Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Apr 1.
Published in final edited form as: J Med Primatol. 2015 Jan 21;44(2):76–88. doi: 10.1111/jmp.12161

Immunogenetic Characterization of a Captive Colony of Sooty Mangabeys (Cercocebus atys) Used for SIV Research

Geary R Smith 1, Liesel Bauer 2, Maria M Crane 1, Zachary P Johnson 2
PMCID: PMC4378528  NIHMSID: NIHMS672547  PMID: 25645218

Abstract

Background

African nonhuman primates are SIV natural hosts and do not develop disease following infection. Understanding disease avoidance mechanisms in these species is important for HIV vaccine development. The largest captive population of sooty mangabeys, a SIV natural host species, resides at the Yerkes National Primate Research Center.

Methods

Thirteen primer sets that amplify polymorphic microsatellite loci within the MHC region were used to genotype 144 animals. Immunogenetic Management Software (IMS) was used to identify MHC haplotypes and organize data.

Results

Seventy-three haplotypes were identified. Limited haplotype diversity was observed in this population with 88.2% of included animals carrying one of 18 haplotypes. Differences in haplotype frequency were observed between SIV (+) and SIV (−) populations.

Conclusions

We have developed a novel tool for others to use in analysis of the role of the MHC in a natural host nonhuman primate model species used for SIV research.

Keywords: MHC, haplotype, microsatellite marker, HIV

Introduction

More than thirty species of African nonhuman primates have been identified as natural hosts for species-specific strains of simian immunodeficiency virus (SIV), the ancestral virus of human immunodeficiency virus (HIV) [25, 44, 56]. Unlike HIV infection in humans and SIV infection in Asian nonhuman primates, SIV infection in African nonhuman primates does not lead to acquired immunodeficiency syndrome (AIDS) [11, 25, 29, 45, 46, 48]. The difference in basic clinical outcome between SIV-infected natural host species and SIV-infected Asian nonhuman primate species and HIV-infected humans has been shown to be related to the difference in evolutionary history between SIV and its natural host species versus SIV and Asian nonhuman primate species and HIV and humans. African nonhuman primates evolved in the presence of SIV-infection for at least the last 32,000 years while HIV has infected humans for approximately the previous 100 years, and SIV infection does not exist in wild Asian nonhuman primate species populations [26, 42, 59]. Over time, evolutionary pressures selected for African nonhuman primate individuals that mount host responses to SIV infection that allow disease avoidance, which are not present in Asian nonhuman primate species or humans. Comparing host responses to SIV infection in natural host species to those in Asian nonhuman primates and responses to HIV infection in humans revealed some of the mechanisms important for the avoidance of disease following SIV infection in natural host species [11, 13, 19]. These mechanisms are likely necessary for the development of an effective HIV vaccine [50].

The majority of our understanding of host response to SIV infection in natural host species originates from the use of sooty mangabeys and African green monkeys as research models [25, 50]. Sooty mangabeys are of particular interest because the strain of SIV infecting them, SIVsm, is the ancestral virus of both SIVmac, which is used to produce simian AIDS in Asian nonhuman primates for HIV studies, and HIV-2, a strain of HIV endemic to West Africa [3, 4, 22, 28]. Sooty mangabeys and African green monkeys possess similar host responses to SIV infection that are thought to allow them to avoid the clinical development of AIDS despite equal or increased viral replication levels compared to HIV-infected humans and SIV-infected Asian nonhuman primates. These mechanisms include the maintenance of normal peripheral CD4+ T-cell numbers in the chronic phase of infection, the selective preservation of memory T-cells, the maintenance of T-cell regenerative capacity, the maintenance of mucosal integrity in the gastrointestinal system, the lack of chronic immune system activation, and the maintenance of normal lymph node architecture and function [4548]. In addition, sooty mangabeys lack target cell availability early in development, which hinders mother-to-infant transmission of SIV [12].

Within human and Asian nonhuman primate populations, individuals exist that are capable of sustaining HIV or SIV infections without progressing to AIDS. This phenotype has been repeatedly correlated with specific major histocompatibility complex haplotypes [1, 6, 10, 23, 33, 34, 36, 51]. Proteins encoded within the major histocompatibility complex function as antigen presentation proteins that initiate either CD8+ T-cell cytotoxic activity to intracellular infections (MHC class I) or CD4+ T-cell mediated humoral responses to extracellular infections (MHC class II). Both MHC class I and MHC class II proteins are important for the host response to HIV or SIV infection. Individuals with MHC haplotypes that allow for the presentation of highly conserved regions of HIV or SIV proteins are better able to control infection and avoid progressing to AIDS [2, 14, 34]. In cynomolgus macaques, an Asian nonhuman primate species, cellular immune responses to SIV infection were found to be similar in individuals with the same MHC haplotype [9]. The role of MHC proteins is less well understood within natural host species, such as the sooty mangabey. It is likely that MHC haplotypes in sooty mangabeys also play a role in avoidance of clinical AIDS. However, MHC defined populations of sooty mangabeys are not available for research use. Currently, the only captive colony of sooty mangabeys resides at the Yerkes National Primate Research Center Field Station. This study sought to create a database of individual animal’s MHC haplotypes within this colony of sooty mangabeys. Combined with ongoing efforts to maintain detailed pedigree information, this resource will be valuable for future studies of SIV pathogenesis in a well-defined SIV natural host species, the sooty mangabey. We hypothesized that MHC haplotype diversity within this population of sooty mangabeys would be limited due to a founder effect and MHC frequencies would differ between the physically separated naturally infected SIV (+) and SIV (−) subpopulations of animals.

Large quantities of data are necessary to maintain a colony of animals that are MHC-defined. Here, we used software developed for the management of an MHC-defined colony of rhesus macaques used in transplant research, Immunogenetic Management Software (IMS). This system allows for pedigree visualization, MHC haplotype assignment, MHC RNA expression analysis, and calculation of MHC allele and expression sharing between individual members of the colony [24]. We aimed to expand the use of the IMS system to the colony of sooty mangabeys housed at the Yerkes National Primate Research Center.

Materials and Methods

Humane Care Guidelines

This study was conducted in accordance with the Guide for the Care and Use of Laboratory Animals. Animals included in this study were housed at the Yerkes National Primate Research Center Field Station (Lawrenceville, GA, USA) in accordance with all procedures approved by the Emory University Institutional Animal Care and Use Committee. The Yerkes National Primate Research Center Field Station is fully accredited by AAALAC, International.

Animals

144 naïve and naturally SIV-infected sooty mangabeys were included in this study. These animals were all captive-born and part of the Yerkes National Primate Research Center sooty mangabey colony that was established with 22 individuals in 1968 [43]. This colony has been maintained as a closed colony since its formation. Therefore, all animals included in this study are direct descendants of the original 22 founding animals. Animals were housed in large indoor/outdoor compounds and fed a standard monkey chow (Purina LabDiet 5037, St. Louis, MO, USA) supplemented with fresh fruit and vegetables for the Behavioral Management Unit enrichment program. Naturally infected SIV (+) and SIV (−) animals were housed in separate compounds.

Blood Sample Collection

Blood for this project was collected during three separate semiannual health monitoring surveys performed by the veterinary staff in the Division of Animal Resources and the Field Station Colony Management Unit from 2004 until 2006. Animals were fasted overnight and sedated with 10 mg/kg ketamine hydrochloride (Fort Dodge, Fort Dodge, IA, USA). A complete physical exam was performed on every animal prior to blood collection. After ensuring no abnormalities were noted on physical exam, blood was collected from the femoral vein in Vacutainer Cell Preparation Tubes with Sodium Heparin (Becton Dickinson Vacutainer Systems, Franklin Lakes, NJ, USA). Blood was stored at room temperature until processing.

Blood Sample Processing

Within two hours of collection, blood was centrifuged at 1500 RCF for 20 minutes to separate white blood cells (WBCs). WBCs were frozen and stored at −20°C. DNA from WBCs was extracted using the Promega Maxwell System [20]. DNA was quantified using a Nanodrop spectrophotometer.

Existing primer sets shown to be polymorphic in the rhesus macaque MHC were gathered from both existing studies of rhesus macaque MHC genetics and the published rhesus macaque microsatellite map [38, 41]. The most centromeric and the most telomeric microsatellite markers used in this study were the same as those used in the Penedo, et al., 2005 [38]. The approximate size of the MHC region is 5,000 kb, and it includes centromeric and telomeric flanking regions as well as the MHC I and MHC II regions. Due to the relatively close evolutionary relationship between sooty mangabeys and rhesus macaques, many of the primer sets amplified polymorphic regions in both species, however significant regions with no suitable loci existed within the sooty mangabey genome. To address this problem, we leveraged previously identified repeat units within the rhesus macaque genome and attempted to design primers using the techniques described within Raveendran, et al. [39]. Table 1 lists the forward and reverse primer sequences used for each of the thirteen microsatellite makers, and Figure 1 illustrates the relative genomic location of each microsatellite marker. These microsatellite markers were located within the MHC I region, within the MHC II region, and within the centromeric and telomeric flanking regions of the MHC on chromosome 6.

Table 1.

Primers. Forward and reverse primers for each microsatellite marker used to haplotype each animal.

Marker Forward Primer Sequence Reverse Primer Sequence
D6S1691 AGGACAGAATTTTGCCTC GCTGCTCCTGTATAAGTAATAAAC
D6S276 TTCCAGTGTATACATCAATCAAATCA GGGTGCAACTTGTTCCTCCT
D6S1571 GGACCTACGCATCTGGTG TGGCTCTAATGGTTACTTTTTACA
D6S1621 AAAGATTTAGAGTAAATGCTGATGA ACCACAGATGAGAATGCCTT
MML4SJ3 GGGAGACGGTTTCTTTCACA TGGCAGATAATGTGTGGTTG
MML4SJ5 CTCCCCAGCCTCACTCATTA GAGGTTGTGGGTAGGGAGGT
MML4SJ16 TCAGCATTTCCTGTGAGGTG TCCTTTCCTTTCACAGTAGCC
STRMICA CCTTTTTTTCAGGGAAAGTGC CCTTACCATCTCCAGAAACTGC
DRACA GATACTTTCCTAATTCTCCTCCTTC ATGGAATCTCATCAAGGTCAG
D6S2876 GGTAAAATTCCTGACTGGCC GACAGCTCTTCTTAACCTGC
D6S2741 AGACTAGATGTAGGGCTAGC CTGCACTTGGCTATCTCAAC
D6S1568 ACATGACCAGAACTTCCCAG AGCTAGGCCAGGCCGT
D6S291 CTCAGAGGATGCCATGTCTAAAATA GGGGATGACGAATTATTCACTAACT

Figure 1.

Figure 1

Primer set locations. Relative positions of the 13 microsatellite marker primer sets, within and flanking the MHC region of the genome, used to genotype each animal. Primer sets were chosen to provide allelic data at loci from the MHC flanking regions, the MHC class I region, and the MHC class II region. The telomeric end of the chromosome is located to the left, and the centromere is located to the right.

PCR amplification and genotyping of the entire sooty pedigree (n = 144 individuals) was performed with 25 ng of genomic DNA in a 6-μl reaction volume using Applied Biosystems (ABI) dual 384-well 9700 thermal cyclers under the following conditions: 12 min denaturation at 95°C followed by 10 cycles of 15 s at 94°C, 15 s at 48–55°C, 30 s at 72°C and 20 cycles of 15 s at 89°C, 15 s at 48–55°C, 30 s at 72°C, with a final 10-min extension at 72°C. PCR mixtures contained AmpliTaq Gold 10X PCR buffer, dNTPs, MgCl2, 0.5 μmol forward and reverse primers, and 0.5 units AmpliTaq Gold DNA polymerase (ABI). PCR products from a single panel were pooled, and the pooling ratio could be adjusted to achieve approximately even peak heights across all loci. The appropriate pooling volume was mixed with a cocktail containing genetic analysis grade Hi-Di formamide (ABI) and labeled size standard (GeneScan-500 Liz; ABI). The electrophoresis was performed in 3730 genetic analyzers (ABI) using data collection software v3.0. Genotyping analysis used Genemapper 3.7 software. Supplemental Table 1 lists the markers and their expected product lengths included in each of the three PCR panels used to fully haplotype each animal.

Haplotypes were identified using the web based Immunogenic Management Software (IMS) [24]. IMS is capable of utilizing both complex pedigree relationships and large genotypic data files in ways to quickly and visualize these complex data sets.

Polymorphism Information Content Calculation

The polymorphism information content (PIC) for each microsatellite marker was calculated according to Nagy, et al. [32]. Briefly, frequencies for all alleles at each microsatellite marker were entered into the online tool, Polymorphism Information Content Calculator, available at http://w3.georgikon.hu/pic/english/kezi.aspx (accessed 11/25/2014). This online tool calculates the PIC using the mathematical formula discussed in the above-mentioned reference. For this study, the PIC was calculated for each microsatellite marker in both the SIV (+) and the SIV (−) subpopulations.

Results

Microsatellite-based MHC Haplotypes

MHC haplotypes were determined for 144 animals (288 chromosomes) using PCR reactions with primer sets (Table 1) for 13 microsatellite markers (Figure 1).. Maternal and paternal haplotypes were determined by combining reproduction data identifying parentage with allelic data based on the size of the PCR products produced from each of the 288 chromosomes analyzed. Table 2 lists the 13 microsatellite markers used for haplotype determination, the alleles identified for each of these markers, the frequency of these alleles in both the SIV (+) and the SIV (−) subpopulations, the observed heterozygosity for these markers in both the SIV (+) and the SIV (−) subpopulations, and the PIC value calculated for each marker in both the SIV (+) and the SIV (−) subpopulations.. Seventy-three unique MHC haplotypes were identified. Eighteen of these haplotypes were carried by more than three animals. One hundred twenty-seven (88.2%) animals included in this study carried one of these 18 haplotypes. Figure 2 and Table 3 illustrate the prevalence of the 18 haplotypes present in three or more animals. Ceat-004 was the most common MHC haplotype in this population, being present in 22.2% of the animals. Table 4 lists the allele profiles for each of these 18 haplotypes.

Table 2.

Microsatellite characterization. Allele sizes (bp) observed at each microsatellite locus genotyped, frequencies of each allele in both the SIV (+) and SIV (−) subpopulations, calculated polymorphism information content (PIC) for each microsatellite marker in both the SIV (+) and SIV (−) subpopulations, and observed heterozygosities of each microsatellite marker in both the SIV (+) and SIV (−) subpopulations.

Marker Allele Sizes (bp) Frequency SIV (+) PIC SIV(+) Heterozygosity SIV(+) Frequency SIV(−) PIC SIV(−) Heterozygosity SIV(−)

D6S1691 258 0.12 0.77 0.86 0.10 0.78 0.86
260 0.22 0.24
261 0.01 Not Present
265 0.20 0.13
268 0.29 0.25
270 0.08 0.10
272 0.08 0.18

D6S276 210 0.59 0.57 0.62 0.50 0.65 0.64
211 0.13 0.14
214 0.08 0.13
216 0.13 0.15
218 0.07 0.08

D6S1571 114 0.11 0.73 0.80 0.11 0.75 0.80
119 0.01 Not Present
124 0.07 0.06
126 0.42 0.37
127 0.16 0.14
131 0.01 0.01
137 0.09 0.17
139 0.13 0.14

D6S1621 269 0.01 0.19 0.20 Not Present 0.18 0.23
280 0.88 0.89
282 0.11 0.11

MML4SJ3 204 0.27 0.68 0.74 0.32 0.71 0.76
206 0.04 0.09
210 0.08 0.10
212 0.37 0.29
214 0.24 0.20

MML4SJ5 143 0.05 0.80 0.84 0.02 0.81 0.82
146 0.29 0.19
149 0.07 0.09
154 0.14 0.11
156 0.07 0.15
165 0.10 0.11
167 0.23 0.28
169 Not Present 0.03
182 0.01 Not Present
184 0.04 0.02

MML4SJ16 161 0.16 0.75 0.79 0.13 0.77 0.76
171 0.09 0.17
173 0.25 0.17
176 0.16 0.14
177 0.01 0.03
180 0.31 0.33
181 0.02 0.03

STRMICA 207 0.20 0.29 0.35 0.28 0.32 0.41
209 0.01 Not Present
224 0.79 0.72

DRACA 248 0.41 0.73 0.76 0.46 0.72 0.80
251 0.05 0.06
253 0.13 0.12
261 0.07 0.09
263 0.01 Not Present
264 0.02 0.06
265 0.12 0.10
267 0.01 0.02
269 0.18 0.09

D6S2876 224 0.13 0.69 0.71 0.06 0.63 0.66
226 0.15 0.14
228 0.32 0.41
231 0.35 0.35
238 0.04 0.04
239 0.01 Not Present

D6S2741 259 0.12 0.77 0.85 0.10 0.78 0.86
261 0.22 0.24
262 0.01 Not Present
266 0.20 0.13
269 0.29 0.25
271 0.08 0.10
273 0.08 0.18

D6S1568 116 0.78 0.28 0.40 0.73 0.32 0.46
128 0.22 0.27

D6S291 202 0.06 0.46 0.62 0.05 0.44 0.45
207 0.55 0.53
209 0.38 0.42
213 0.01 Not Present

Figure 2.

Figure 2

Haplotype frequencies. Histogram illustrating the frequency of the 18 MHC haplotypes identified in the Yerkes sooty mangabey colony that are carried by more than three individuals. Ceat-004, the most common MHC haplotype identified in the entire colony, is carried by 22.2% of the animals included in this study. Differences in frequencies of these 18 MHC haplotypes between SIV (+) and SIV (−) animals are also presented. The greatest differences in prevalence rates were seen in Ceat-028 and Ceat-008, which were present more frequently in SIV (+) animals, and Ceat-004, which was present more frequently in SIV (−) animals.

Table 3.

Haplotype frequencies. Frequencies of the 18 MHC haplotypes carried by more than three individuals in the Yerkes sooty mangabey colony. Frequencies are also listed for these haplotypes in the SIV (+) subpopulation, and the SIV (−) subpopulation.


Frequencies
Overall SIV (+) SIV (−)

Ceat-001 2.8% 2.4% 3.3%
Ceat-004 22.2% 16.7% 30.0%
Ceat-005 13.9% 10.7% 18.3%
Ceat-006 5.6% 2.4% 10.0%
Ceat-007 14.6% 11.9% 18.3%
Ceat-008 9.7% 13.1% 5.0%
Ceat-009 7.6% 6.0% 10.0%
Ceat-015 8.3% 10.7% 5.0%
Ceat-016 5.6% 4.8% 6.7%
Ceat-018 2.8% 2.4% 3.3%
Ceat-019 3.5% 1.2% 6.7%
Ceat-020 2.8% 3.6% 1.7%
Ceat-021 4.9% 4.8% 5.0%
Ceat-022 4.9% 6.0% 3.3%
Ceat-026 8.3% 7.1% 10.0%
Ceat-028 9.7% 15.5% 1.7%
Ceat-033 4.9% 4.8% 5.0%
Ceat-034 2.8% 3.6% 1.7%

Table 4.

Allele profiles. Allele profiles for the 18 haplotypes carried by more than three individuals.


Allele Profile
D6S1691 D6S276 D6S1571 D6S1621 MML4SJ3 MML4SJ5 MML4SJ16 STRMICA DRACA D6S2876 D6S2741 D6S1568 D6S291

Ceat-001 258 210 114 282 212 146 180 207 265 228 259 116 207
Ceat-004 260 210 126 280 204 167 180 224 248 228 261 116 207
Ceat-005 270 211 139 280 210 149 180 224 261 226 271 116 207
Ceat-006 265 216 126 280 206 146 173 224 264 231 266 116 209
Ceat-007 272 214 137 280 212 156 171 207 248 228 273 128 209
Ceat-008 265 210 126 280 212 146 173 224 269 231 266 116 209
Ceat-009 260 216 139 280 204 154 161 224 248 231 261 116 202
Ceat-015 258 210 114 282 212 165 180 207 265 228 259 128 207
Ceat-016 268 211 127 280 214 167 176 224 253 231 269 116 207
Ceat-018 260 210 126 280 204 167 180 224 248 231 261 116 207
Ceat-019 265 210 126 280 212 146 173 224 269 224 266 128 209
Ceat-020 268 210 127 280 214 184 176 224 253 231 269 116 207
Ceat-021 268 210 124 280 214 143 161 224 248 226 269 116 207
Ceat-022 268 210 127 280 214 167 176 224 253 231 269 116 207
Ceat-026 268 210 114 280 204 154 161 224 251 231 269 116 209
Ceat-028 265 210 126 280 212 146 173 224 269 224 266 116 209
Ceat-033 268 216 126 280 214 146 173 224 253 231 269 116 209
Ceat-034 258 218 127 282 214 165 176 207 265 228 259 116 209

Differences between SIV (+) and SIV (−) Subpopulations

Within the 127 animals carrying at least one of the 18 haplotypes carried by more than three individuals, 70 animals were naturally infected with SIV and 57 animals were seronegative for SIV. Haplotype frequencies within these subpopulations varied. The greatest differences in haplotype frequencies were observed in Ceat-028, Ceat-008, and Ceat-004. As seen in Figure 2 and Table 3, Ceat-028 and Ceat-008 were present more frequently in SIV (+) animals while Ceat-004 was present more frequently in SIV (−) animals. In addition, as noted in Table 2, nine marker alleles were present in the SIV(+) subpopulation and absent in the SIV (−) subpopulation while one marker allele was present in the SIV (−) subpopulation and absent in the SIV (+) subpopulation.

Discussion

Understanding immunologic responses to SIV infection in natural-host nonhuman primate species has been identified as a necessary component of HIV vaccine development [50]. Comparisons between sooty mangabeys and rhesus macaques have been used extensively to delineate these responses [12, 13, 19, 2729, 31, 37, 40, 4547, 5254]. The colony of sooty mangabeys at Yerkes National Primate Research Center is the largest source of animals naturally-infected with SIV and animals that are SIV-naïve, and as such, it represents a valuable resource for HIV research.

Immune system responses to infectious agents, including SIV and HIV, have been shown to vary with MHC haplotype. Specific MHC haplotypes in both Asian nonhuman primates and humans have been associated with aberrant, desirable disease progression patterns that prolong the chronic phase of immunodeficiency virus infection, which occurs prior to the onset of clinical AIDS. [1, 7, 10, 34, 49, 60]. Based on data collected in this study, it is clear that MHC microsatellite marker allele profiles differ among humans, Asian nonhuman primates, and sooty mangabeys. However, it is likely that the expressed protein profiles are similar in specific haplotypes identified across species. Additionally, due to the close evolutionary relationship between sooty mangabeys, Asian nonhuman primates, and humans, it is likely that specific sooty mangabey MHC haplotypes identified in this study will also be associated with desirable immune response phenotypes. Identification and characterization of the mechanisms resulting in these phenotypes will lead to improved HIV treatment or vaccination strategies.

In nonhuman primates, the MHC region is both highly polygenic and highly polymorphic [18, 38]. Consequently, variability in MHC genetic content is inherent in most populations of nonhuman primates used for research. This genetic variability results in levels of data variance in infectious disease research that could mask important but subtle differences in immune responses. As shown by studies completed in Mauritian cynomolgus macaques, a population of Asian nonhuman primates that display a limited MHC haplotype repertoire due a founder effect and their continued geographical isolation from other cynomolgus macaque populations, improved experimental design and data interpretation in SIV research projects are possible when the MHC haplotypes of individual animals included in the study are known and limited [5, 710, 30, 35, 36, 57, 58]. Here, we provide a tool for future researchers using sooty mangabeys from the Yerkes colony to include MHC haplotype information in their experimental design and data interpretation.

We used microsatellite-based haplotyping to characterize the MHC at the level of DNA. Alternative approaches for defining individual animal’s MHC include using full-length cDNA sequencing of MHC transcripts or using high-resolution pyrosequencing of MHC transcripts. These alternative methods are complicated by the presence of duplicate regions of the MHC genome yielding multiple copies of individual loci in nonhuman primates that are absent in humans [57]. The consequence of this duplication is that multiple transcripts per gene may be present in each animal. Additionally, it has been shown that expression of MHC transcripts is dependent upon cell type [21]. By using genomic DNA as opposed to RNA transcripts, microsatellite-based MHC haplotyping presents the most straightforward, efficient, and cost-effective method of defining individual immunogenetics in nonhuman primates [1517, 38].

Samples were collected from 144 animals for this study. A total of 73 unique microsatellite-based MHC haplotypes were identified within these animals. However, only 18 of these haplotypes were present in more than three individuals within the population. These 18 haplotypes had prevalence rates up to 22.2% of the population, and 127 out of the 144 (88.2%) animals tested carried one of these 18 haplotypes. This pattern of relatively few haplotypes being present in the majority of the animals in this population is similar to that observed by Wiseman, et al. when they used microsatellite-based MHC haplotyping to characterize the cynomolgus macaque population of the island of Mauritius [58]. Mauritian cynomolgus macaques are descended from a small founder population that was brought to the island approximately 500 years ago, and the population has been geographically isolated since that time [55]. Similarly, the sooty mangabey colony at Yerkes National Primate Research Center was founded by a small group of 22 animals 36 years prior to sample collection for this project [43]. Due to their protected status as a CITES appendix II animal and the subsequent limits placed on importation of this species, the colony of sooty mangabeys at Yerkes has remained genetically isolated. Therefore, the relative homogeneity of MHC haplotypes present in this population is expected, and it may prove to be useful in future studies that seek to use animals with identical MHC haplotypes.

The 22 founding animals of the Yerkes sooty mangabey colony could have carried at most 44 different MHC haplotypes. Considering that this colony has been closed since its inception, it is potentially paradoxical that our data suggest a minimum of 73 MHC haplotypes are present in the colony currently. A likely explanation for this potential paradox is the occurrence of recombination events. Most of these events would likely occur between our most centromeric microsatellite marker, D6S291, and our most telomeric microsatellite marker, D6S1691. Table 5 illustrates one such possible recombination event that may have occurred in an animal carrying both the Ceat-006 and the Ceat-019 haplotyes, which could have generated the Ceat-008 haplotype. Differences in MHC haplotype frequencies between naturally infected SIV (+) animals and SIV (−) animals were observed within the Yerkes sooty mangabey colony. Some MHC haplotypes were present more frequently in the SIV (+) subpopulation while some MHC haplotypes were present more frequently in the SIV (−) subpopulation. These differences are likely due to the management practices in place at the Yerkes National Primate Research Center Field Station, which physically separate naturally infected SIV (+) and SIV (−) animals.

Table 5.

Recombination event. Example of a possible recombination event between Ceat-006 and Ceat-019, which created Ceat-008.


Allele Profile
D6S1691 D6S276 D6S1571 D6S1621 MML4SJ3 MML4SJ5 MML4SJ16 STRMICA DRACA D6S2876 D6S2741 D6S1568 D6S291

Ceat-019 265 210 126 280 212 146 173 224 269 224 266 128 209
Ceat-008 265 210 126 280 212 146 173 224 269 231 266 116 209
Ceat-006 265 216 126 280 206 146 173 224 264 231 266 116 209

In conclusion, the colony of sooty mangabeys at the Yerkes National Primate Research Center Field Station represents a valuable resource for HIV vaccine development research. The use of Immunogenetics Management Software to create a microsatellite-based database of MHC haplotypes for this colony has created a tool for future projects to use in order to give their experiments greater power. This increase in power could potentially unmask subtle differences in immune responses between experimental groups and lower the number of animals necessary to reliably identify effects.

Supplementary Material

Supp TableS1. Supplemental Table 1.

Primer panels. Three, multiplexed primer panels were used to genotype each animal in this study. This table lists the microsatellite marker primers included in each panel along with the expected fragment length range for each individual microsatellite marker.

Acknowledgments

Funding Source: NIH Grant Number 3 P51 RR000165-49S4

We thank Nirav Patel, Leslie Kean, and Roger Wiseman for their expert technical assistance. Research reported in this publication was supported by the Office of Research Infrastructure Programs of the National Institutes of Health under award number 3 P51 RR000165-49S4.

Footnotes

The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

References

  • 1.Aarnink A, Garchon HJ, Puissant-Lubrano B, Blancher-Sardou M, Apoil PA, Blancher A. Impact of MHC class II polymorphism on blood counts of CD4+ T lymphocytes in macaque. Immunogenetics. 2011;63:95–102. doi: 10.1007/s00251-010-0492-6. [DOI] [PubMed] [Google Scholar]
  • 2.Adland E, Carlson JM, Paioni P, Kloverpris H, Shapiro R, Ogwu A, Riddell L, Luzzi G, Chen F, Balachandran T, Heckerman D, Stryhn A, Edwards A, Ndung’u T, Walker BD, Buus S, Goulder P, Matthews PC. Nef-specific CD8+ T cell responses contribute to HIV-1 immune control. PLoS One. 2013;8:e73117. doi: 10.1371/journal.pone.0073117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Apetrei C, Kaur A, Lerche NW, Metzger M, Pandrea I, Hardcastle J, Falkenstein S, Bohm R, Koehler J, Traina-Dorge V, Williams T, Staprans S, Plauche G, Veazey RS, McClure H, Lackner AA, Gormus B, Robertson DL, Marx PA. Molecular epidemiology of simian immunodeficiency virus SIVsm in U.S. primate centers unravels the origin of SIVmac and SIVstm. J Virol. 2005;79:8991–9005. doi: 10.1128/JVI.79.14.8991-9005.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Apetrei C, Lerche NW, Pandrea I, Gormus B, Silvestri G, Kaur A, Robertson DL, Hardcastle J, Lackner AA, Marx PA. Kuru experiments triggered the emergence of pathogenic SIVmac. AIDS. 2006;20:317–321. doi: 10.1097/01.aids.0000206498.71041.0e. [DOI] [PubMed] [Google Scholar]
  • 5.Blancher A, Aarnink A, Tanaka K, Ota M, Inoko H, Yamanaka H, Nakagawa H, Apoil PA, Shiina T. Study of cynomolgus monkey (Macaca fascicularis) Mhc DRB gene polymorphism in four populations. Immunogenetics. 2012;64:605–614. doi: 10.1007/s00251-012-0613-5. [DOI] [PubMed] [Google Scholar]
  • 6.Bontrop RE, Watkins DI. MHC polymorphism: AIDS susceptibility in non-human primates. Trends Immunol. 2005;26:227–233. doi: 10.1016/j.it.2005.02.003. [DOI] [PubMed] [Google Scholar]
  • 7.Budde ML, Lhost JJ, Burwitz BJ, Becker EA, Burns CM, O’Connor SL, Karl JA, Wiseman RW, Bimber BN, Zhang GL, Hildebrand W, Brusic V, O’Connor DH. Transcriptionally abundant major histocompatibility complex class I alleles are fundamental to nonhuman primate simian immunodeficiency virus-specific CD8+ T cell responses. J Virol. 2011;85:3250–3261. doi: 10.1128/JVI.02355-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Budde ML, Wiseman RW, Karl JA, Hanczaruk B, Simen BB, O’Connor DH. Characterization of Mauritian cynomolgus macaque major histocompatibility complex class I haplotypes by high-resolution pyrosequencing. Immunogenetics. 2010;62:773–780. doi: 10.1007/s00251-010-0481-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Burwitz BJ, Pendley CJ, Greene JM, Detmer AM, Lhost JJ, Karl JA, Piaskowski SM, Rudersdorf RA, Wallace LT, Bimber BN, Loffredo JT, Cox DG, Bardet W, Hildebrand W, Wiseman RW, O’Connor SL, O’Connor DH. Mauritian cynomolgus macaques share two exceptionally common major histocompatibility complex class I alleles that restrict simian immunodeficiency virus-specific CD8+ T cells. J Virol. 2009;83:6011–6019. doi: 10.1128/JVI.00199-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Cafaro A, Bellino S, Titti F, Maggiorella MT, Sernicola L, Wiseman RW, Venzon D, Karl JA, O’Connor D, Monini P, Robert-Guroff M, Ensoli B. Impact of viral dose and major histocompatibility complex class IB haplotype on viral outcome in mauritian cynomolgus monkeys vaccinated with Tat upon challenge with simian/human immunodeficiency virus SHIV89. 6P. J Virol. 2010;84:8953–8958. doi: 10.1128/JVI.00377-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chahroudi A, Bosinger SE, Vanderford TH, Paiardini M, Silvestri G. Natural SIV hosts: showing AIDS the door. Science. 2012;335:1188–1193. doi: 10.1126/science.1217550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chahroudi A, Cartwright E, Lee ST, Mavigner M, Carnathan DG, Lawson B, Carnathan PM, Hashempoor T, Murphy MK, Meeker T, Ehnert S, Souder C, Else JG, Cohen J, Collman RG, Vanderford TH, Permar SR, Derdeyn CA, Villinger F, Silvestri G. Target cell availability, rather than breast milk factors, dictates mother-to-infant transmission of SIV in sooty mangabeys and rhesus macaques. PLoS Pathog. 2014;10:e1003958. doi: 10.1371/journal.ppat.1003958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.d’Ettorre G, Paiardini M, Ceccarelli G, Silvestri G, Vullo V. HIV-associated immune activation: from bench to bedside. AIDS Res Hum Retroviruses. 2011;27:355–364. doi: 10.1089/aid.2010.0342. [DOI] [PubMed] [Google Scholar]
  • 14.DeGottardi MQ, Specht A, Metcalf B, Kaur A, Kirchhoff F, Evans DT. Selective downregulation of rhesus macaque and sooty mangabey major histocompatibility complex class I molecules by Nef alleles of simian immunodeficiency virus and human immunodeficiency virus type 2. J Virol. 2008;82:3139–3146. doi: 10.1128/JVI.02102-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Doxiadis GG, de Groot N, Otting N, Blokhuis JH, Bontrop RE. Genomic plasticity of the MHC class I A region in rhesus macaques: extensive haplotype diversity at the population level as revealed by microsatellites. Immunogenetics. 2011;63:73–83. doi: 10.1007/s00251-010-0486-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Doxiadis GG, de Groot N, Otting N, de Vos-Rouweler AJ, Bolijn MJ, Heijmans CM, de Groot NG, van der Wiel MK, Remarque EJ, Vangenot C, Nunes JM, Sanchez-Mazas A, Bontrop RE. Haplotype diversity generated by ancient recombination-like events in the MHC of Indian rhesus macaques. Immunogenetics. 2013;65:569–584. doi: 10.1007/s00251-013-0707-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Doxiadis GG, Heijmans CM, Bonhomme M, Otting N, Crouau-Roy B, Bontrop RE. Compound evolutionary history of the rhesus macaque MHC class I B region revealed by microsatellite analysis and localization of retroviral sequences. PLoS One. 2009;4:e4287. doi: 10.1371/journal.pone.0004287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Doxiadis GG, Otting N, de Groot NG, Noort R, