels) producing CD4⁺ T cells isolated from WT^FL/FL and LRP5/6^ΔDC mice CNS on day 16 pi. The cells were stimulated with PMA/ionomycin for 6 h in the presence of brefeldin A and monensin followed by intracellular cytokine staining (ICS). (g–i) Frequencies of IFN-γ⁺, IL-17⁺, TNF-α⁺, and IL-10⁺-producing, Foxp3⁺ CD4⁺ or IFN-γ⁺, TNF-α⁺ CD8⁺ T cells from WT^FL/FL and LRP5/6^ΔDC mice CNS on day 16 pi. (j) Quantitative real-time PCR analysis of Ifng, Il17a, Il22, Tnfa and Gmcsf mRNA expression relative to GAPDH in CNS infiltrating leukocytes of WT^FL/FL and LRP5/6^ΔDC mice on day 16 pi. Data are representative of two (d, i) or three (a–c, e-h) experiments (a, n=5–6 mice per group; c, n= 3 to 4 perexperiment; c, n= 5 per experiment f-h, n= 3 per experiment; i, n= 3 per experiment). Error bars show mean values ± SEM. *p<0.01; **p<0.001; ***p<0.0001.

CNS-infiltrating CD4 and CD8 effector T cells contribute to the pathogenesis of EAE(6, 7, 9). Thus, we next determined whether increased EAE severity observed in LRP5/6^ΔDC mice was due to effector T cell subsets. As shown in Fig. 1c–e, there was a significant increase in the total number of CD4⁺ and CD8⁺ T cells as well as the frequency of MOG_33-55 tetramer-specific CD4⁺ T cells in the CNS of LRP5/6^ΔDC mice when compared to control mice. Furthermore, intracellular cytokine analysis showed significant increase in the frequencies of IFN-γ⁺, IL-17⁺ and TNF-α⁺ CD4⁺ T cells (Fig. 1f–g). Moreover, there were significantly higher frequencies of IFN-γ⁺ and TNF-α⁺ CD8⁺ T cells in the CNS of LRP5/6^ΔDC mice than in WT mice (Fig. 1h). Consistent with these observations, treatment of mice with wnt inhibitor resulted in a more severe disease compared to control mice (Supplementary Fig. 2a). Likewise, treatment of mice with wnt inhibitor resulted in increases in the frequencies of CD4 and CD8 effector T cells in the CNS compared to control mice (Supplementary Fig. 2b–c). In contrast, we observed a decrease in the frequency IL-10⁺ CD4⁺ regulatory (Tr1) cells in the CNS of LRP5/6^ΔDC mice or upon wnt inhibitor-treated mice than in the CNS of WT control mice, whereas the frequency of Foxp3⁺ CD4⁺ T cells was similar in both groups (Fig. 1i; Supplementary Fig. 2d). Consistent with the above observations, CNS-infiltrating leukocytes from LRP5/6^ΔDC mice showed increased mRNA expression for IFN-γ, IL-17A, IL-22, TNF-α and GM-CSF as compared to WT control mice (Fig. 1j). Collectively, these data suggest that DC-specific expression of at least either LRP5 or LRP6 is critical for limiting autoimmune CNS pathology. Our results also show that the absence of both of these co-receptors results in increased EAE disease severity through promotion of effector T cell responses, indicating a possible regulatory role for LRP5/6 mediated signaling in DCs during ongoing neuroinflammation.

LRP5/6 signaling programs DCs to induce IL-10 and TGF-β secretion and limits pro-inflammatory cytokine expression

DCs control the fate of naïve T cell differentiation through the secretion of various inflammatory or anti-inflammatory cytokines(3, 4). The above results prompted us to assess whether LRP5/6-mediated signals regulate DC function through the expression of inflammatory and anti-inflammatory cytokines. So, we assessed the cytokine production by DCs upon adjuvant (Mtb) treatment. As shown in Fig. 2a, Mtb stimulation of LRP5/6-deficient DCs led to significantly increased production of IL-6, TNF-α, IL-1β, IL-12p40 and IL-12p70 compared to WT DCs. In contrast, there was significantly reduced production of IL-10 by LRP5/6-deficient DCs compared to control DCs (Fig. 2a). These results prompted us to determine whether LRP5/6 signaling regulates the cytokine expression by DCs during the EAE induction phase. We observed significantly increased mRNA levels for IL-6, TNF-α, IL-1β and IL-23 in draining lymph node (DLN) DCs isolated from EAE-induced LRP5/6^ΔDC mice compared to WT control mice (Fig 2b). In contrast, there was significant reduction in mRNA levels for immune regulatory genes such as IL10, TGF-β and IL-27 (p28) by LRP5/6^ΔDC DCs compared to control DCs (Fig 2b). In addition to effector T cell differentiation during the EAE induction phase, DCs infiltrating the CNS during the effector phase reactivate primed T cells and function as effector cells to cause CNS lesions. So, we examined the expression of inflammatory and anti-inflammatory cytokines in CNS-infiltrating DCs. As shown in Fig. 2c, there were significant increases in mRNA levels of Il-6, and Tnfa but decreased levels of Il-10 in LRP5/6^ΔDC CNS DCs compared to control CNS DCs. Thus, our data demonstrate that LRP5/6-mediated signaling in DCs is critical for limiting inflammatory cytokine expression and inducing anti-inflammatory cytokines during the induction and effector phase of EAE.

Figure 2. LRP5/6 signaling programs DCs to induce IL-10 and TGF-β secretion and limits pro-inflammatory cytokine expression.

(a) Cytokine concentrations in supernatants obtained after culture of bone marrow DCs (BMDCs) from WT^FL/FL and LRP5/6^ΔDC mice stimulated with or without M. tuberculosis (Mtb) (25 μg/ml) for 24 h. (b) Quantitative real-time PCR analysis of Il6, Tnfa, Il1b, Il23p19, Il10, Tgfb1and Il27 (p28) mRNA expression in CD11c⁺ DCs isolated from the DLN of WT^FL/FL and LRP5/6^ΔDC mice on day 2 pi. (c) Quantitative real-time PCR analysis of Il6, Tnfa and Il-10 mRNA expression in CD11c⁺ DCs enriched from the CNS of WT^FL/FL and LRP5/6^ΔDC mice on day 16 pi. Data are representative of two experiments (n= 3 per experiment). Error bars show mean values ± SEM. *p<0.01; **p<0.001; ***p<0.0001.

LRP5/6-dependent activation of β-catenin limits Th1 and Th17 differentiation

As DCs dictate the fate of naïve CD4⁺ T cells through differential production of pro- and anti-inflammatory cytokines (4), we further considered the functional relevance of DC-specific LRP5/6-mediated signaling in naive CD4⁺ T cell differentiation. We adoptively transferred naïve CD4⁺ CD25⁻ T cells from 2D2 mice (25) into WT and LRP5/6^ΔDC mice and then challenged these mice with MOG_35-55 plus CFA. Intracellular cytokine analysis on day 5 post-challenge showed a significant increase in naïve 2D2 T cell differentiation towards Th1 and Th17 cells in LRP5/6^Δ_DC mice compared to WT mice (Fig 3a–b). Next, we characterized whether increased inflammatory Th1 and Th17 cell responses and reduced regulatory T cell responses observed in LRP5/6^ΔDC mice are due to altered DC maturation and activation. However, characterization of DLN DCs from LRP5/6^ΔDC mice on day 2 pi showed no significant difference in the expression MHC class II, CD40, CD80 and CD86 as compared to control WT mice upon CFA immunization (Figure 3c). Thus, these data indicate that activation of LRP5/6-mediated signaling in DCs regulate the Th1 and Th17 cell differentiation through differential expression of pro and anti-inflammatory cytokine production in the DLN as well as in the CNS.

Figure 3. LRP5/6-dependent activation of β-catenin limits Th1 and Th17 differentiation.

