Urotensin-II Receptor Stimulation of Cardiac L-type Ca²⁺ Channels Requires the βγ Subunits of G_i/o-protein and Phosphatidylinositol 3-Kinase-dependent Protein Kinase C β1 Isoform

Background: Regulation of L-type Ca²⁺ channels has important roles in determining the electrical properties of cardiomyocytes.

Results: U-II potentiates I_Ca,L via U-IIR that couples to the PI3K-dependent PKCβ₁ isoform.

Conclusion: U-IIR stimulation of I_Ca,L contributes to the increase in the amplitude of sarcomere shortening.

Significance: Regulation of I_Ca,L by U-IIR plays important roles in cardiovascular actions including cardiac positive inotropic effects and increasing cardiac output.

Abstract

Recent studies have demonstrated that urotensin-II (U-II) plays important roles in cardiovascular actions including cardiac positive inotropic effects and increasing cardiac output. However, the mechanisms underlying these effects of U-II in cardiomyocytes still remain unknown. We show by electrophysiological studies that U-II dose-dependently potentiates L-type Ca²⁺ currents (I_Ca,L) in adult rat ventricular myocytes. This effect was U-II receptor (U-IIR)-dependent and was associated with a depolarizing shift in the voltage dependence of inactivation. Intracellular application of guanosine-5′-O-(2-thiodiphosphate) and pertussis toxin pretreatment both abolished the stimulatory effects of U-II. Dialysis of cells with the QEHA peptide, but not scrambled peptide SKEE, blocked the U-II-induced response. The phosphatidylinositol 3-kinase (PI3K) inhibitor wortmannin as well as the class I PI3K antagonist CH132799 blocked the U-II-induced I_Ca,L response. Protein kinase C antagonists calphostin C and chelerythrine chloride as well as dialysis of cells with 1,2bis(2aminophenoxy)ethaneN,N,N′,N′-tetraacetic acid abolished the U-II-induced responses, whereas PKCα inhibition or PKA blockade had no effect. Exposure of ventricular myocytes to U-II markedly increased membrane PKCβ₁ expression, whereas inhibition of PKCβ₁ pharmacologically or by shRNA targeting abolished the U-II-induced I_Ca,L response. Functionally, we observed a significant increase in the amplitude of sarcomere shortening induced by U-II; blockade of U-IIR as well as PKCβ inhibition abolished this effect, whereas Bay K8644 mimicked the U-II response. Taken together, our results indicate that U-II potentiates I_Ca,L through the βγ subunits of G_i/o-protein and downstream activation of the class I PI3K-dependent PKCβ₁ isoform. This occurred via the activation of U-IIR and contributes to the positive inotropic effect on cardiomyocytes.

Introduction

Urotensin-II (U-II)³ is a cyclic peptide first identified in the goby urophysis, an endocrine organ homologous in structure to the mammalian hypothalamoneurohypophysial axis (1). Following the cloning of carp U-II cDNAs (2), U-II has since been cloned from additional vertebrates including humans (3). The orphan G-protein-coupled receptor GPR14 (3), subsequently redesignated the urotensin-II receptor (U-IIR) (4), has been identified as the endogenous receptor for U-II. Consistent with the broad distribution of U-IIR in the central nervous system (CNS) and peripheral organs (2, 5), U-II exerts a large array of behavioral effects and regulates a variety of physiological processes including stimulation of prolactin and thyrotropin release (6), modulation of immune function (7), enhancement of rapid eye movement sleep duration (8), and energy balance (5). In the cardiovascular system, particularly in the heart, both U-II and the U-IIR are endogenously expressed (2), suggesting that U-II may be an endogenous modulator of mammalian cardiovascular function. Indeed, U-II has been shown to exert potent contractile force of cardiac muscle in vitro (9). U-II has also been reported to increase cardiac output in healthy humans and in patients with heart failure (10–12) independently of serotonin or β-adrenergic receptors (9). In addition, U-II has a positive inotropic effect and improves cardiac performance in rats with congestive heart failure as indicated by increases in left ventricular maximum dP/dT (an index of myocardial contractility) and left ventricular fractional shortening (2, 5, 13, 14). However, the mechanisms underlying these effects of U-II in cardiomyocytes remain unknown.

L-type Ca²⁺ channels are voltage-dependent channels that open in response to membrane depolarization, permitting entry of Ca²⁺ into the cell (15). Ca²⁺ entry through L-type Ca²⁺ channels is critical in the control of excitation-contraction coupling of cardiac, skeletal, and smooth muscle cells and contributes to physiological frequency regulation in the sinus node (16–18). Furthermore, the L-type Ca²⁺ channel is important for determining the duration of the plateau phase of the action potential and refractoriness. It is also involved in Ca²⁺ release from the sarcoplasmic reticulum, raising the free intracellular Ca²⁺ concentration and allowing cell contraction (18–21). Importantly, these channels are modulated by a variety of hormones and transmitters operating via G-protein-coupled receptors and second messengers (22), thereby profoundly affecting target tissue functions.

However, little is known about the mechanism(s) involved in the effect of U-II on L-type Ca²⁺ channels in the heart. Therefore, the present study sought to elucidate the signaling pathways implicated in L-type Ca²⁺ channel modulation by U-II in adult rat ventricular myocytes.

EXPERIMENTAL PROCEDURES

Pharmacological Agents

All the chemicals were obtained from Sigma-Aldrich unless otherwise stated. QEHA and SKEE peptides (23) were synthesized by GenScript Corp. βIV5-3 (24) and βIIV5-3 (24, 25) were synthesized by American Peptide, Inc. Stock solutions of U-II, GDP-β-S, pertussis toxin (PTX), cholera toxin, chelerythrine chloride, Ro 31-8220, BAPTA, and dn-BAPTA were prepared in distilled deionized water. Stock solutions of wortmannin, calphostin C, KT-5720, forskolin, LY333531, CH5132799, Bay K8644, HBDDE, and palosuran were prepared in dimethyl sulfoxide (DMSO). The final concentration of DMSO in the bath solution was less than 0.01% and had no functional effects on L-type Ca²⁺ channel currents (data not shown).

