Inhibiting STAT5 by the BET bromodomain inhibitor JQ1 disrupts human dendritic cell maturation

Abstract

Maturation of dendritic cells (DCs) is required to induce T-cell immunity while immature DCs can induce immune tolerance. Although the transcription factor STAT5 is suggested to participate in DC maturation, its role in this process remains unclear. Here, we investigated the effect of STAT5 inhibition on LPS-induced maturation of human monocyte-derived DCs (Mo-DCs). We inhibited STAT5 by treating Mo-DCs with JQ1, a selective inhibitor of BET epigenetic readers, which can suppress STAT5 function. We found that JQ1 inhibits LPS-induced STAT5 phosphorylation and nuclear accumulation, thereby attenuating its transcriptional activity in Mo-DCs. The diminished STAT5 activity results in impaired maturation of Mo-DCs as indicated by defective upregulation of costimulatory molecules and CD83, and reduced secretion of IL12p70. Expression of constitutively activated STAT5 in JQ1-treated Mo-DCs overcomes the effects of JQ1 and enhances the expression of CD86, CD83 and IL-12. The activation of STAT5 in Mo-DCs is mediated by GM-CSF produced following LPS stimulation. Activated STAT5 then leads to increased expression of both GM-CSF and GM-CSFR, triggering an autocrine loop that further enhances STAT5 signaling, enabling Mo-DCs to acquire a more mature phenotype. JQ1 decreases the ability of Mo-DCs to induce allogeneic CD4⁺ and CD8⁺ T-cell proliferation and production of pro-inflammatory cytokines. Furthermore, JQ1 leads to a reduced generation of inflammatory CD8⁺ T-cells and decreased Th1 differentiation. Thus, JQ1 impairs LPS-induced Mo-DC maturation by inhibiting STAT5 activity, thereby generating cells that can only weakly stimulate an adaptive immune response. Therefore, JQ1 could have beneficial effects in treating T-cell mediated inflammatory diseases.

Introduction

Several mechanisms are involved in the regulation of the immune response to prevent excessive activation of the immune system, tissue damage and autoimmunity. Dendritic cells (DCs), a specialized subset of antigen-presenting cells, play a major role in the balance between tolerance and immunity (1, 2). DCs are responsible for triggering and modulating the immune response against invading pathogens and certain malignant cells while keeping the immune system in a standby condition against self-antigens (3). One critical factor determining the effectiveness of the immune response is the maturation status of the DCs. In the absence of danger signals, immature DCs expressing few MHC and costimulatory molecules induce anergy of T cells or induce and activate regulatory T cells (Tregs) that provide a check on the immune response (4). In contrast, danger signals induce maturation of DCs, which express higher levels of T cell activating molecules, including MHC, CD80, CD86, CD40 and CD83, and secrete pro-inflammatory cytokines, thus effectively priming T cell responses (1, 3).

Because of the critical role of DCs in the immune response, they have been intensely studied as a tool to treat cancer and immune-related diseases (5–7). However, cell-based immunotherapies as a treatment modality for immune disorders still require further development. Most cytokines and growth factors implicated in the differentiation and maturation of DCs culminate in the activation of the Jak/STAT signaling pathway (8, 9). Thus, understanding the function of STAT transcription factors in the physiology of DCs is important not only to further reveal basic physiologic mechanisms of these cells, but also to target STATs therapeutically to modulate the immune response.

The differentiation of DCs from human monocytes in vitro depends on IL-4 and GM-CSF (10). While IL-4 signals via STAT6, GM-CSF can activate STAT1, STAT3 and STAT5 (9, 11, 12). The importance of STAT5 in the development of DCs has been demonstrated by studies showing that GM-CSF-activated STAT5 promotes differentiation of myeloid DCs by inhibiting the development of plasmacytoid DCs (12, 13). Further evidence has shown that DCs differentiated at low doses of GM-CSF become resistant to maturation stimuli afforded by LPS, TNF and CD-40L leading to the generation of immature (tolerogenic) DCs (11). However, the particular role of STAT5 during the maturation of DCs remains unclear.

It has been shown that the selective bromodomain inhibitor, JQ1, blocks STAT5 function (14). JQ1 was designed as an inhibitor of BET (bromodomain and extraterminal domain) family members of bromodomain-containing reader proteins, which include BRD2, BRD3, BRD4 and BRDT. These proteins specifically recognize acetylated chromatin sites and facilitate gene expression by recruiting transcriptional activators (15, 16). It was found that JQ1 reduced STAT5 function in leukemia and lymphoma cells through inhibition of BRD2, which is a critical mediator of STAT5 activity (14). JQ1 has also been found to decrease STAT5 phosphorylation (and exert an anti-tumor effect) in acute lymphoblastic leukemia cells, through suppression of transcription of IL-7R (17). In addition to its promising role in treating cancer, JQ1 has shown anti-inflammatory properties in murine macrophages (18, 19). Though tyrosine kinase inhibitors are currently used to treat immune-mediated diseases, this strategy is hampered by a lack of specificity and extensive suppression of immune responsiveness, leading to serious adverse effects, such as infections or malignances (20). Therefore, the development of more selective agents with reduced adverse effects would be a major step forward.

In this study, we aimed to determine the effect of JQ1 in human monocyte-derived DCs (Mo-DCs) as a potential inhibitor of STAT5 function. Additionally, we explored the role of STAT5 during the maturation of DCs induced by LPS. Our findings demonstrate that JQ1 can modulate adaptive immune responses, at least in part through STAT5. Our results provide new insight into the mechanism of STAT5 signaling during Mo-DC maturation and indicate that JQ1 may be used for the rational design of new strategies for the treatment of immune-related disorders.

Materials and Methods

Generation of Mo-DCs from PBMC

PBMCs isolated from leukapheresis products from healthy donors were obtained through a Dana-Farber Cancer Institute Institutional Review Board-approved protocol. Volunteers provided informed consent in accordance with the Declaration of Helsinki. PBMCs were isolated by Ficoll-Paque density gradient centrifugation. Human monocyte-derived DCs (Mo-DCs) were generated from PBMCs by adherence to plastic for 2 hours at 37°C in 5% CO₂. Adherent monocytes were cultured in RPMI 1640 complete medium (10% heat inactivated fetal bovine serum, 1% GlutaMAX, 1mM sodium pyruvate, 0.5% MEM-amino acids, 1% MEM-Vitamin, 0.07 mM β-ME, 1% penicillin/streptomycin; Gibco^®, Grand Island, NY, USA) supplemented with GM-CSF (50 ng/ml; PeproTech, Rocky Hill, NJ, USA) and IL-4 (50 ng/ml; PeproTech). After 5 days, immature Mo-DCs (Mo-iDCs) were induced to mature with LPS (Escherichia coli; 100ng/mL; Sigma-Aldrich, St. Louis, MO, USA). At day 6, mature Mo-DCs (Mo-mDCs) were harvested for further experiments.