Naïve CD4⁺CD62L⁺ T cells from 2D2 mice were adoptively transferred into WT^FL/FL and LRP5/6^ΔDC mice followed by immunization with MOG_35-55 (100 μg) in CFA. Five days after challenge, DLN cells were restimulated in vitro for 6 h with PMA/ionomysin in the presence of brefeldin A and monensin followed by ICS. Representative FACS plots (a) and frequencies (b) for IFN-γ and IL-17A-producing CD4⁺ 2D2 T cells are shown. (c) CD11c DCs from LRP5/6^ΔDC and WT mice on day 2 post EAE induction were analyzed for phenotypic characterization of various cell. Representative histogram shows the expression of MHC Class II, CD40, CD80 and CD86 expression by CD11c DCs. (d) Representative histogram of β-catenin, active β-catenin, and β-Gal expression by DCs isolated from the DLN (day 2 pi) and CNS (day 16 pi) of EAE-induced WT mice and analyzed by ICS. (e–f) Naïve CD4⁺CD62L⁺ T cells from 2D2 mice were adoptively transferred into WT (β-cat^FL/FL) and β-cat^ΔDC mice, followed by immunization with MOG_35-55 (100 ug) in CFA. Five days after challenge, DLN cells were restimulated in vitro for 6 h with PMA/ionomysin in the presence of brefeldin A and monensin, followed by ICS. Representative FACS plots (e) and frequencies (f) for IFN-γ and IL-17A-producing CD4⁺ 2D2 T cells. Data are representative of two experiments (a–b, n= 4–5 mice per experiment; c, n= 3 per experiment; d-e n= 4–5 mice per experiment). Error bars show mean values ± SEM. *p<0.01; **p<0.001.

Next, we determined whether EAE immunization affects β-catenin expression and activation in DCs during the initiation phase (in DLN) and effector phase (in CNS) of the EAE. To test this, we quantified β-catenin expression in DLN DCs on day 2 and in CNS DCs on day 16 post EAE induction. As shown in Fig. 3d, DCs isolated from the DLN and CNS showed similar levels of β-catenin expression compared to control DCs. However, we observed marked increase in active β-catenin levels in both DLN and CNS DCs (Fig. 3d). Upon activation, β-catenin translocates into the nucleus where it binds to T cell factor (TCF) family members to form a complex and regulate target gene expression. Therefore, we next determined whether β-catenin activation in DCs during the effector phase of EAE activates TCF expression using β-catenin/TCF reporter mice(29). We observed markedly higher levels of β-galactosidase (β-Gal) expression in DCs isolated from the DLN and CNS of EAE-induced mice (Fig. 3d). These data suggest that the β-catenin/TCF pathway is activated in DCs in the DLN and CNS during the initiation and effector phases of EAE.

Next, we studied whether activation of β-catenin in DCs affects the differentiation of naïve CD4⁺ T cells. To test this, we adoptively transferred naïve CD4⁺ T cells from 2D2 mice in WT and mice lacking β-catenin expression in DCs (β-cat^ΔDC mice) followed by challenge with MOG_35-55 in CFA. As shown in Fig. 3e–f, donor T cells isolated from β-cat^ΔDC mice showed significantly increased frequencies of Th1 and Th17 cells compared to control WT mice. Collectively, our results indicate that LRP5/6 mediated activation of β-catenin in DCs regulates the differentiation of naïve CD4⁺ T cells into Th1 and Th17 cells through regulation of DC-specific cytokine production. Furthermore, our data indicate a regulatory role for the canonical wnt pathway during ongoing neuroinflammation, where activation of this pathway in DCs limits the uncontrolled differentiation of naïve CD4⁺ T cells to Th1 and Th17 cells.