Isolation of Ventricular Myocytes

All the procedures and protocols conformed to the Guide for Care and Use of Laboratory Animals published by the National Institutes of Health, and the local institutional ethical committee approved the study. Left ventricular myocytes were enzymatically dissociated from rat hearts using a modified method described previously (26, 27). Briefly, male Sprague-Dawley rats (200–300 g) were injected with heparin (1000 IU intraperitoneally) and then euthanized in a CO₂ chamber. The heart was dissected out and transferred to ice-cold Tyrode's solution. The aorta was cannulated, and the heart was mounted on a Langendorff apparatus and perfused with prewarmed (37 °C) and oxygenated Tyrode's solution containing protease type XIV and collagenase type I for 12 min until the heart was flaccid. The left ventricles were dissected out, cut into small pieces, and gently bathed in Tyrode's solution. Isolated cells were filtered and maintained in oxygenated Kraft-Brühe (KB) solution. Cells with a rod shape and clear cross-striation were used for experiments. For short hairpin RNA (shRNA) knockdown experiments, primary cultures of adult rat ventricular myocytes were cultured in serum-free Medium 199 (Invitrogen) containing taurine (5 mm), creatine (5 mm), l-carnitine (5 mm), and sodium bicarbonate (26 mm) and plated in 24-well plates onto 12-mm glass coverslips coated with matrigel (BD Biosciences). All the media used for the cell culture contained 50 IU penicillin and 50 μg/ml streptomycin, and the cells were incubated under sterile conditions at 5% CO₂ and 37 °C.

Reverse Transcription-PCR (RT-PCR)

Total RNA was extracted from rat ventricular myocytes using the RNeasy kit (Qiagen) according to the manufacturer's instructions. Reverse transcription was performed using SuperScript^TM II (Invitrogen) as described previously (23, 28, 29). Control reactions without reverse transcriptase were performed for determining contamination, if any, in the samples. The primer sequences used in this study were as follows: U-IIR: sense, 5′-cagctccctgaaagaccttg-3′; antisense, 5′-acaatgctggtcccaaagag-3′; and GAPDH: sense, 5′-atgggaagctggtcatcaac-3′; antisense, 5′-ggagacaacctggtcctcag-3′.

Western Blotting

Western blot analysis was performed as described previously (30, 31). Briefly, total cellular protein was extracted from rat ventricular myocytes using homogenization buffer. Equivalent amounts of proteins (20 μg) were separated by 7.5% SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes (Amersham Biosciences). Membranes were blocked using 5% (w/v) skimmed milk in phosphate-buffered saline (PBS) for 1 h at room temperature. Membranes were then probed using the following primary antibodies: rabbit anti-U-IIR (1:600; Santa Cruz Biotechnology), rabbit anti-G_q (1:1000; Santa Cruz Biotechnology), rabbit anti-phosphorylated Akt (1:500; Cell Signaling Technology), rabbit anti-total Akt (1:500; Cell Signaling Technology), rabbit anti-PKCα (1:600; Santa Cruz Biotechnology), mouse anti-PKCβ₁ (1:600; Sigma), rabbit anti-PKCβ₂ (1:1000; Sigma), rabbit anti-PKC_γ (1:1000; Santa Cruz Biotechnology), and rabbit anti-GAPDH (1:2000; Cell Signaling Technology). After washing in Tris-buffered saline (TBS) and Tween 20 (TBS-T), the membranes were incubated with horseradish peroxidase-conjugated anti-rabbit or anti-mouse IgG (1:10,000) for 2 h at room temperature. Chemiluminescence signals were generated using a SuperSignal West Pico trial kit (Pierce). Quantification software (Bio-Rad) was used for background subtraction and for analyzing the immunoblotting data.

Protein Kinase A (PKA) Activity Assay

PKA activity in homogenates from isolated cardiomyocytes was determined by enzyme-linked immunosorbent assay (ELISA; Promega, Madison, WI) according to the manufacturer's instructions. Briefly, the cells were pretreated with either vehicle or KT-5720 for 30 min followed by treatment with either vehicle (0.1% DMSO) or forskolin for 15 min. The cells were washed with ice-cold PBS, placed on ice, and incubated with 200 μl of lysis buffer. After a 10-min incubation on ice, the cells were transferred to microcentrifuge tubes. Cell lysates were centrifuged for 15 min, and aliquots of the supernatants containing 0.2 μg of protein were assayed for PKA activity. The activity is expressed as relative light units⁻¹/amount of protein.

Determination of PKC Activity

The cells were pretreated with either vehicle or calphostin C for 30 min at 37 °C followed by treatment with either vehicle or U-II for 15 min. Cells were resuspended in 50 μl of buffer A (20 μm Tris, 2 μm EDTA, 0.5 μm EGTA, and 1 μm PMSF, pH 7.4) containing 50 μm 2-mercaptoethanol and 25 μl of 10% Nonidet P-40 followed by sonication for 45 s. The cell lysates were centrifuged at 100,000 × g for 1 h and stored at −20 °C. PKC activity was determined using the PepTag PKC assay kit (Promega) according to the manufacturer's instructions.

Phosphatidylinositol 3-Kinase (PI3K) Activity Assay

Cells were stimulated with or without U-II (0.1 μm) for 15 min. After stimulation, PI3K activity was determined using a phosphatidylinositol 3-kinase activity ELISA kit according to the manufacturer's instructions (Tian-Ao Biotechnology). The absorbance of samples was measured at 450 nm with an EL 340 Bio Kinetic Reader (Bio-Tek Instruments).

Adenovirus Transduction

Three shRNAs targeting the sequence of PKCβ₁ (GenBank^TM accession number NM_012713.3) or G_q (GenBank accession number Y17161.1) were designed, and the best knockdown effects of shRNA for G_q (5′-CGCGGAGAUCGAGAAACAG-3′) and PKCβ₁ (5′-CACAUCCAACAAGUUGGCCGUUUCA-3′) were selected for subsequent experiments. Additional scrambled sequences also were designed as negative controls (NCs) (G_q, AGAUGAGAGAGCACACCGG; PKCβ₁, GUACUCACCUGACUCAUCAUGCAAG). The recombinant adenoviruses containing G_q shRNA (Ad-G_q-shRNA) or PKCβ₁ shRNA (Ad-PKCβ₁-shRNA) were packaged by GeneChem (Shanghai, China) using the pAdeasy system with pAdtrack-CMV-GFP as a shuttle vector and pAdeasy-1 as an adenoviral backbone. The virus was purified on two consecutive cesium chloride gradients, dialyzed, and titered. The titer of viral preparations used in the studies ranged from 10⁹ to 10¹⁰ pfu/ml. Forty-eight hours after infection, cells showing green fluorescence under an inverted fluorescence microscope (Ti-2000, Nikon) were subjected to whole-cell patch clamp analysis. RNAi efficacy on G_q or PKCβ₁ expression was analyzed by Western blot analysis.

Measurement of Myocyte Contraction

Cell shortening of ventricular myocytes was assessed by a video-based edge detection system (IonOptix Corp.). The cells were placed in a perfusion chamber mounted on the stage of an inverted microscope (Zeiss IM). The cells were field-stimulated with 20% suprathreshold voltage at a frequency of 0.5 Hz with a pair of platinum electrodes. The myocyte being studied was displayed on the computer monitor with the help of an IonOptix MyoCam charge-coupled device camera, which was attached to the sidearm of the microscope. SoftEdge acquisition software (IonOptix Corp.) captured and converted the changes in sarcomere length to digital signals. Only rod-shaped myocytes with clear edges were selected for experiments. Signals were recorded when steady-state contraction was reached in each experimental medium.

Electrophysiology and Data Analysis

Whole cell patch clamp electrophysiology was used to measure the L-type Ca²⁺ currents (I_Ca,L) in rat ventricular myocytes. Cells were placed in a recording dish and perfused with a bath solution containing 140 mm tetraethylammonium chloride, 2 mm CaCl₂, 0.5 mm MgCl₂, 5.5 mm glucose, 5 mm CsCl, and 10 mm HEPES, pH 7.35 with CsOH. Recordings were performed at room temperature (22–24 °C) using a MultiClamp 700B amplifier (Molecular Devices). Recording pipettes (World Precision Instruments) had 2–3-megaohm resistance when filled with internal solution containing 110 mm CsCl, 4 mm Mg-ATP, 0.3 mm Na₂-GTP, 10 mm EGTA, and 25 mm HEPES, pH 7.3 with CsOH. pClamp 10.2 was used to acquire and analyze all data. I_Ca,L were recorded in voltage clamp mode, and signals were filtered at 1 kHz using a low pass Bessel filter and digitized at 5 kHz. Series resistance and capacitance readings were taken directly from the amplifier after electronic subtraction of capacitive transients. Series resistance was compensated to the maximal extent (at least 75%). Current traces were corrected using on-line P/6 trace subtraction. In experiments in which cells were dialyzed with compounds or peptides, current measurements were started at least 5 min after breaking the patch. I_Ca,L were measured at their peak amplitude within the 200-ms test pulse and used to determine the percentage of I_Ca,L increase. Concentration-response curves were fitted by the following sigmoidal Hill equation: I/I_control = 1/(1 + 10^{(log(IC50) − X)}n_H) where X is the decadic logarithm of the concentration used, IC₅₀ is the concentration at which the half-maximum effect occurs, and n_H is the Hill coefficient. Activation data were fitted by the following modified Boltzmann equation: G/G_max = 1/{1 + exp[−(V_half − V_m)/k]} where G_max is the fitted maximal conductance, V_half is the membrane potential for half-activation, and k is the slope factor. Steady-state inactivation of I_A was fitted with the following negative Boltzmann equation: I/I_max = 1/{1 + exp[−(V_half − V_m)/k]} where I_max is maximal current, V_half is the membrane potential for half-inactivation, and k is the slope factor. Summary data are expressed as mean ± S.E. GraphPad Prism 5.0 was used to analyze the data. Statistical significance was determined using Student's t test when two groups were compared and one-way analysis of variance with a post hoc Bonferroni test when three or more groups were compared. Results were considered statistically significant at a p value of <0.05.

RESULTS

U-II Enhances I_Ca,L

Whole-cell currents were elicited by a 200-ms stepping voltage from a holding potential of −60 to 0 mV. These currents can be blocked by nicardipine (5 μm), a specific L-type Ca²⁺ channel blocker (data not shown). Addition of U-II (0.1 μm) to the bath caused a significant increase in peak I_Ca,L to 28.3% of the basal level (n = 8; Fig. 1, A and B). Following removal of U-II, the amplitude of I_Ca,L recovered partially within 5 min (Fig. 1, B and C). Further examination of the U-II effect demonstrated that U-II increased I_Ca,L in a concentration-dependent manner (Fig. 1D). The relationship between U-II concentration and the degree of increase observed is described by a logistic equation where the concentration of U-II producing half-maximal increase (IC₅₀) is 62.7 nm, the apparent Hill coefficient is 0.86, and the maximal stimulatory effect is 45.2 ± 1.8% (n = 9; Fig. 1D).

FIGURE 1.

U-II stimulates L-type Ca²⁺ channels in adult rat ventricular myocytes. A, time course of changes in I_Ca,L amplitude mediated by 0.1 μm U-II. Letters (a–c) indicate which points were used for sample traces. B and C, representative traces and summary data of I_Ca,L under control conditions (a), during exposure to 0.1 μm U-II (b), and during washout (c) (n = 8). I_Ca,L were elicited by a 200-ms-long depolarizing step pulse from the holding potential of −60 to 0 mV. D, dose response of U-II on the stimulation of I_Ca,L. The dotted line represents the line of best fit to the sigmoidal Hill equation. The number of cells tested at each concentration of U-II are indicated in parentheses. E, current-voltage plot showing the current density of I_Ca,L versus test voltage recorded before and after treatment with 0.1 μm U-II (n = 12). F, summary of results showing the current density of I_Ca,L at 0 mV as indicated in E. G–I, U-II did not significantly alter the steady-state activation curve of L-type Ca²⁺ channels (H; n = 9) but caused a rightward shift of the steady-state inactivation curve (G; n = 11). To determine the steady-state inactivation, I_Ca,L was evoked by a 100-ms test pulse to 0 mV after the 3-s conditioning pulses ranging from −80 to +30 mV with 10-mV increments. To determine the voltage dependence of activation, tail currents were elicited by repolarization to −60 mV after 40-ms test pulses from −50 to +40 mV in increments of 10 mV. I, summary of results showing the effects of 0.1 μm U-II on V_half of the activation and inactivation curves. ***, p < 0.001 versus 0.1 μm U-II; ##, p < 0.01 versus control. Error bars represent S.E. pF, picofarad.

Next, we determined whether the biophysical properties of I_Ca,L were affected by U-II. A current-voltage curve was evoked by a series of depolarizing pulses from a holding potential of −60 mV to test potentials between −60 and +50 mV. Population data showed that 0.1 μm U-II significantly down-shifted the current-voltage curve (n = 12; Fig. 1E), and at 0 mV, the current density increased from 6.8 ± 0.7 to 9.1 ± 0.6 pA/picofarad (p < 0.01, n = 12; Fig. 1F). Further effects mediated by U-II including the voltage dependences of activation and inactivation were examined. We observed a significant shift of the steady-state inactivation potentials of I_Ca,L by 8.5 mV in the depolarized direction (V_half from −32.6 ± 0.6 to −24.1 ± 0.8 mV, n = 11; Fig. 1, G and I), whereas the activation potential did not change significantly (V_half from −12.6 ± 0.5 to −12.8 ± 0.8 mV, n = 9; Fig. 1, H and I). These results suggest that the increase in I_Ca,L observed after the application of U-II may be due to the retention of a decreased proportion of inactivated channels.

U-IIR Mediates U-II-induced Increase in I_Ca,L

U-IIR is the functional receptor for U-II in vivo (2). We examined U-IIR participation in I_Ca,L responses to U-II by examining the expression profile in rat ventricular myocytes. RT-PCR analysis demonstrated that the transcripts for U-IIR (predicted size of amplicon is 537 bp) were present in adult rat ventricular myocytes. Negative control reactions in which reverse transcriptase was excluded from the RT step did not yield any PCR products (Fig. 2A). Protein levels of U-IIR were assessed by immunoblotting with subunit-specific antibodies. Immunoblotting analysis revealed that U-IIR is endogenously expressed in adult rat ventricular myocytes. The rat testis expresses U-IIR and was therefore used as a positive control (Fig. 2B). We next determined the involvement of U-IIR in U-II-induced changes in I_Ca,L. Palosuran (1 μm), a specific U-IIR antagonist, alone had no significant effect on I_Ca,L in adult rat ventricular myocytes (increase of 1.5 ± 1.2%, n = 7), whereas pretreatment of cells with palosuran (1 μm) completely abolished the U-II-induced I_Ca,L response (increase of 2.6 ± 1.3%, n = 9, p < 0.001; Fig. 2, C and D), suggesting that the U-II-induced increase in I_Ca,L was dependent on U-IIR.

FIGURE 2.

U-II increases I_Ca,L via the activation of U-IIR. A, detection of U-IIR mRNA in adult rat ventricular myocytes. Total RNA from rat testis was used as a positive control. −RT, negative control, RT-PCR without the addition of enzyme. B, Western blot analysis showed the expression of U-IIR protein in rat ventricular myocytes. GAPDH was used as a loading control. The blots shown are representative of three experiments. C and D, time course (C) and summary of results (D) showing that treatment of ventricular myocytes with palosuran (pal.) (1 μm for 30 min) completely abolished the increase in I_Ca,L induced by 0.1 μm U-II (n = 9). Application of palosuran (1 μm) alone had no significant effect on I_Ca,L (n = 7). Letters (a and b) indicate the points used for sample traces. ***, p < 0.001 versus 0.1 μm U-II. Error bars represent S.E. VM, ventricular myocytes.

U-II-induced Changes in I_Ca,L Require the βγ Subunits of G_i/o

U-IIR is a G-protein-coupled receptor and has been shown to couple to G_q/11 in the cardiomyocytes (2, 32). To investigate the potential involvement of heterotrimeric G-proteins, cells were dialyzed with the non-hydrolyzable GDP analog GDP-β-S (1 mm). GDP-β-S completely abolished the increase in I_Ca,L induced by U-II (increase of 2.7 ± 1.1%, n = 8; Fig. 3A), indicating the requirement for G-protein activation. We next determined the involvement of G_q/11 in the response mediated by U-IIR. Because of a lack of commercially available specific G_q/11 inhibitors, an adenovirus-based shRNA knockdown approach was used to examine the effect of U-II on I_Ca,L in G_q-silenced ventricular myocytes. Western blot analysis showed that the expression of G_q was significantly reduced in cells transduced with G_q shRNA (Ad-G_q-shRNA) compared with the cells transduced with control shRNA (Ad-NC-shRNA; Fig. 3B). Knockdown of G_q did not affect the U-II-induced I_Ca,L increase (increase of 27.9 ± 1.7%, n = 12; Fig. 3C), and there was no significant difference in the I_Ca,L density between control shRNA and non-transduced control cells (Figs. 1F and 3C). These results support the hypothesis that the U-II-induced increase in I_Ca,L is independent of G_q/11 in adult rat ventricular myocytes. In cultured ventricular myocytes (48 h), the current density of I_Ca,L slightly, but not significantly, decreased at 0 mV (6.6 ± 0.4 pA/picofarad for control, n = 9; 5.9 ± 1.1 pA/picofarad for cultured cells, n = 11; Fig. 3D). In addition, the voltage dependence of I_Ca,L activation and inactivation was also measured in control and in cultured cells. Similar values for half-maximal activation and inactivation voltage (V_half) (V_half from −13.1 ± 0.4 to −12.3 ± 0.6 mV for activation curve, n = 9; V_half from −29.7 ± 0.7 to −28.6 ± 0.9 mV for inactivation curve, n = 12; Fig. 3E) and slope factor (k) (k from 7.7 ± 0.6 to 7.5 ± 0.9 mV for activation curve, n = 9; k from 8.9 ± 0.6 to 9.1 ± 0.8 mV for inactivation curve, n = 12; Fig. 3E) were obtained in both groups. We next examined the involvement of different G-protein subtypes in the U-II-mediated modulation of I_Ca,L. Inactivation of G_s by pretreating ventricular myocytes with cholera toxin (0.5 μg/ml for 24 h) did not affect the ability of U-II to increase I_Ca,L (increase of 32.2 ± 3.1%, n = 10; Fig. 3F). Conversely, inhibition of G_i/o by pretreating ventricular myocytes with PTX (0.2 μg/ml for 24 h) abolished the stimulatory effect of U-II (increase of 1.3 ± 2.1%, n = 9; Fig. 3F). These results indicate that G_i/o is involved in the transduction pathways leading to the increase in I_Ca,L in response to U-IIR stimulation.

FIGURE 3.

The βγ subunits of G_i/o-protein are involved in the U-II-induced response. A, time course (left panel) and summary of results (right panel) showing the effect of U-II (0.1 μm) on I_Ca,L in the presence of GDP-β-S (1 mm applied intracellularly) (n = 8). B, protein expression of G_q measured by Western blotting in control shRNA (Ad-NC-shRNA)- and G_q shRNA-treated (Ad-G_q-shRNA) groups. GAPDH was used as a loading control. The blots shown are representative of three individual experiments. C, summary of results showing the effect of G_q shRNA on 0.1 μm U-II-induced I_Ca,L increase. I_Ca,L were recorded from ventricular myocytes transfected with control shRNA (n = 10) or G_q shRNA (n = 12). D, summary of results showing the current density of I_Ca,L at 0 mV in control cells (n = 9) compared with the ventricular myocytes cultured for 48 h (n = 11). E, similar values for half-maximal activation (n = 9) and inactivation (n = 12) voltage (V_half) and slope factor (k) were obtained in both control cells and the ventricular myocytes cultured for 48 h. F, summary of results showing the effect of 0.1 μm U-II on I_Ca,L following cholera toxin (CTX; 0.5 μg/ml pretreated for 24 h; n = 10) or PTX pretreatment (0.2 μg/ml pretreated for 24 h; n = 9). G, time courses showing the effects of 0.1 μm U-II on I_Ca,L in the presence of QEHA (intracellular application). H, summary of results showing the effects of 0.1 μm U-II on I_Ca,L in the presence of QEHA (n = 9) or SKEE (intracellular application; n = 10). ***, p < 0.001 versus 0.1 μm U-II; ##, p < 0.01 versus Ad-NC-shRNA; ###, p < 0.001 versus Ad-NC-shRNA; &, p < 0.05 versus Ad-G_q-shRNA. Error bars represent S.E. pF, picofarad.

The potential role of the native βγ subunits (Gβγ) of G_i/o-protein in the U-IIR-mediated increase of I_Ca,L was examined further. Intracellular infusion of synthetic peptide QEHA was used to bind Gβγ subunits released after receptor activation, thus preventing the activation of the upstream effectors. Application of QEHA (10 μm) through the recording pipette blocked the U-II-induced response (increase of 2.8 ± 3.2%, n = 9; Fig. 3, G and H), whereas similar dialysis of a scrambled peptide, SKEE (10 μm), did not alter the ability of U-II to increase I_Ca,L (increase of 27.5 ± 1.5%, n = 10; Fig. 3H). Together, these findings suggest that the Gβγ subunit of the G_i/o-protein complex mediates the U-II-induced increase in I_Ca,L.

U-IIR-mediated Stimulation of I_Ca,L Involves the Class I PI3K but Not Akt

Next, we investigated in detail the mechanism underlying the U-IIR-mediated I_Ca,L increase. Examination of the potential involvement of intracellular signaling pathways revealed no evidence for the involvement of PKA. Preincubation of cells with the PKA inhibitor KT-5720 (1 μm) did not alter the ability of U-II to increase I_Ca,L (increase of 27.6 ± 1.8%, n = 10; Fig. 4, A and C). Similar results were obtained following addition of another PKA inhibitor, protein kinase inhibitor 5–24 (increase of 28.2 ± 2.1%, n = 9; Fig. 4, B and C). Pretreatment of ventricular myocytes with 1 μm KT-5720 abolished the ability of forskolin (20 μm) to increase PKA activity (Fig. 4D), thus confirming the inhibitory effect of KT-5720. Previous studies have shown that the immediate downstream mediator of Gβγ is PI3K; therefore, to examine the role of PI3K in the response mediated by U-II, we first determined PI3K activity in ventricular myocytes. U-II significantly induced phosphatidylinositol 3,4,5-trisphosphate accumulation, and this effect was blocked by pretreatment of the cells with the PI3K inhibitor wortmannin (0.5 μm) (Fig. 4E). Furthermore, wortmannin pretreatment completely abolished the increase of I_Ca,L induced by U-II (increase of 0.9 ± 2.5%, n = 9; Fig. 4, F and H). It should be noted that pretreatment of cells with CH5132799 (1 μm), which selectively inhibits class I PI3Ks, also blocked the U-II-induced I_Ca,L response (increase of 2.3 ± 1.1%, n = 9; Fig. 4H). Akt is a common downstream target of PI3K (33–35). Therefore, we examined whether U-II action is mediated by Akt activation. We assayed the activity of Akt in ventricular myocytes treated with 0.1 μm U-II. Fig. 4I illustrates that the level of phosphorylated Akt increased following treatment with U-II (0.1 μm), whereas total Akt did not change. This effect was abolished by Akt inhibitor III (10 μm; Fig. 4I). To further explore the role of Akt in the modulation of I_Ca,L by U-II, cells were pretreated with Akt inhibitor III prior to 0.1 μm U-II stimulation. Interestingly, in the presence of Akt inhibitor III (10 μm), U-II still caused a significant increase in I_Ca,L (increase of 27.7 ± 4.1%, n = 11; Fig. 4, G and H). Taken together, these results suggest that U-II increases I_Ca,L through PI3K activation (likely via the class I PI3K) but independently of PKA or Akt signaling.

FIGURE 4.

U-IIR-mediated I_Ca,L increase requires PI3K. A and B, time course of changes in I_Ca,L amplitude mediated by 0.1 μm U-II in the presence of either KT-5720 (1 μm for 30 min; A) or protein kinase inhibitor (PKI) 5–24 (1 μm intracellular application; B). C, summary of results showing the effects of U-II on I_Ca,L in the presence of either KT-5720 (n = 10) or protein kinase inhibitor 5–24 (n = 9) as indicated in A and B. D, bar graph showing the activity of PKA in control cells, in ventricular myocytes treated with 20 μm forskolin, and in ventricular myocytes preincubated with KT-5720 (KT) (1 μm for 30 min) and then treated with 20 μm forskolin. E, U-II (0.1 μm) induced a significant increase in PI3K activity in the ventricular myocytes. This was blocked by the pretreatment of cells with wortmannin (wort) (0.5 μm for 30 min). All experiments were performed in triplicate with similar results. F and G, time course showing the stimulatory effects of 0.1 μm U-II on I_Ca,L in the presence of wortmannin (0.5 μm for 30 min; F) and CH5132799 (1 μm for 30 min; G). H, summary of results showing that treatment of ventricular myocytes with either wortmannin (n = 9) or CH5132799 (n = 9), but not Akt inhibitor III (10 μm, n = 11), completely abolished the 0.1 μm U-II-induced I_Ca,L increase. I, pretreatment of cells with Akt inhibitor III (10 μm) abolished 0.1 μm U-II-induced Akt phosphorylation. The blots shown are representative of three experiments. ***, p < 0.001 versus 0.1 μm U-II; #, p < 0.05 versus vehicle; ##, p < 0.01 versus vehicle; &, p < 0.05 versus 20 μm forskolin. Error bars represent S.E. RLU, relative light units; p-Akt, phosphorylated Akt; t-Akt, total Akt; PIP3, phosphatidylinositol 3,4,5-trisphosphate.

U-IIR-induced Stimulation of I_Ca,L Involves PKC

PKC activation has been shown to modulate L-type Ca²⁺ channels (22, 36) and can act as a downstream effector of Gβγ activation (37). We further investigated the role of PKC in U-II-induced changes in I_Ca,L. U-II (0.1 μm) significantly increased PKC activity (∼2.3-fold) in rat ventricular myocytes (Fig. 5A). This response was abolished in cells pretreated with the class I PI3K inhibitor CH5132799 (1 μm) (Fig. 5A). Calphostin C (50 nm), an inhibitor of both novel and classic PKC isoforms, abolished the ability of U-II to increase I_Ca,L (increase of 1.5 ± 1.6%, n = 10; Fig. 5B). Similar results were obtained with another classic and novel PKC antagonist, chelerythrine chloride (1 μm) (increase of 1.3 ± 2.9%, n = 9; Fig. 5B). Interestingly, the inhibition of PKC on U-II-induced responses by these antagonists was reproduced by Ro 31-8220 (2 μm), which blocks only classic PKC isoforms (increase of 1.9 ± 1.8%, n = 10; Fig. 5B). Application of calphostin C (50 nm), chelerythrine chloride (1 μm), or Ro 31-8220 (2 μm) alone had no significant effect on I_Ca,L in adult rat ventricular myocytes (increase of −1.7 ± 1.9% for calphostin C, n = 6; increase of 2.1 ± 2.3% for chelerythrine, n = 5; increase of −1.0 ± 2.1% for Ro 31-8220, n = 6; Fig. 5B). In contrast to novel PKC isoforms, activation of classic PKC isoforms requires cytoplasmic Ca²⁺. Intracellular dialysis of the fast Ca²⁺ chelator BAPTA (20 mm), but not the inactive analog dn-BAPTA, completely abolished the U-II-mediated response (increase of 1.3 ± 2.1% for BAPTA, n = 10; increase of 27.5 ± 3.6% for dn-BAPTA, n = 8; Fig. 5, C and D), thus supporting the involvement of classic PKC isoforms in this process.

FIGURE 5.

U-II increases I_Ca,L through activation of PKC. A, bar graph showing the activity of PKC in control cells, in ventricular myocytes treated with 0.1 μm U-II, and in ventricular myocytes pre-incubated with CH5132799 (CH) (1 μm for 30 min) and then treated with 0.1 μm U-II. B, summary of results showing the effect of 0.1 μm U-II on I_Ca,L in the presence of calphostin C (50 nm for 30 min; n = 10), chelerythrine chloride (1 μm for 30 min; n = 9), and Ro 31-8220 (2 μm for 30 min; n = 10). Application of calphostin C (50 nm; n = 6), chelerythrine chloride (1 μm; n = 5), or Ro 31-8220 (2 μm; n = 6) alone had no significant effect on I_Ca,L. C and D, time course and summary of results showing the effect of U-II (0.1 μm) on the I_Ca,L amplitude in the presence of BAPTA (20 mm intracellular application; n = 10) or dn-BAPTA (intracellular application; n = 8). **, p < 0.01 versus 0.1 μm U-II; ***, p < 0.001 versus 0.1 μm U-II; ##, p < 0.01 versus vehicle. Error bars represent S.E.

The Classic PKCβ1 Isoform Is Involved in U-II Response

Next, we aimed to determine the exact PKC isoform involved in the U-II-induced I_Ca,L increase. To achieve this, we first investigated the protein expression profiles of classic PKC isoforms in rat ventricular myocytes. Western blot analysis revealed that PKCα, PKCβ₁, and PKCβ₂ are expressed in adult rat ventricular myocytes, whereas PKCγ could not be detected (Fig. 6A). Rat brain expresses all four classic PKC isoforms and was used as a positive control for the various PKC isoform antisera (Fig. 6A). Pretreatment of cells with HBDDE (1 μm), a PKCα and PKCγ inhibitor, did not affect the stimulatory effects of U-II on I_Ca,L (increase of 26.9 ± 3.3%, n = 10; Fig. 6, B and D). In contrast, pretreating ventricular myocytes with the PKCβ antagonist LY333531 (0.2 μm) abolished the U-II-mediated change in I_Ca,L (increase of 1.8 ± 2.1%, n = 9; Fig. 6, C and D). In addition, dialysis of cells with βIV5-3 (0.1 μm), a PKCβ₁-specific inhibitor, completely blocked the U-II-induced I_Ca,L increase (increase of 0.9 ± 1.2%, n = 9; Fig. 6E). Application of scrambled βIV5-3 (0.1 μm) (increase of 28.1 ± 1.9%, n = 9; Fig. 6E) or the PKCβ₂-specific inhibitor βIIV5-3 (0.1 μm) (increase of 27.3 ± 3.1%, n = 10; Fig. 6E) did not elicit this effect. Together, these results suggest that PKCβ₁ may be involved in the U-II-induced increase in I_Ca,L. To confirm this, we used an adenovirus-based shRNA approach to knock down PKCβ₁ in ventricular myocytes. Western blot analysis revealed that the expression of PKCβ₁ was substantially reduced in cells transduced with PKCβ₁-specific shRNA (Ad-PKCβ₁-shRNA) compared with the cells transduced with control shRNA (Ad-NC-shRNA) (Fig. 6F), whereas the expression of PKCβ₂ was not affected. Knockdown of PKCβ₁ in ventricular myocytes almost completely eliminated the U-II-mediated increase in I_Ca,L (increase of 1.3 ± 0.7%, n = 9; Fig. 6G). Cellular activation of PKC is linked to its translocation and binding to the plasma membrane. Therefore, to support the results from the previous experiments, we examined the translocation of PKCβ₁ from the cytosolic to the membrane fractions of the cell following treatment with U-II. Western blot analysis indicated an increase of membrane-bound PKCβ₁ and a decrease in the cytosolic fraction following stimulation with U-II (0.1 μm; Fig. 6H). Collectively, these results suggest that the U-II-mediated increase in I_Ca,L occurs through the classic PKCβ₁ pathway.

FIGURE 6.

U-II increases I_Ca,L via activation of the classic PKCβ₁ pathway. A, Western blots were incubated with rabbit polyclonal antibodies (PKCα, PKCβ₂, and PKCγ) or mouse monoclonal antibodies (PKCβ₁) to determine the protein levels of classic PKC isoforms in rat ventricular myocytes. Rat brain proteins were used as positive controls. The blots shown are representative of three experiments. B and C, time courses of the effect of U-II (0.1 μm) on I_Ca,L in the presence of HBDDE (1 μm; B) and LY333531 (0.2 μm; C). D and E, summary of results showing the effect of U-II (0.1 μm) on I_Ca,L in the presence of HBDDE (1 μm for 30 min; n = 10; D), LY333531 (0.2 μm for 30 min; n = 9; D), βIV5-3 (0.1 μm intracellular application; n = 9; E), scrambled βIV5-3 (0.1 μm intracellular application; n = 9, E), and βIIV5-3 (0.1 μm intracellular application; n = 10; E). F, protein expression of PKCβ₁ and PKCβ₂ was measured by Western blotting in control shRNA (Ad-NC-shRNA) and PKCβ₁ shRNA-treated (Ad-PKCβ₁-shRNA) groups. The blots shown are representative of three experiments. GAPDH was used as a loading control. G, representative current traces and summary of results showing the effect of PKCβ₁ shRNA on 0.1 μm U-II-induced I_Ca,L increase in rat ventricular myocytes (n = 9). H, effect of U-II on membrane PKCβ₁ expression. Cells were treated with vehicle or U-II (0.1 μm) for 15 min. The blots shown are representative of three independent experiments. ***, p < 0.001 versus 0.1 μm U-II; ##, p < 0.01 versus Ad-NC-shRNA; ###, p < 0.001 versus Ad-NC-shRNA; &, p < 0.05 versus control. Error bars represent S.E. Cyto., cytosolic fraction; Mem., membrane fraction.

U-II Increased the Amplitude of Sarcomere Shortening

L-type Ca²⁺ channels are at the top of a cascade of events that initiate excitation-contraction coupling and thus regulate the strength of cardiac contraction (18–20). L-type Ca²⁺ channel blockers can cause a negative inotropism; conversely, any agent that increases I_Ca,L might, in theory, serve as a positive inotrope (20). To further examine the functional implications of the I_Ca,L increase induced by U-II, we tested the effects of U-II on cardiomyocyte contractility in rat ventricular myocytes. Our results showed that application of U-II (0.1 μm) resulted in a rapid (usually within 5 min after administration) increase in the amplitude of sarcomere shortening (increase of 30.8 ± 3.1%, n = 12 from five hearts; Fig. 7, A and B). The effects of U-II on cardiomyocyte shortening in response to depolarizing pulses were reversible after washout of U-II from the bath solution (Fig. 7B). We next determined the involvement of U-IIR in U-II-induced changes in cardiomyocyte shortening. Our results showed that pretreatment of cells with palosuran (1 μm), a specific U-IIR antagonist, abolished the U-II-induced response (increase of 2.1 ± 1.7%, n = 6 from three hearts; Fig. 7C), suggesting the involvement of U-IIR in the U-II-induced increase in the amplitude of sarcomere shortening. Furthermore, pretreating ventricular myocytes with the PKCβ antagonist LY333531 (0.2 μm) completely abolished the U-II-mediated change in sarcomere shortening (increase of 3.5 ± 2.8%, n = 6 from three hearts; Fig. 7C), whereas the PKCα inhibitor HBDDE (1 μm) elicited no such effect (increase of 27.6 ± 1.9%, n = 10 from six hearts; Fig. 7C). To further verify that this U-II-induced response was mediated by the I_Ca,L increase, we investigated whether Bay K8644, an L-type Ca²⁺ channel agonist, would occlude the U-IIR-mediated increase in the amplitude of sarcomere shortening. Indeed, Bay K8644 at 0.5 μm induced a significant increase in I_Ca,L (increase of 37.6 ± 3.1%, n = 7; Fig. 7D). Application of Bay K8644 (0.5 μm) to ventricular myocytes mimicked the U-II-induced increase in the amplitude of sarcomere shortening (Fig. 7, E and F). Notably, application of U-II (0.1 μm) after the maximum Bay K8644-induced response failed to produce any further increase either in I_Ca,L (increase of 35.9 ± 6.5%, n = 7; Fig. 7D) or in the amplitude of sarcomere shortening (Fig. 7, E and F). These results together suggest that U-II increased the amplitude of sarcomere shortening through a U-IIR-dependent PKCβ and L-type Ca²⁺ channel pathway.

FIGURE 7.

U-II increases the amplitude of sarcomere shortening. A and B, representative recordings (A) and summary data (B) of sarcomere shortening of ventricular myocytes under control conditions, exposure to 0.1 μm U-II for 5 min, and washout (n = 12). The vertical axis shows absolute sarcomere length in micrometers. C, effect of U-II (0.1 μm) on cardiomyocyte contractility in the presence of palosuran (1 μm for 30 min; n = 6), HBDDE (1 μm for 30 min; n = 10), and LY333531 (0.2 μm for 30 min; n = 6). D, summary of results showing the effect of U-II (0.1 μm) on I_Ca,L in the presence of Bay K8644 (Bay.) (0.5 μm for 30 min; n = 7). E and F, representative recordings (E) and summary data (F) showing the effect of U-II (0.1 μm) on sarcomere shortening in the presence of Bay K8644 (0.5 μm; n = 11). *, p < 0.05 versus U-II at 0.1 μm; **, p < 0.01 versus U-II at 0.1 μm; &, p < 0.05 versus control. Error bars represent S.E.

DISCUSSION

The present study provides mechanistic data describing a novel functional role of U-II in modulating L-type Ca²⁺ channels as well as sarcomere shortening in adult rat ventricular myocytes. These results suggest that this response is mediated by U-IIR coupled to the βγ subunits of G_i/o-proteins and subsequent activation of the class I PI3K-dependent PKCβ₁ isoform. A schematic diagram of this proposed pathway is shown in Fig. 8.

FIGURE 8.

Proposed signaling pathway involved in the effect of U-II on L-type Ca²⁺ channels. U-II binds to U-IIR, which is coupled to the G-protein G_i/o, causing it to release the Gβγ subunits. Activation of PI3K by the Gβγ subunit causes an increase in PKCβ₁ activity and subsequent stimulation of the L-type Ca²⁺ channels. PI3K catalyzes the conversion of phosphatidylinositol 4,5-bisphosphate (PIP₂) to phosphatidylinositol 3,4,5-trisphosphate (PIP₃), which serves as a second messenger that helps to activate Akt. Neither PKA, Akt, PKCβ₂, nor direct interaction between Gβγ and L-type Ca²⁺ channel is necessary for the U-IIR-mediated increase of I_Ca,L. Whether PKCβ₁ directly phosphorylates L-type Ca²⁺ channels or acts on an intermediate protein remains unclear.

U-IIR activation is detected through PTX-insensitive G-protein G_q/11 coupling sequentially to phospholipase C (2, 32). Interestingly, in adult rat ventricular myocytes, we found that the βγ subunits of PTX-sensitive G_i/o-protein are involved in the U-IIR-mediated L-type Ca²⁺ channel stimulation because 1) the effect was blocked by the nonselective G-protein inhibitor GDP-β-S and 2) pretreatment with PTX, but not cholera toxin, abolished the response to U-II, indicating the involvement of G_i/o in rat ventricular myocytes. It has been suggested previously that G_i/o can interact directly with L-type Ca²⁺ channels (38); however, such a mechanism is unlikely to be involved in our system. We did find the involvement of Gβγ subunits in the U-II-induced response because pipette application of the peptide QEHA, which disrupts interactions between Gβγ subunits and Ca²⁺ channels, but not its scrambled peptide SKEE abolished U-II-induced stimulation. However, Gβγ did not seem to interact with the L-type Ca²⁺ channels because the U-II-induced response was further blocked by the inhibition of downstream protein kinases. Importantly, the outcome of Gβγ regulation of Cav1.2 was a reduction in I_Ca,L due to direct interaction with the N terminus of α1C subunits (39). The apparent independence of Gβγ subunits in the modulation of L-type calcium channels may indicate that rat ventricular myocytes express a Ca²⁺ channel that is insensitive to the Gβγ subunits of G_i/o. An alternative hypothesis is that different Cav1.2 channel splice variants are able to generate different L-type Ca²⁺ channel functions (40). For example, alternative splicing of the Cav1.2 channel changes the sensitivity of the L-type Ca²⁺ channel to dihydropyridines (41). In addition, it is possible that U-IIR-mediated Gβγ activation does not result in a functional increase in L-type Ca²⁺ channel current in adult rat ventricular myocytes.

Presently, it is unclear how Gβγ stimulates L-type Ca²⁺ channel activity. Gβγ subunits can activate PKA to modulate various targets including calcium channels (42, 43). For example, I_Ca,L recorded from isolated cardiomyocytes were shown to be increased by β-adrenergic receptors via the cAMP/PKA-dependent pathway (44). In contrast, I_Ca,L inhibition by CB1 cannabinoid receptor activation was prevented by the application of PKA inhibitors (45). Similarly, Cav1.2 current inhibition by integrin receptor activation was blocked by the addition of the PKA inhibitor H89 (46). However, in the present study, we found that the stimulatory effect of U-II on I_Ca,L was PKA-independent, which suggests that other non-cAMP/PKA-dependent mechanisms are involved in the stimulatory effect of U-II. PI3K (particularly PI3Kγ) is a known downstream target of Gβγ signaling, and there is evidence that Gβγ stimulates Cav1.2 via PI3K (47). In this study, we found that the response to U-II was abolished by the selective PI3K inhibitors, suggesting that PI3K also participates in the U-IIR/Gβγ pathway in rat ventricular myocytes. In contrast, the stimulatory effect of U-II on PKC activity was abolished by PI3K blockade, suggesting that PKC is downstream of PI3K rather than the reverse.

Next, we wished to determine how PI3K activates PKC. Phosphatidylinositol 3,4,5-trisphosphate, the lipid product of PI3K, targets several different second messengers (48, 49) including PKC. Furthermore, PI3Kγ itself has serine kinase activity, and this could lead to PKC activation (50–53). The Gβγ/PI3K pathway has been reported to regulate chloride channels in oocytes and has been linked to phosphatidylinositol 3,4,5-trisphosphate-dependent activation of PKCζ, an atypical PKC that is insensitive to both Ca²⁺ and diacylglycerol (54, 55). In addition, the Gβγ/PI3K pathway has been shown to activate a novel PKC isoform in rabbit portal vein myocytes (50). Conversely, the U-IIR-induced response is blocked with calphostin C. Calphostin C inhibits both classic and novel PKCs but not atypical PKCs. Furthermore, the effects of U-II in the present study were also inhibited when selective antagonists of classic PKCs and a fast intracellular calcium chelator were used, leading us to the conclusion that classic PKC isoforms are involved.

The following data suggest that PKCβ₁ is involved in the U-II-induced increase in I_Ca,L. 1) Pharmacological inhibition of PKC_β, but not PKCα, completely abolished the increase of U-II on I_Ca,L. 2) PKCβ₁ has been identified in rat ventricular myocytes, and U-II increases the membrane expression of PKCβ₁. 3) Pharmacological inhibition of PKCβ₁ or knockdown with shRNA blocked the U-II-induced I_Ca,L response. These results are supported by previous studies showing that PKC activation increases I_Ca,L in neonatal mouse ventricular myocytes (56). It has also been shown that PKC phosphorylates the Cav1.2 α1C calcium channel subunit, resulting in the up-regulation of L-type Ca²⁺ channel activity (57). Similar results have been reported in rat portal vein myocytes (50). In contrast, a PKC-induced I_Ca,L decrease has been described in the heart (58, 59) and cerebral artery smooth muscle cells (60). Biphasic effects of PKC and no effect of PKC activation on L-type Ca²⁺ channels have also been reported (61, 62). Although the regulation of L-type Ca²⁺ channels by PKC remains controversial, the differential modulation of L-type Ca²⁺ channel activity by PKC may also involve different parameters. First, the expression and/or activation of endogenous PKC isoforms is tissue/cell-specific, and remarkable heterogeneity across PKC-dependent signal transduction pathways exists including that for ion channel modulation (63, 64). As described in the present study, we suggest that the PKCβ₁ isoform is involved in the U-II-induced I_Ca,L response. Second, PKC modulation of L-type Ca²⁺ channels may involve PKC-interacting proteins; this is the case for the Cav2.2 N-type channel (65). PKC-interacting proteins confer specificity on individual PKC isoforms by regulating their activity and cellular location, endowing isoforms with the ability to mediate specific cellular functions (66, 67). Finally, cell-specific splice variants of Cav1.2 α1C (68) or β subunits (69) might modulate the pharmacological properties of L-type Ca²⁺ channels in different ways. Therefore, we cannot exclude the possibility that an intermediate protein, phosphorylated by a different PKC isoform, may be involved in the observed U-IIR-mediated response.

In conclusion, the present study provides evidence of new mechanisms involved in the modulation of L-type Ca²⁺ channels by U-II in adult rat ventricular myocytes. We propose that the marked increase in I_Ca,L induced by U-II is mediated through U-IIR and involves the Gβγ subunits of G_i/o and downstream class I PI3K-dependent activation of the PKCβ₁ pathway. We found no evidence of a role for PKA and Akt signaling. This novel mechanism may contribute to the physiological functions of U-II including ventricular contraction in the mammalian cardiovascular system.