Drug treatment of Mo-DCs

JQ1 was provided by James Bradner (Dana-Farber Cancer Institute) (16) and Jak Inhibitor 1 (Jaki) was obtained from EMD Millipore (Billerica, MA). The drugs were dissolved in DMSO and added to the culture media for Mo-DC differentiation at day 5 for 1 hour before LPS stimulus. JQ1 was diluted to a final concentration of 0.25μM (unless otherwise noted) and Jaki was used at a final concentration of 1μM. In each case, equal amounts of DMSO were added as a control. In the experiments involving JQ1-treatment and LPS activation in the presence of recombinant GM-CSF, Mo-iDCs were treated with JQ1 (0.25 μM) for 1 hour. Then, GM-CSF (50 ng/ml) was added, and cells were stimulated with LPS (100 ng/mL) for 24 hours.

RNA isolation and quantitative RT-PCR (qRT-PCR)

RNA was harvested using the RNeasy Mini Kit from Qiagen (Valencia, CA). cDNA was synthesized using the TaqMan Reverse Transcription kit (Applied Biosystems, Foster City, CA). qPCR was performed in triplicate using SYBR select master mix (Applied Biosystems) on ABI Prism 7500 Sequence Detection System (Applied Biosystems). RNA expression was normalized to 18sRNA, and the fold increase was determined by dividing the expression in each sample by that of mature Mo-DC controls. Data are expressed as mean fold increase and standard error of the mean (SEM). Primer sequences are provided in Supplemental Table I.

Immunobloting and cellular fractionation

Total protein lysates were prepared using lysis buffer (50 mM Tris, pH 8.0, 250 mM NaCl, 0.5% NP-40) containing protease and phosphatase inhibitors. Nuclear and cytoplasmic fractionation was performed according to the manufacturer’s protocol (Active Motif, Carlsbad, CA). Protein lysates were resolved by 8% SDS-PAGE and immunoblotted with primary antibodies specific for pSTAT5, pSTAT3, pSTAT1 and poly(ADP-ribose) polymerase (PARP) (Cell Signaling, Boston, MA); STAT5, STAT3 and STAT1 (Santa Cruz Biotechnology, Santa Cruz, CA); and actin or tubulin (Sigma-Aldrich). Band intensity was quantitated using Image J software (NIH).

Chromatin immunoprecipitation (ChIP)

ChIP was performed as described (21). Briefly, cells were fixed in 1% formaldehyde for 10 min, sonicated using a Qsonica sonicator, and lysates were immunoprecipitated overnight with normal rabbit IgG (Caltag, Burlingame, CA) and anti-STAT5 (sc-835; Santa Cruz Biotechnology). Quantitative PCR was performed in triplicate using primers for CSF2RA (TTTGCATGTGGTCTTTGAGG and TTCTTGACAACACCCAGCAC), CisH (CCCGCGGTTCTAGGAAGAC and CGAGCTGCTGCCTAATCCT), Socs2 (AGGCCGATTCCTGGAAAG and CGACGAGACTTGGCAAGAG), CD83 (CTGGCCCTCAAATTCTTTCA and TGAGACGTTAGCCAGTGGAA), CD80 (CCAAATCTTCACCCCACCTA and CTGAGGAAAAGCGAATGGAA) or rhodopsin (TGGGTGGTGTCATCTGGTAA and GGATGGAATGGATCAGATGG). The results were normalized to the input and expressed relative to binding to the rhodopsin-negative binding region. Match Browser (http://www.gene-regulation.com/cgi-bin/pub/programs/match/bin/match.cgi) and the UCSC Genome Browser (http://genome.ucsc.edu) were used to identify potential STAT5 binding sites in the regulatory region of genes.

Lentiviral production and infection of Mo-DCs

The eGFP-expressing lentiviral vector, SiEW, expressing a constitutively activated mutant form of STAT5a (caSTAT5) was cloned and produced as described (22). Immature Mo-DCs were infected with lentivirus expressing caSTAT5 or empty vector at day 5 of culture in the presence of 4 μg/mL polybrene (Sigma-Aldrich) and centrifuged at 2500 rpm, 32°C for 30 min. Medium was changed 150 min after transduction and Mo-iDCs were treated with JQ1 or DMSO for 1 hour followed by LPS stimulation (100ng/mL). After 24 hours, mature Mo-DCs were analyzed by flow cytometry or harvested for RNA analysis. The transduction efficiency was between 60% and 70%.

GM-CSF neutralization assay

Immature Mo-DCs were generated in the presence of IL-4 and GM-CSF as described above. On the 5^th day of culture, culture media was removed and fresh media was added to eliminate residual GM-CSF. Then, 10 μg of anti-GM-CSF antibody (Biolegend) was added to Mo-iDCs, and cells were stimulated with LPS (100 ng/mL) for 24 or 48 hours.

Quantitation of cell viability

Viable cells were measured by adenosine triphosphate (ATP)–dependent bioluminescence using the CellTiter-Glo assay (Promega, Madison, WI). The combination index to measure drug interactions was calculated using CalcuSyn software (Conservion, Ferguson, MO).

T cell proliferation assay

Mature Mo-DCs pre-treated with JQ1, Jaki or DMSO were harvested and washed to remove residual drug at day 6 of culture. These cells were then cocultured with bead-purified allogeneic CD3⁺ T cells labeled with CellTrace Violet (Molecular Probes®). Cells were cultured at 37°C in 5% CO₂ for 5 days. Cell proliferation was quantified by flow cytometry. The division index and quantitation of cell division were calculated with FlowJo 8.7 software (Tree Stars Inc.).

Flow cytometry of surface markers, intracellular cytokines, and Foxp3

Cells were stained on ice in PBS containing 2% FBS for 20 min, using the following mAbs: FITC anti-CD11c; PERCP anti-CD14; PE-Cy7 anti-CD80; APC anti-CD83; APC-Cy7 anti-CD40; pacific blue anti-CD86; and V500 anti-HLA-DR (BD Biosciences); anti-CD4 (APC, APC-Cy7 and Alexa-Fluor 488); anti-CD8 (PE and PERCP); APC-Cy7 anti-CD25; and PE-Cy7 anti-CD127 (Biolegend). For intracellular cytokine staining, cells were stimulated with Leukocyte Activation Cocktail with GoldiPlug (BD Biosciences) for 5 hours at 37°C in 5% CO₂. Cells were permeabilized using BD Cytofix/Cytoperm Fixation/Permeabilization solution kit (BD Biosciences). Intracellular staining was performed with PE anti-IL-4, APC anti-IFNγ, PE-Cy7 anti-IL-10 and FITC anti-TNF (Biolegend). To quantitate Tregs (CD4⁺CD127⁻CD25⁺Foxp3⁺), cells were stained for intracellular Foxp3 using the APC anti-human Foxp3 antibody kit (eBioscience). Flow cytometry was performed using a FACSCanto II (Becton Dickinson, Franklin Lakes, NJ), and the results were analyzed with FlowJo 8.7 software.

Determination of cytokine production

Secretion of IL-12p70, TNF, IL-10 and IFN-γ in Mo-mDC supernatant or coculture supernatant was determined using ELISA MAX^™ Deluxe (Biolegend®, San Diego, CA, USA), following the manufacturer’s instructions. Analysis was performed using SpectraMax M3 (Molecular Devices).

Statistical analysis

Data are shown as means ± standard error of the mean (SEM). Comparison of results was carried out using two-tailed paired Student t test when there were only two groups or one-way analysis of variance (ANOVA) followed by Tukey post test for multiple comparisons. Analysis were performed using GraphPad PRISM 6 software, and differences were considered significant at p <0.05.

Results

JQ1 inhibits STAT5 function in mature Mo-DCs

To understand the role of STAT5 in the maturation of human Mo-DCs, and to determine the potential of targeting this transcription factor therapeutically, we focused on pharmacological modulators of STAT5 in hematopoietic cells. Previous data demonstrated that the bromodomain inhibitor JQ1 reduces STAT5 function through the inhibition of BRD2 protein in leukemia and lymphoma cells (14). Therefore, we probed whether JQ1 could also inhibit STAT5 activity in Mo-DCs following LPS stimulus. LPS stimulation prominently increased the activating tyrosine phosphorylation of STAT5 in Mo-DCs. Treatment with JQ1 abrogated this effect, although it did not significantly alter STAT5 protein expression (Fig. 1A). The ratio of phosphorylated STAT5 to total STAT5 (pSTAT5/STAT5) was reduced by JQ1 in Mo-DCs induced to mature with LPS to the same levels observed in immature Mo-DCs (Fig. 1B). LPS can lead to activation of not only STAT5 but also STAT1 and STAT3 (23, 24). However, JQ1 had no significant effect on either tyrosine phosphorylation or total levels of either STAT1 or STAT3 in mature Mo-DCs, indicating that BET inhibition by JQ1 selectively reduces STAT5 activation without influencing the activation of other STATs (Fig. 1B).

FIGURE 1.

JQ1 inhibits STAT5 functional activity in Mo-DCs. Immature Mo-DCs (Mo-iDCs) were treated with JQ1 or vehicle for 1h and stimulated with LPS for 24h at which point cells were harvested. (A) Lysates from Mo-DCs treated as above were analyzed by immunoblotting for the phosphorylated or total form of STAT5. (B) Lysates of Mo-DCs were immunoblotted for the phosphorylated and total level of the indicated STAT protein, and the ratio of pSTAT/STAT was quantitated. Data are derived from three different donors. (left panel). Representative immunoblots for the phosphorylated and total form of STAT3 and STAT1 (right panel). (C) Nuclear extracts from Mo-DCs treated as above were analyzed by immunoblotting for STAT5. Jak inhibitor (Jaki) was used as positive control of STAT inhibition. PARP and actin are used as markers of the nucleus and cytoplasm, respectively. Data are representative of three independent experiments. (D) RNA from Mo-iDCs (without LPS) and Mo-mDCs (with LPS) pre-treated with JQ1 or vehicle was analyzed by quantitative (q)RT-PCR for expression of STAT5 target genes. RNA expression was normalized to 18S ribosomal RNA, and the fold increase was determined by dividing the expression in each sample by that of Mo-mDCs. Data are derived from five different donors. (E) STAT5 target gene expression analyzed by qRT-PCR was compared between Mo-mDCs untreated or treated with JQ1 and is shown as individual plots representing five different donors. (F) STAT5 DNA-binding to the indicated sites was analyzed by ChIP-qPCR. The results are expressed relative to a negative-control binding region in the rhodopsin gene. Experiments were performed with cells from five different donors, except for the Bcl-3 region (n=3) (G) mRNA expression of GM-CSF and its receptor (CSF2RA) were analyzed by qRT-PCR normalized to 18S RNA (left panel). Median intensity of fluorescence (MFI) of GM-CSF receptor (CD116) on Mo-mDC, analyzed by flow cytometry (right panel). Data are derived from five different donors. (H) STAT5 binding to the CSF2RA regulatory region was analyzed by ChIP-qPCR. Data are derived from five different donors. The error bars indicate means ± SEM. *p<0.05.

Following tyrosine phosphorylation, STATs translocate from the cytoplasm to the nucleus. Therefore, we next considered whether the inhibition in STAT5 phosphorylation was reflected in a decrease in nuclear localization of STAT5. We isolated the nuclear fraction from Mo-DCs induced to mature by LPS that had been pre-treated with JQ1 or vehicle alone. As a positive control, cells were also treated with Jak inhibitor I (Jaki), which completely blocks the Jak kinases upstream of STATs. In Mo-DCs, the nuclear accumulation of both total STAT5 protein and its phosphorylated form were increased following LPS stimulus. However, JQ1 treatment reduced nuclear localization of both phosphorylated and total STAT5 (Fig. 1C). These findings further confirm that JQ1 inhibits STAT5 activation and hence decreases STAT5 nuclear localization, which could inhibit its transcriptional activity.

We, therefore, next determined whether JQ1 affected the transcriptional activity of STAT5 in mature Mo-DCs (Mo-mDC) and how this compared with its transcriptional activity in immature Mo-DCs (Mo-iDC). We assessed the mRNA expression of endogenous STAT5 target genes, including CisH, Socs2, Socs3, Bcl-x, Bcl-6, Bcl-2 and Bcl-3 (Fig. 1D and 1E). Consistent with the induction of STAT5 phosphorylation, LPS stimulation led to increased expression of Socs2, Socs3, Bcl-x, Bcl-2 and Bcl-3, all of which was abrogated by JQ1 treatment. Bcl-6, which is repressed by STAT5, showed decreased expression following LPS stimulation, and JQ1-treatment tended to reverse this effect. Although LPS-induced maturation did not further increase CisH mRNA levels, JQ1 was found to repress the expression of CisH compared to control Mo-mDCs. Furthermore, ChIP analysis showed that maturation of Mo-DCs was associated with increased binding of STAT5 to the regulatory regions of CisH, SOCS2 and Bcl-3, and this recruitment of STAT5 was reduced following JQ1-treatment (Fig. 1F). To determine whether these alterations in STAT5 binding were associated with changes in transcription, we evaluated whether the regions of STAT5 binding corresponded to regions of transcriptionally active chromatin by performing ChIP assays for acetylated H4 histones (acetyl H4). There was a trend toward increased acetyl H4 in all of these regions following LPS stimulation, and a decrease in acetyl H4 in the presence of JQ1 (Supplemental Fig. S1A). Taken together, these results show that JQ1 directly inhibits STAT5 binding to the regulatory region of target genes and that this is associated with a decrease in transcriptionally active chromatin marks.

It is known that GM-CSF, signaling through STAT5, plays an important role in the differentiation of Mo-DCs, though its role during Mo-DC maturation is not certain. This raised the possibility that JQ1 could be inhibiting STAT5 by downregulating GM-CSF signaling in Mo-DCs stimulated with LPS. To address this question, we first evaluated whether the expression of GM-CSF and the specific alpha subunit of its receptor (CSF2RA) is affected by STAT5 inhibition upon JQ1-treatment of Mo-DCs. While LPS induced upregulation of both GM-CSF and CSF2RA mRNA expression, JQ1 completely blocked this effect (Fig. 1G). Consistent with this finding, the increased surface expression of the GM-CSF receptor (GM-CSFR or CD116) induced by LPS was significantly abrogated by JQ1-treatment (Fig. 1G). To determine the mechanism for this effect, we analyzed the CSF2RA regulatory region, and identified a strong potential STAT binding site in the CSF2RA regulatory region. We then performed ChIP to assess whether STAT5 could bind to this site during LPS-induced maturation. We found that STAT5 was recruited to this site in the CSF2RA promoter region following LPS stimulation, and this was inhibited by JQ1-treatment (Fig. 1H). To determine whether STAT5 binding in the CSF2RA promoter region is associated with chromatin marks of active transcription, we performed ChIP for acetyl H4. Similar to the STAT5 binding pattern, the levels of acetyl H4 trended towards an increase following LPS stimulation, and were at basal values in the presence of JQ1, indicating that STAT5 binding in the CSF2RA regulatory region is likely functional (Supplemental Fig. S1B). These data reveal CSF2RA as a novel STAT5 target gene in Mo-DCs.

Collectively, these results show that JQ1 selectively inhibits STAT5 tyrosine phosphorylation and decreases STAT5 nuclear translocation, resulting in decreased expression of STAT5 target genes. This decrease in STAT5 activity by JQ1 is associated with inhibition of expression of GM-CSF and the GM-CSF receptor.

JQ1 impairs the activation of Mo-DCs

Although accumulating evidence shows that STAT5 is required for in vitro differentiation of Mo-DCs, this transcription factor is also thought to be important for dendritic cells maturation (9, 25). Having found that JQ1 inhibits STAT5 activity in Mo-DCs, we next evaluated the effect of this drug on the expression of surface markers of Mo-DCs following LPS-induced maturation. Immature Mo-DCs were treated with JQ1 for 1 hour and stimulated by LPS for another 24 hours, at which point they were analyzed by flow cytometry. The increased expression of the activation marker CD83 and the costimulatory molecules CD80 and CD86 that occur in Mo-DCs stimulated by LPS, were strongly attenuated by JQ1 treatment, and reverted towards the expression pattern seen in immature Mo-DCs (Fig. 2A). Moreover, JQ1 inhibited the increased expression of these cell surface proteins in a dose-dependent manner (Fig. 2B). This was not a general effect of JQ1, as the expression of other molecules, such as CD14, CD11c, HLA-DR and CD40 remained unaffected (Fig. 2A and Supplemental Fig. S2B). The unaltered expression of these molecules indicates that the cells retain the characteristics of myeloid Mo-DCs, and maintain the capability for antigen-presentation (signal 1, based on HLA-DR expression) and the ability to respond to the maturation signal dependent on CD40. Importantly, JQ1 did not affect the viability of Mo-DCs at any dose tested (Supplemental Fig. S2A). These findings show that JQ1-treated Mo-DCs display an impaired maturation capacity, though not a complete block of maturation.

FIGURE 2.

JQ1 attenuates Mo-DC maturation. (A) On day 5, immature Mo-DCs pre-treated with JQ1 for 1h were treated with LPS to induce maturation, and 24h later mature Mo-DCs (Mo-mDCs) were analyzed for the expression of DC surface markers by flow cytometry. Doublets were excluded from analysis and Mo-DCs were defined as CD14⁻HLA-DR⁺. Median intensity of fluorescence (MFI) of Mo-mDC surface molecules is shown in histograms representative of seven independent experiments. Unfilled curves represent autofluorescence of control cells unstained with antibody. (B) Dose-response of JQ1 on expression of CD80, CD86 and CD83, as analyzed by flow cytometry. MFI is shown relative to that of Mo-mDCs. Data are shown as means ± SEM of seven independent experiments. (C) STAT5 DNA binding to the indicated sites was analyzed by ChIP-qPCR. The results are expressed relative to a negative-binding control region in the rhodopsin gene. Experiments were performed with cells from 5 different donors. (D) The expression of cytokines by Mo-DCs treated as above was analyzed by qPCR. RNA expression was normalized to 18S RNA, and the fold increase was determined by dividing the expression in each sample by that of Mo-mDCs. Data are shown as means ± SEM of six independent experiments. (E) Cytokine production was measured by ELISA from the supernatant of Mo-mDCs treated with JQ1 or vehicle. Each individual plot represents one different donor. *p<0.05, **p<0.0001.

The decreased induction of these key cell surface molecules raised the possibility that JQ1 decreased the maturation of Mo-DCs by directly inhibiting the interaction of STAT5 with the genomic regulatory sequences of these genes. To address this issue, we identified a potential STAT5 binding site in the regulatory region of CD83 and we focused on a previously described biding site in the CD80 regulatory region (26). Interestingly, we did not identify STAT5 binding sites in the proximal regulatory region of CD86, raising the question of whether STAT5 regulates CD86 through a distant enhancer locus or regulates this gene indirectly through other transcription factors. We then performed ChIP to determine the relative binding of STAT5 at the CD83 and CD80 regulatory regions. While LPS treatment increased STAT5 binding to both the CD83 and the CD80 regulatory regions, pre-treatment with JQ1 reduced STAT5 recruitment, consistent with the decreased STAT5 phosphorylation and nuclear translocation observed with JQ1 treatment (Fig. 2C). Moreover, we performed ChIP for acetyl H4 to evaluate a marker of transcriptionally active chromatin in the regulatory regions of CD83 and the CD80. We observed that acetyl H4, which was increased after LPS stimulation, was present at only basal levels in Mo-mDCs pre-treated with JQ1 (Supplemental Fig. S1C).

Taken together, these data demonstrate that JQ1 specifically decreases CD83 and CD80 expression, and reduces STAT5 recruitment to their regulatory regions, which display evidence of less transcriptionally active chromatin. This represents one significant mechanism by which JQ1 treatment can lead to the impaired maturation of Mo-DCs.

JQ1 modulates cytokine production by Mo-DCs

To further evaluate the effect of JQ1 on the phenotype of Mo-DCs, we analyzed whether JQ1 could also interfere with the production of pro-inflammatory (IL-12 and TNF) and anti-inflammatory (IL-10 and TGF-β) cytokines. As expected, immature Mo-DCs had lower mRNA expression of IL-12 and TNF, but higher expression of IL-10 and TGF-β compared to Mo-DCs following LPS-induced maturation (Fig. 2D). JQ1 blocked the increase in IL-12 and the decrease in TGF-β that occurs with LPS-induced maturation (Fig. 2D). Notably, immature Mo-DCs treated with JQ1 showed no change in IL-12 or TGF-β expression (Fig. 2D). In contrast to IL-12, the increase in TNF expression with maturation was unchanged by JQ1. JQ1 treatment reduced IL-10 expression in both immature and mature Mo-DCs. This decreased expression was of similar magnitude (approximately 50%) for Mo-iDC and Mo-mDC treated with JQ1 compared to vehicle treatment (Fig. 2D). Consistent with these findings, we observed that the secretion of IL-12p70 and IL-10 by mature Mo-DCs treated with JQ1 was significantly reduced compared to that of control mature Mo-DCs. On the other hand, the amount of TNF measured in Mo-DC supernatant was unaltered by JQ1 (Fig. 2E). These data confirm that JQ1 is impairing the maturation of Mo-DC.

The inhibitory effect of JQ1 in Mo-DC is dependent on inhibition of Stat5

Since JQ1 can inhibit the effects of other transcription factors dependent on bromodomain-containing proteins, we wished to test the hypothesis that the effect of JQ1 on dendritic cell maturation was dependent on its effect on STAT5. JQ1 repressed GM-CSF expression in Mo-mDCs (Figure 1G). We therefore considered the possibility that the addition of exogenous GM-CSF could increase STAT5 activity in JQ1-treated Mo-DCs and, consequently, enhance the maturation of Mo-DCs. To address this, Mo-DCs pre-treated with JQ1 were stimulated by LPS in the presence of human recombinant GM-CSF, and the expression of CD80, CD86 and CD83 were analyzed by flow cytometry. Notably, the addition of GM-CSF did not increase the expression of CD80, CD86 and CD83 on mature Mo-DCs, which suggests that decreased expression of GM-CSF receptor functionally restricts this pathway (Fig. 3A).

FIGURE 3.

The effects of JQ1 on Mo-DC maturation are STAT5-dependent. (A) Immature Mo-DCs were treated with JQ1 (0.25 μM) for 1h and maturation was induced by LPS (100 ng/mL) in the presence of human recombinant GM-CSF (50 ng/mL). After 24 hours, cells were analyzed by flow cytometry for the expression of CD80, CD86 and CD83. The Mo-DC population was defined by gating CD14⁻HLA-DR⁺ cells excluded of doublets. MFI is shown relative to that of Mo-mDCs. Data are shown as mean ± SEM of three independent experiments. (B, C, D, E) Mo-iDCs were transduced with a lentivirus expressing caSTAT5 or empty vector for 150 min, at which time the media was changed and cells were treated with JQ1 or DMSO for 1 hour followed by LPS stimulation. (B) mRNA expression of GM-CSF and CSF2RA were analyzed 24 hours after LPS-induced maturation by qPCR (normalized to 18S RNA). (C) The population of Mo-DCs was defined by gating on CD14⁻HLA-DR⁺ cells within the eGFP+ population, which are expressing caSTAT5 (upper panel). Then, the expression of CD80, CD86 and CD83 were assessed by flow cytometry (bottom panel), with data presented for 5 different donors. (D) mRNA for IL-12 and TGF-β was quantitated in JQ1-treated Mo-mDCs after transduction with caSTAT5 or empty vector. Two independent experiments are shown. D1, donor 1; D2, donor 2. (E) mRNA expression analysis of STAT5 target genes expressed by JQ1-treated Mo-mDCs after transduction with caSTAT5 or empty vector. Data are shown as mean ± SEM of two independent experiments. *p<0.05.

To directly assess the role of STAT5 in Mo-DC maturation, we transduced Mo-DCs with a lentiviral vector encoding eGFP alone or eGFP and a constitutively active form of Stat5 (caSTAT5). The caSTAT5 mutant has constitutive STAT5 transcriptional activity and can overcome the inhibitory effects of JQ1 (14). After transduction, Mo-DCs were treated with JQ1 and maturation was induced with LPS. To confirm the functional activity of the caSTAT5, we measured expression of the STAT5 target genes GM-CSF and CSF2RA, both of which were prominently induced (Fig. 3B). Then, we investigated the expression of CD80, CD86 and CD83 in the caSTAT5-transduced Mo-DCs, considering only the eGFP⁺CD14⁻HLA-DR⁺ subpopulation in the analysis. Even in the presence of JQ1, caSTAT5 significantly enhanced the expression of CD86 and CD83 (though not CD80) compared with empty vector-transduced Mo-DCs (Fig. 3C). Furthermore, the levels of IL-12 were notably increased by caSTAT5-transduced Mo-DCs in the presence of JQ1, while TGF-β remained unchanged (Fig. 3D). Additionally, the expression of caSTAT5 resulted in the upregulation of the STAT5 target genes CisH and Bcl-x, which were previously shown to be repressed by JQ1 (Fig. 3E). These data show that the effect of JQ1 in decreasing the maturation of Mo-DCs is dependent, at least in part, on its effect upon Stat5.

GM-CSF is required for the complete maturation of Mo-DC

It has been shown that stimulation of human monocytes with LPS leads to activation of STAT5, which is dependent on GM-CSF that is secreted by these cells (23). To determine whether a similar mechanism occurs in the maturation of Mo-DCs stimulated with LPS, we first investigated whether the activation of STAT5 induced by LPS occurs as consequence of GM-CSF produced by mature Mo-DCs or directly by LPS itself. We performed a detailed time course of STAT5 phosphorylation following LPS stimulation. We did not detect enhanced STAT5 phosphorylation at any time point up to 180 minutes as would be expected to occur with a direct inducer of STAT5 activity like a cytokine (Fig. 4A). By contrast, we detected increased STAT5 phosphorylation 24 hours following LPS addition, suggesting an indirect effect. Consistent with such a mechanism, we found upregulation of GM-CSF and CSF2RA occurred no earlier than 1 hour and 3 hours, respectively, following LPS stimulation (Fig. 4B). These data suggested that LPS stimulation induces the production of both GM-CSF and GM-CSFR, which in turn triggers STAT5 phosphorylation.

FIGURE 4.

GM-CSF signaling is essential for the full maturation of Mo-DCs. (A) Immature Mo-DCs were stimulated with LPS for the indicated times, and lysates were obtained and analyzed by immunoblotting for the phosphorylated (p) or total form of STAT5. (B) RNA from Mo-iDCs stimulated with LPS (as described) was analyzed by qRT-PCR for the expression of GM-CSF and GM-CSF receptor (CSF2RA), normalized to 18S RNA. (C, D, E) Mo-iDCs were stimulated with LPS in the presence of anti-GM-CSF neutralizing antibody (anti-GM). (C) Lysates were obtained 24 hours after LPS stimulation and analyzed by immunoblotting for phosphorylated or total STAT5. (D) Mo-DCs treated as indicated were harvested 48 hours following LPS stimulation, and analyzed by flow cytometry for the expression of CD116 (GM-CSF receptor, α chain) or (E) for the expression of CD80, CD86 and CD83. The Mo-DC population was defined by gating CD14⁻HLA-DR⁺ cells excluding doublets. MFI, median fluorescent intensity. Data are shown as mean ± SEM of six independent experiments. *p<0.05, compared with other groups. ^#p<0.05, compared with time 0 hours (Mo-iDC).

To determine the importance of GM-CSF during the maturation of Mo-DCs induced by LPS, we used an antibody to neutralize the activity of GM-CSF and analyzed whether this affected STAT5 phosphorylation and the expression of CD80, CD86 and CD83. Mo-DCs were differentiated with IL-4 and GM-CSF for 5 days, the culture media was replaced with fresh media without GM-CSF, and Mo-DCs were then stimulated with LPS in the presence or absence of anti-GM-CSF neutralizing antibody. Blocking GM-CSF during Mo-DC maturation decreased STAT5 phosphorylation compared to control Mo-mDCs, and significantly reduced the upregulation of GM-CSF receptor (CD116) (Fig. 4C and D). Furthermore, the increased expression of CD80, CD86 and CD83 induced by LPS was attenuated by anti-GM-CSF (Fig. 4E). These results show that a GM-CSF autocrine loop contributes to the maturation of Mo-DCs.

JQ1 reduces allogeneic T-cell proliferation mediated by Mo-mDCs

Having demonstrated that JQ1 inhibited the expression of cytokines and cell surface markers associated with Mo-DC maturation, we next wished to test the physiologic role of JQ1 inhibition on Mo-DC function. To do this, we assessed the ability of JQ1-treated Mo-mDCs to induce allogeneic T-cell responses in vitro, by analyzing T cell proliferation. We cultured allogeneic CD3⁺ T cells with mature Mo-DCs that had been treated with JQ1 or vehicle, and analyzed the proliferation of T-cells through cell trace dilution with flow cytometry. JQ1-treated Mo-mDCs supported significantly less proliferation of both CD4⁺ and CD8⁺ T cells, compared with that induced by vehicle treated Mo-mDCs (Fig. 5). These findings show that JQ1-treated Mo-DCs only weakly stimulate T cells proliferation, consistent with their impaired maturation capacity.

FIGURE 5.

JQ1-treated Mo-DCs support decreased allogeneic T-cell proliferation. The proliferation of bead-isolated allogeneic responder CD3⁺ T cells was assessed to determine the immunostimulatory capacity of LPS-matured Mo-DCs in the presence or absence of JQ1. JQ1- or vehicle-treated Mo-mDCs were cocultured with allogeneic CellTrace Violet labeled CD3⁺ T cells for 5 days. Plots representing the proliferation of CD4⁺ and CD8⁺ T cells measured by CellTrace dilution, assessed by flow cytometry (right panel). Numbers in the plots represent the frequency of undivided cells (right) and frequency of highly proliferating cells (left). The proliferation index of CD4⁺ (upper) and CD8⁺ (bottom) T cells was calculated with FlowJo 8.7 software (left panel). Data are shown as mean ± SEM of eight independent experiments. *p<0.05.

JQ1-treated Mo-DCs support decreased T-cell-mediated pro-inflammatory cytokine production and inhibit Th1 polarization

To explore the pattern of T-cell-mediated response that is being induced by Mo-mDCs treated with JQ1, we next measured the cytokine profile in the co-culture supernatant. Allogeneic T-cells stimulated by JQ1-treated Mo-mDC produced less inflammatory cytokines, such as IFN-γ and TNF than T-cells cultured with untreated Mo-mDCs. Furthermore, the production of the anti-inflammatory cytokine IL-10 was significantly decreased (Fig. 6A).

FIGURE 6.

T-cells stimulated by JQ1-treated Mo-DCs produce less pro-inflammatory cytokines and selectively inhibit Th1 polarization. (A) The cytokine concentrations in the supernatants of CD3⁺ T cells cocultured with Mo-mDCs were measured by ELISA. (B) CD3⁺ T cells cocultured with Mo-DCs induced to mature in the presence or absence of JQ1 were analyzed by intracellular staining of cytokines produced by CD4⁺ and CD8⁺ T cells. Upper plots show TNF and IFNγ-producing CD8⁺ T cells. Middle plots show the percentage of TNF and IFNγ (Th1-type) produced by CD4⁺ T cells. Bottom plots show the percentage of IL-10 and IL-4 (Th2-type) produced by CD4⁺ T cells. Graphical representation of the frequency of CD8⁺ TNF⁺, CD8⁺ IFNγ⁺, CD4⁺ TNF⁺, CD4⁺ IFNγ⁺, CD4⁺ IL-4⁺, CD4⁺ IL-10⁺ cells, are shown on the right, with each data point representing the sum of the frequencies of single and double-positive cells for each cytokine. Data are shown as mean ± SEM of five independent experiments performed in duplicate, and were analyzed by a paired T-test. (C) Mo-iDCs and Mo-mDCs pre-treated with JQ1 or vehicle were cocultured with CD3⁺ T cells, and were assessed for the induction and expansion of Tregs. Tregs were defined by gating CD4⁺ CD127⁻CD25⁺FOXP3⁺ cells. Plots are representative of five independent experiments. *p<0.05.

Depending on the signal provided during the interaction with DCs, T cells differentiate toward pro-inflammatory (Th1) or anti-inflammatory (Th2 and Treg) cells (27). Therefore, we determined whether JQ1-treated Mo-mDC would alter CD4⁺ T-cell polarization. We assessed the percentage of IFN-γ and TNF (Th1-type) or IL-4 (Th2-type) and IL-10-producing cells by intracellular cytokine staining. Compared with the enhanced IFN-γ and TNF-producing T cells induced by untreated Mo-mDCs, CD4⁺ T cells displayed a low percentage of cells producing IFN-γ and TNF when stimulated by JQ1-treated Mo-mDCs (Fig. 6B). On the other hand, JQ1 did not alter the ability of Mo-mDCs to induce IL-4 and IL-10-producing CD4⁺ T-cells (Fig. 6B).

We also found that JQ1 treatment impaired the ability of Mo-mDCs to induce IFN-γ and TNF-producing CD8⁺ T-cells (Fig. 6B). Moreover, Mo-mDCs treated with JQ1 did not modify the induction/expansion of CD4⁺CD127⁻CD25⁺ T-regulatory cells (Fig. 6C). These data indicate that JQ1-treated Mo-DCs display a decreased Th1 polarization activity while maintaining an unaffected ability to induce Th2 cells and Tregs.

The selective inhibition of STAT5 by JQ1 resembles the inhibition of STATs by Jaki on phenotype and function of Mo-DCs

To determine whether the effect of JQ1 on Mo-mDCs was causally related to STAT5 inhibition, we treated Mo-DCs with Jaki and then induced their maturation with LPS. We analyzed the phenotype and function of these Mo-mDCs through the expression of surface markers and their ability to stimulate T cells proliferation, respectively. Similar to Mo-mDCs treated with JQ1, the increased expression of the molecules CD80, CD86 and CD83 was inhibited by Jaki treatment, while expression of CD11c and HLA-DR were not significantly changed (Fig. 7A). Interestingly, CD40 expression was also downregulated by Jaki treatment, whereas JQ1 did not significantly affect CD40 expression (Fig. 2A). This may reflect the effect of Jaki on signaling pathways other than STAT5. Like JQ1, Jaki-treated Mo-mDCs induced less T CD4⁺ and T CD8⁺ proliferation when compared to untreated Mo-mDCs (Fig. 7B). These data show that the specific inhibition of STAT5 by JQ1 was comparable to the inhibition of STATs by Jaki, and indicate that STAT5 plays a key role in maintaining phenotype and function of Mo-DCs as efficient antigen-presenting cells.

FIGURE 7.

Jak inhibition leads to a similar phenotype in Mo-DCs as selective inhibition of STAT5 by JQ1. (A) Immature Mo-DCs pre-treated with Jaki were matured with LPS and analyzed for the expression of surface molecules by flow cytometry. Doublets were excluded from analysis and Mo-DCs were defined as CD14⁻HLA-DR⁺. Bar graphs display median intensity of fluorescence (MFI) of Mo-mDC markers. Data are shown as the mean ± SEM of six independent experiments. (B) Jaki-treated Mo-mDCs or vehicle-treated Mo-mDCs were cocultured with allogeneic CellTrace Violet labeled CD3⁺ T cells for 5 days. Flow cytometry was used to determine the proliferation of CD4⁺ and CD8⁺ T cells, as measured by CellTrace dilution (right panel). Numbers in the plots represent the frequency of undivided cells (right) and frequency of highly proliferating cells (left). Plots are representative of eight independent experiments. The proliferation index of CD4⁺ (upper) and CD8⁺ (bottom) T cells was calculated with FlowJo 8.7 software (left panel). Data are shown as mean ± SEM of eight independent experiments. *p<0.05, **p<0.0001, ^#p<0.05.

Discussion

The manipulation of DCs to generate cells able to modulate the immune response is an appealing approach to treat patients with excessive inflammation and autoimmunity. Here we show that the BET bromodomain inhibitor JQ1 has immunomodulatory effects on DCs that could be exploited for this purpose. The presence of JQ1 during LPS-induced maturation of Mo-DCs leads to a dose-dependent reduction of CD80, CD86 and CD83 expression. In addition, JQ1-treated Mo-mDCs exhibit markedly reduced production of IL-12p70 and IL-10, but not of TNF. These effects of JQ1 on Mo-mDCs depend on its inhibition of STAT5, since introduction of a constitutively active form of STAT5 can reverse the effects of JQ1. The activation of STAT5 in maturing Mo-DCs occurs through the production of GM-CSF induced by LPS stimulation, which activates a positive feedback GM-CSF/GM-CSFR/STAT5 autocrine loop. Co-culture of JQ1-treated Mo-mDCs with allogeneic T cells results in significantly reduced IFN-γ and TNF production whereas IL-4 is unchanged. Also, the ability of JQ1-treated Mo-mDCs to trigger CD4⁺ and CD8⁺ T-cells response is lower when compared to control Mo-mDCs.

The precise relevance of STAT5 for the maturation of DCs has been uncertain. Since STAT5 is a mediator of the biological effects of GM-CSF, previous reports have focused more on studying the role of STAT5 during the differentiation of DCs (9, 25, 28, 29), rather than during their maturation. STAT5 is continuously activated during the maturation of murine DCs into immunogenic antigen-presenting cells, suggesting its involvement in this process (9, 25). Here, we used JQ1 as a potentially clinically relevant inhibitor of STAT5 function to investigate its role in human Mo-DCs, differentiated in the presence of GM-CSF and IL-4, which are induced to mature under LPS stimulation. JQ1 has been reported to inhibit STAT5 phosphorylation and transcriptional activity in a range of cancer cell lines (14, 17), but its effect in human DCs has not been previously described. We show here that in human LPS-matured Mo-DCs, JQ1 inhibits STAT5 phosphorylation and subsequent nuclear translocation, thereby inhibiting the transcription of target genes including CisH, Socs2, Bcl-x and Bcl-3. Confirming the role of JQ1 in disrupting STAT5-regulation of these genes we found decreased DNA-binding of STAT5 to the regulatory region of CisH and Bcl-3, which was correlated with regions of chromatin less transcriptionally active. CisH, a well-described specific STAT5 target gene (25, 28), can drive murine DC differentiation toward an immunogenic phenotype through GM-CSF-activated STAT5 (25). Similarly, Socs2, a regulatory molecule that belongs to the same family as CisH, appears to be essential for DC maturation induced by LPS (30). These data support our findings that the downregulation of STAT5-mediated expression of CisH and Socs2 by JQ1 could account for the decrease of Mo-DC maturation. The inhibition of STAT5 activity in Mo-mDCs by JQ1 is associated with the ability of this drug to prevent GM-CSF signaling, which is critical for LPS-induced STAT5 activation (23). We found that JQ1 blocked the ability of LPS to induce expression of both GM-CSF and its receptor (CSF2RA). Moreover, we found that STAT5 binds to the CSF2RA promoter, suggesting that CSF2RA is a novel STAT5 target gene that is directly repressed by JQ1 treatment.

The effects of JQ1 on the function of Mo-mDCs may be due to its inhibition of the expression of cell surface molecules on these cells. CD80 and CD86 upregulation was decreased by JQ1 in LPS-stimulated Mo-DCs. This resulted in defective co-stimulatory capacity, the second classical signal needed for naïve T-cells activation (31). Similar findings were demonstrated in mice lacking STAT5 in CD11c⁺ cells, which showed impaired CD80 and CD86 expression and inhibition of Th2 response upon thymic stromal lymphopoietin (TSLP) treatment (32, 33). Moreover, JQ1-treated Mo-mDCs also displayed reduced CD83 expression, an important maturation marker described as essential for the induction of T-cell proliferation and IFN-γ production (34, 35). Interestingly, JQ1 directly decreased the recruitment of STAT5 to the CD83 regulatory region, indicating that CD83 is a potential STAT5 target gene. Contributing to the lower immunostimulatory activity of JQ1-treated Mo-mDCs, the production of IL-12 by these cells was markedly reduced when compared to control Mo-mDCs, while TGF-β was produced at elevated levels. Interestingly, TNF was unaffected by JQ1 treatment of Mo-mDCs, and IL-10 was decreased, indicating that these molecules are not responsible for the reduced maturation capacity of these cells. These characteristics of JQ1-treated Mo-mDCs strongly suggest that this drug is impairing the full maturation of Mo-DCs even upon LPS stimulus.

Because of the reduced expression of CSF2RA in Mo-mDCs treated with JQ1, the addition of human recombinant GM-CSF simultaneously with LPS was unable to induce STAT5 activation or enhance the expression of CD80, CD86 and CD83 in these cells. However, introduction of caSTAT5 restored the expression both of GM-CSF and CSF2RA, suggesting a positive feedback loop involving the induction of expression of these molecules by STAT5. Notably, when activated STAT5 was restored, the defective phenotype of JQ1-treated Mo-mDCs was reversed, at least partially, as demonstrated by increased expression of CD86 and CD83 and increased IL-12 levels, thus confirming the important role of STAT5 in Mo-DC activation induced by LPS. Although we found that STAT5 binds to the CD80 regulatory region, the introduction of caSTAT5 did not rescue the expression of this molecule in the presence of JQ1, suggesting that other cooperating factors are necessary. It has recently been reported that the presence of both STAT5a and STAT5b is necessary for the induction of CD80 expression in cutaneous T cell lymphoma cells (26). Thus, one possibility is that the constitutively activated STAT5a expressed in this experiment was not sufficient to mediate expression of CD80 without an activated form of STAT5b present as well. It is also possible that STAT5 must cooperate with other transcription factors dependent on bromodomain-containing proteins, which are inhibited by JQ1.

Since STAT5 activation contributes to the expression of CD83, co-stimulatory molecules, and IL-12 in LPS-stimulated Mo-DCs, our data support the hypothesis that STAT5 is important not only for Mo-DC differentiation (as previously described (11, 13)) but also for their complete maturation. We also found that LPS induces expression of GM-CSF and GM-CSFR prior to the time that phosphorylation of STAT5 can be detected, and that neutralization of GM-CSF during Mo-DC maturation blocks STAT5 activation and decreased the upregulation of GM-CSFR, CD80, CD86 and CD83, similar to the effects of JQ1. Furthermore, activated STAT5 directly induces increased GM-CSF and GM-CSFR levels, which consequently increases STAT5 signaling. These findings clearly demonstrate that this GM-CSF/STAT5 positive feedback loop is required for full maturation of Mo-DCs.

As expected from their cell surface phenotype and cytokine secretion pattern, JQ1-treated Mo-mDCs had a compromised ability to induce T-cell proliferation. Indeed, both CD8 and CD4 T-cells stimulated by JQ1-treated Mo-mDCs produced lower amounts of the pro-inflammatory cytokines IFN-γ and TNF. This is in agreement with the decreased IL-12 production by JQ1-treated Mo-mDCs. Furthermore, JQ1-treated Mo-mDCs did not affect Th2 generation or the induction and expansion of CD4⁺CD127⁻CD25⁺ T-regulatory cells. These results are in agreement with the direct effect of JQ1 on T-cells, in which JQ1 does not interfere with the differentiation of human or murine Th2 or Tregs from naïve CD4⁺ T-cells (36). Thus, JQ1-treated Mo-mDCs can inhibit Th1 differentiation (inflammatory response) but not the differentiation of other T-cell subtypes.

In summary, we have shown that the BET inhibitor JQ1 has immunosuppressive properties. The selectively of JQ1 in inhibiting the activating tyrosine phosphorylation of STAT5, but not other STATs, as previously reported (14), is sufficient to disrupt the phenotype and function of Mo-mDCs. Compounds with the potential to downregulate pathogenic immune responses while preserving protective immunity are highly desirable to prevent serious adverse effects caused by tyrosine kinase inhibitors. Thus, JQ1 might be such a selective agent, which could be used to treat immune-mediated disease. JQ1 has been shown to have anti-oncogenic properties (14, 17) and the potential to inhibit innate immune responses by murine macrophages (18, 19). Here we report that JQ1 may also profoundly affect the initiation of an adaptive immune response by reducing co-stimulation (signal 2) and production of pro-inflammatory cytokines (signal 3) in human Mo-DCs stimulated by LPS (Fig. 8). Mechanistically, the induction of STAT5 phosphorylation occurs in two phases. First, LPS induces GM-CSF and GM-CSFR (CSF2RA) expression, which initially activates STAT5. Consequently, STAT5 leads to the expression of maturation markers of Mo-DCs, and also induces further expression of GM-CSF and GM-CSFR. This autocrine production of GM-CSF and GM-CSFR further enhances STAT5 signaling, generating a positive feedback mechanism (Fig. 8). This is important to enable Mo-DCs to acquire a more mature phenotype, and it can be inhibited by JQ1 through targeting STAT5. Thus, our data support a significant role for GM-CSF/GM-CSFR-mediated STAT5 phosphorylation in human Mo-DC maturation, and indicate that this transcription factor is the likely target of JQ1 (Fig. 8), though the involvement of other transcription factors cannot be completely ruled out. Taken together, these findings suggest that JQ1 has the potential to be a novel immunomodulatory drug that could have beneficial effects in patients with T-cell mediated inflammatory diseases.

FIGURE 8.

JQ1 impairs full maturation of Mo-DC by interfering with GM-CSF/STAT5 signaling. LPS stimulation induces maturation of Mo-DCs by increasing the expression of MHC, costimulatory molecules, and CD83, and inducing increased secretion of pro-inflammatory cytokines, thus effectively priming T cell responses. STAT5 activation occurs in two phases. First, LPS induces the expression of GM-CSF and the GM-CSF receptor (GM-CSFR), resulting in STAT5 phosphorylation, nuclear translocation, and transcription of its target genes, including CD80, CD83, GM-CSF and GM-CSFR. Second, the increased GM-CSF and GM-CSFR induced by STAT5 activation further enhances STAT5 signaling, which is necessary to provide the stimulation required for the complete maturation of Mo-DCs. JQ1 inhibits STAT5 activation, thereby decreasing the Mo-DC maturation process by preventing upregulation of CD80, CD86 and CD83, and reducing the secretion of IL-12, resulting in a decreased induction of pro-inflammatory T cells.

Abbreviations used in this article

Mo-DCs

monocyte-derived dendritic cells

Mo-iDCs

immature monocyte-derived dendritic cells

Mo-mDCs

mature monocyte-derived dendritic cells

CSF2RA

colony stimulating factor 2 receptor alpha