Induction of wnt3a during EAE conditions DCs to limit inflammatory responses

Next, we sought to determine whether increased wnt ligand expression in the DLN (Day 2) and CNS (Day 11) activates β-catenin in DCs and its effect on naïve CD4⁺ T cell differentiation. Previous studies have shown that wnt3a specifically activates β-catenin in DCs (30–32). Consistent with these studies(30–32), the wnt3a treatment of DCs from TCF reporter mice showed an increase in the reporter gene expression compared to untreated DCs (Fig. 4a). In contrast, wnt2b and wnt5a failed to activate β-catenin in DCs (data not shown). Next, we examined whether wnt3a exerts a regulatory effect on DCs to drive T cell differentiation. Accordingly, Mtb-treated DCs co-cultured with naïve CD4⁺ T cells led to an increase in Th1 and Th17 differentiation compared to control DCs (Fig. 4b). Interestingly, the addition of DKK1, a negative regulator of wnt ligands, during Mtb-treatment of DCs significantly increased the frequencies of Th1 and Th17 cells (Fig. 4b). Conversely, wnt3a treatment during Mtb-pulsing of DCs significantly reduced Th1 and Th17 cell differentiation (Fig. 4b). Furthermore, addition of wnt3a along with DKK1 inhibited the regulatory effect of wnt3a as observed by increased frequencies of Th1 and Th17 cells to levels equal to that of Mtb-treated DCs (Fig. 4b). Consistent with these observations, DCs conditioned with wnt3a produced significantly lower levels of inflammatory cytokines and more IL-10 compared to the control (Fig. 4c).

Figure 4. Wnt3a-conditioned DCs limit inflammatory responses.

(a) β-Galactosidase (β-Gal) expression in CD11c⁺ splenic DCs isolated from WT^FL/FL mice treated with wnt3a ligand (0.5 μg/ml) for 24 h and assessed by ICS. (b) CD11c⁺ splenic DCs were stimulated with Mtb (25 μg/ml) in the presence or absence of (i) DKK1 (Wnt antagonist; 0.5 μg/ml), (ii) wnt3a (0.5 μg/ml), and (iii) DKK1 plus wnt3a for 24 hours. After 24 hours, DCs were washed and co-cultured with naïve 2D2 CD4⁺ CD62L⁺ T cells for 4 days in the presence of MOG peptide. Representative FACS plot showing IFN-γ⁺ and IL-17A⁺ CD4⁺ T cell differentiation by Mtb-pulsed DCs in the presence or absence of wnt3a and wnt-antagonist (DKK1). (c) Quantitative real-time PCR analysis of Il6, Il-12p40, Il10 and Tgfb1 mRNA expression in Mtb-pulsed CD11c⁺ DCs in the presence or absence of wnt3a for 24 hours. Data are representative of two (a and b) or three (c) experiments (n= 3 per experiment). Error bars show mean values ± SEM. **p<0.001.

Lack of β-catenin in DCs exacerbates EAE disease severity

To further explore the role of LRP5/6-mediated activation of the wnt/β-catenin signaling pathway during neuroinflammation, we analyzed whether activation of β-catenin in DCs is critical for limiting EAE pathology. To test this, we monitored EAE disease severity over time in mice that specifically lack β-catenin in DCs(19). Similar to the deletion of LRP5/6 in DCs, deletion of β-catenin in DCs significantly increased EAE severity (Fig. 5a). Accordingly, histopathological analysis of the CNS of β-cat^ΔDC mice showed increased inflammation as observed by increased leukocyte infiltration and severe demyelination compared to WT control mice (Fig. 5b). Moreover, the CNS of β-cat^ΔDC mice had higher numbers of CD4⁺ and CD8⁺ T cells as well increased frequency of MOG_35-55 specific CD4⁺ T cells compared to control mice (Fig. 5c–e). Consistent with these data, intracellular cytokine analysis showed higher frequencies of Th1, Th17, TNF-α⁺ CD4⁺ T cells, IFN-γ⁺ CD8⁺ and TNF-α⁺ CD8⁺ T cells with lower percentage of Tr1 cells and no change in Treg cells in the CNS of β-cat^ΔDC mice compared to control mice (Fig. 5f–h).

Figure 5. Activation of wnt/β-catenin in DCs ameliorates EAE pathology.

The progression of EAE disease course in WT and β-cat DC mice immunized with MOG_35-55 plus CFA. (a) Mean clinical EAE score in WT^FL/FL and β-cat^ΔDC mice. (b) Hematoxylin and eosin (H&E) and luxol fast blue staining of spinal cords of WT^FL/FL and β-cat^ΔDC mice representative of mean EAE scores on day 16 pi. Original magnification, 20X. (c) Total number of CD4⁺ and CD8⁺ T cells isolated from CNS of WT^FL/FL and β-cat^ΔDC mice on day 16 pi. (d) Representative FACS plot and (e) bar diagram for frequency of MOG_35-55 tetramer-specific CD4⁺ T cells isolated from CNS of WT^FL/FL and β-cat^ΔDC mice on day 16 pi. (f–h) ICS analysis for frequencies of IFN-γ⁺, IL-17⁺, TNF-α⁺, IL-10⁺ and Foxp3⁺ cells among CD4⁺ or CD8⁺ T cells isolated from WT^FL/FL and β-cat^ΔDC mice CNS on day 16 pi. Data are representative of two (c–g) or three (a) experiments (a, n=4–5 mice per group per experiment; c-f, n= 5 per experiment). Error bars show mean values ± SEM. *p<0.01; **p<0.001.

To further confirm the regulatory role of the wnt/β-catenin pathway in DCs during autoimmune neuroinflammation, we immunized mice expressing constitutively active β-catenin in DCs (Act-β-cat^DC) and monitored EAE progression. In contrast to WT control mice, Act-β-cat^DC mice showed significantly diminished EAE disease severity (Fig. 6a). Consistent with this observation, we also noted a significant reduction in MOG_35-55 specific CD4⁺ T cell, Th1, and Th17 cells responses, whereas an increase in Tr1 cells was observed in Act-β-cat^DC mice compared to control mice (Fig. 6b–e). In conclusion, our data indicate that EAE induction leads to the expression of wnt ligands in the CNS that activates the β-catenin pathway in DCs and potentially limits the expansion of Th1 and Th17 cells. Furthermore, our data suggest a possible feedback regulatory role for the wnt/β-catenin pathway in controlling excessive neuroinflammation through induction of wnt ligands, which activate the β-catenin pathway in DCs and modulate T cell differentiation.

Figure 6. Mice expressing active β-catenin in DCs show diminished EAE pathology.

(a) The progression of EAE disease course in WT and Act-β-cat DC mice immunized with MOG_35-55 plus CFA. Mean clinical EAE score in WT^FL/FL and Act-β-cat^ΔDC mice. (b) Representative FACS plot and (c) frequencies of MOG_35-55 tetramer-specific CD4⁺ T cells isolated from CNS of WT^FL/FL and Act-β-cat^ΔDC mice on day 16 pi. Representative FACS plots (d) and frequencies (e) of IFN-γ⁺, IL-17⁺, and IL-10⁺-producing CD4⁺ T cells isolated from WT^FL/FL and Act-β-cat^ΔDC mice CNS on day 16 pi. Data are representative of two (b–e) or three (a) experiments (a, n= 3 to 4 mice per group per experiment; b-e, n= 3 mice per experiment). Error bars show mean values ± SEM. *p<0.01; **p<0.001.

Pharmacological activation of the wnt/β-catenin pathway limits EAE pathology in LRP5/6^ΔDC mice

Our data has thus far indicated that β-catenin is downstream of the LRP5/6 signaling pathway in DCs and its activation is critical for limiting EAE pathology. So, we explored the possible therapeutic implication of pharmacologically activating the canonical wnt/β-catenin pathway during ongoing neuroinflammation. First, we examined the effect of activating the β-catenin pathway in DCs on the expression of inflammatory and anti-inflammatory cytokines in response to Mtb. As shown in Fig. 7a, Mtb treatment of DCs led to increased production of IL-1β, IL-6, TNF-α and IL-12p40 compared to untreated DCs. Interestingly, the addition of β-catenin agonist to Mtb-treated DCs significantly reduced IL-1β, IL-6, TNF-α and IL-12p40 production by DCs compared to Mtb treated DCs alone (Fig. 7a). In contrast, we observed a significant increase in IL-10 levels in Mtb plus β-catenin activated DCs compared to Mtb-treated DCs (Fig. 7a). These in-vitro data further confirmed that the β-catenin pathway in DCs regulates the expression of anti-inflammatory cytokines and pro-inflammatory cytokines.

Figure 7. Pharmacological activation of the wnt/β-catenin pathway diminishes autoimmune neuroinflammation.

(a) Cytokine concentrations for IL-1β, IL-6, TNF-α, IL-12p40, and IL-10 in supernatants obtained from Mtb-pulsed WT BMDCs in the presence or absence of β-catenin agonist (0.5 μg/ml) for 24 h. (b) WT^FL/FL mice were immunized with 100 μg MOG_35-55 in CFA on day 0. Mice also received 250 ng of pertussis toxin on days 0 and 2 pi. EAE-induced WT mice were treated with β-catenin agonist (5 mg/kg) or left untreated/control vehicle (PBS) (None) on day -2, 0, 3 and 5 pi. The EAE disease progression was monitored in control and β-cat agonist treated groups over 30 days pi. Mean clinical EAE score with no treatment (None) and β-catenin agonist treated mice. (c) Hematoxylin and eosin (H&E) and luxol fast blue staining of spinal cords of none and β-catenin agonist treated mice representative of mean EAE scores on day 16 pi. Original magnification, 20X. (d) Total number of CD4⁺ and CD8⁺ T cells isolated from CNS of control and β-catenin agonist-treated mice on day 16 pi. (e) Representative FACS plot and (f) bar diagram for frequency of MOG_35-55 tetramer-specific CD4⁺ T cells isolated from the CNS of control and β-catenin agonist-treated mice on day 16 pi. (g–i) ICS analysis for frequencies of IFN-γ⁺, IL-17⁺, TNF-α⁺, and IL-10⁺ cells among CD4⁺ or CD8⁺ T cells isolated from control and β-catenin agonist-treated mice CNS on day 16 pi. Data are representative of at least two experiments (a, n= 3 per experiment; b, n=4 to 5 mice per group per experiment; d-e, n= 4–5 mice per experiment; f-h, n= 3 mice per experiment). Error bars show mean values ± SEM. *p<0.01; **p<0.001; ***p<0.0001.

Next, we assessed whether activation of this pathway could ameliorate EAE pathology. To study this, EAE-induced WT mice were treated with β-catenin agonist (5 mg/kg) intraperitoneally before and after disease induction. The treatment of WT mice with β-catenin agonist significantly delayed EAE onset and markedly reduced EAE severity compared to control group mice (Fig. 7b). Consistent with disease severity score, histopathological analysis of the CNS showed reduced inflammation as marked by reduced infiltration of leukocytes and diminished demyelination in the β-catenin agonist treated group compared to control vehicle treated mice (Fig. 7c). Further characterization of CNS-infiltrating leukocytes showed a significant reduction in total number of CD4⁺, CD8⁺ T cells, MOG_35-55-specific CD4⁺ T cells, Th1, Th17 and TNF-α⁺ CD4⁺ T cells (Fig. 7d–g, Supplementary Fig. 3a). Similarly, there was a significant reduction in IFN-γ⁺ and TNF-α⁺ CD8⁺ T cells in the CNS of β-catenin agonist-treated mice compared to control mice (Fig. 7h; Supplementary Fig. 3b). In contrast, we observed a significant increase in frequency of Tr1 cells with no change in Foxp3⁺ Treg cells in β-catenin agonist-treated animals compared to control mice (Fig. 7i; Supplementary Fig. 3c). To confirm further the role of β-catenin activation during clinical stages of EAE, β-catenin agonist treatment was initiated from day 10 post EAE induction when EAE clinical signs become evident, followed by treatment of day 13 and day 16. This therapeutic activation of β-catenin also reduced the clinical severity of EAE and CNS pathology (Supplementary Figure 3d–e), further confirming the role of β-catenin pathway activation during late stages of EAE pathology.

Since β-catenin is downstream of LRP5/6-signaling, we next investigated whether or not activation of β-catenin in LRP5/6^ΔDC mice can rescue EAE disease severity. To test this, we treated LRP5/6^ΔDC mice with β-catenin agonist following EAE induction. Accordingly, β-catenin agonist-treated LRP5/6^ΔDC mice showed significantly reduced EAE severity compared to untreated LRP5/6^ΔDC mice (Supplementary Fig. 4a). Also, we noted significantly diminished frequencies of MOG_35-55-specific CD4⁺ T cells as well as Th1, Th17 and TNF-α⁺ CD4⁺ T cells in β-catenin agonist-treated LRP5/6^ΔDC mice compared to untreated mice (Supplementary Fig. 4b–d). Conversely, there was an increase in the frequency of Tr1 cells in β-catenin agonist-treated LRP5/6^ΔDC mice compared to untreated mice (Supplementary Fig. 4e). Thus, these results indicate that activation of the β-catenin pathway independent of LRP5/6-mediated signaling is equally effective in suppressing autoimmune pathology. Taken together, our overall data demonstrate that LRP5/6-mediated activation of the canonical wnt/β-catenin pathway in DCs during EAE limits CNS pathology via suppression of pro-inflammatory responses and promotion of anti-inflammatory responses.

Discussion

In the present study we show that increased wnt ligand expression during the induction and effector phase of EAE regulates neuropathology through activation of LRP5/6-mediated canonical β-catenin signaling in DCs. Accordingly, DC-specific deletion of LRP5/6 or β-catenin led to an increased expression of IL-6, TNF-α, IL-1β, IL-12p40 and IL-12p70 with diminished production of IL-10 and TGF-β. Consequently, the absence of LRP5/6-β-catenin-mediated signaling in DCs suppressed regulatory T cell responses yet promoted Th1 and Th17 cell differentiation. Accordingly, mice lacking LRP5/6 or β-catenin in DCs exhibited a very severe EAE pathology characterized by intense demyelination in CNS with increased effector T cell infiltration in the brain. Finally, DC-specific expression of active β-catenin or pharmacological induction of β-catenin signaling during ongoing neuroinflammation delayed EAE onset with diminished neuropathology. These data indicate an important role of the canonical wnt/β-catenin pathway in controlling CNS inflammation during EAE and represents a logical target to control chronic inflammatory conditions such as MS.

In models of gut tolerance and tumor-induced immune tolerance, our recent studies have shown that activation of β-catenin in DCs induces T regulatory responses, and suppresses intestinal inflammation and antitumor immunity (19, 32). However, whether this pathway in DCs regulates peripheral immune homeostasis and neuroinflammation is not known. The data presented in this study clearly demonstrates that wnt-ligand-mediated activation of the β-catenin pathway in DC is critical for limiting inflammation and the magnitude of disease severity. Our data suggest that either deletion of LRP5/6 or blocking LRP5/6 signaling in DCs programmed them to a potent inflammatory state inducing Th1/Th17 responses that exacerbated EAE. This was due to high levels of pro-inflammatory cytokines secreted by DCs that promoted Th1/Th17 cell differentiation and expansion. In addition, T cells isolated from CNS of LRP5/6^ΔDC mice showed increased expression of GM-CSF, a key effector cytokine involved in CNS pathology during EAE (33–36). This data suggest that wnt-mediated canonical signaling in DCs is critical in regulating both differentiation and effector function of T cells.

Emerging evidence suggest that DCs are critical in resolving inflammation and limiting immune-mediated pathology in several autoimmune disease settings. However, the immune modulatory factors in the tissue microenvironment that are critical in programming DCs to containing inflammation are not known. In this context, our data suggest that the central role of increased wnt ligand expression in the brain as a feedback mechanism to regulate CNS pathology through activation of the β-catenin pathway in DCs. Accordingly, we observed increased wnt3a and wnt5a expression in the DLN during disease induction and in the CNS during EAE effector phase. Conditioning of DCs with wnt3a or wnt5a programs DCs to a regulatory state and limits the pro-inflammatory cytokines in response to different TLR-ligands (30, 31). Consistent with these studies (30, 31), we observed that wnt3a conditioning of DCs limits the expression of pro-inflammatory cytokines and increases the expression of anti-inflammatory factors in response to Mtb. Interestingly, dysregulated wnt-signaling has been linked to neurodegenerative and inflammatory disorders (37). Sustained activation of the wnt-pathway restrains inflammation, incites neuroprotection and promotes neurogeneration (37). In addition to DCs, macrophages and microglial cells play an important role in EAE pathogenesis(38, 39). Wnt5a, which signals independently of the β-catenin pathway, also reprograms DC to limit the expression of inflammatory cytokines (30, 31). It is possible that both the canonical and non-canonical pathway might act in concert to regulate the level of inflammation. In addition to canonical wnt signaling, TLR2- and E-cadherin-mediated signaling can also activate β-catenin in DCs suppressing chronic inflammation and EAE disease severity(20, 40). Although our data indicated the role of wnt3a in modulating DC activity during EAE, it is quite possible that increased wnt ligand expression could also regulate EAE pathology by modulating the functions of macrophage and microglial cells. Furthermore, it will be interesting to investigate the cellular source of factors inducing wnt ligand expression during ongoing neuroinflammation

DC-derived signals and the types of cytokines produced by DCs dictate the type of T helper cell differentiation and adaptive immune responses. In general, activation of the β-catenin pathway in DCs promotes the expression of immune regulatory molecules such as IL-10, TGF-β and RA (19, 20, 30–32, 40). There is accumulating evidence suggesting that these factors regulate the immune response by acting directly on DCs and limiting the expression of pro-inflammatory cytokines under different autoimmune settings(7, 41). For example, increased IL-10 production downstream of β-catenin activation in DCs could further induce SOCS3 expression in DCs and regulate pro-inflammatory cytokines. Accordingly, our previous study has shown that TLR2/IL-10/RA-mediated SOCS3 induction in DCs has shown to regulate IL-6, IL-12, and IL-23 through suppression of p38 (27). Moreover, p38 expression in DCs is critical for Th17 differentiation and plays an important role in EAE pathology (42). Thus activation of β-catenin in DCs could regulate EAE pathology through IL-10/SOCS3-mediated suppression of p38 in DCs. Consistent with these studies, we show that activation of the β-catenin pathway using wnt3a ligand or β-catenin agonist results in increased expression of IL-10 and TGF-β. In contrast, blockade of wnt signaling or deletion of β-catenin in DCs results in increased expression of pro-inflammatory cytokines and enhanced Th1/Th17 responses. Similarly, recent studies have shown the immunoregulatory role for DC-specific IL-27 signaling in limiting EAE pathology. TLR-mediated activation of DCs induces IL-27 production by DCs, which limits Th1 and Th17 cell differentiation through the induction of immunoregulaotry molecule CD39 (43–47). Accordingly, our data showed reduced production of IL-27p28 by DCs, increased Th1 and Th17 cell differentiation and severe EAE pathology in the absence of LRP5/6-β-catenin signaling in DCs (Fig 1–3, 5). This data indicates that LRP5/6-β-catenin-mediated signaling in DCs could limit EAE pathology through induction of IL-27. However, further studies are warranted to elucidate mechanistic details of this pathway..

What evolutionary benefits might accrue to host from activating the canonical wnt-β-catenin pathway during ongoing inflammation? Accumulating evidence suggests that high levels of wnt expression occur in several inflammatory diseases such as arthritis(13), arthrosclerosis(14), psoriasis(15), inflammatory bowel disease(16), and neurodegenerative(17) and neuroinflammatory diseases(37). Though moderate inflammation is essential for normal immune responses, uncontrolled chronic and excessive inflammation leads to allergic and autoimmune diseases. Generally, wnt-signaling represents a molecular switch in antigen presenting cells to dampen excessive inflammation thereby conferring host protection from immune-mediated pathology. While the activation of β-catenin during chronic inflammatory conditions is an excellent strategy to limit excessive inflammation(19, 20), tumor cells(32, 48) and persistent pathogens possibly exploit the same molecular mechanisms to suppress effective immune responses. Thus, wnt-mediated activation of LRP5/6-β-catenin signaling in DCs limit Th1, Th17 and CD8⁺ T cell responses and promotes regulatory T cell responses. Finally, our findings suggest that fine-tuning of the wnt/β-catenin pathway in DCs might be an attractive approach to limit neuroinflammation in MS patients.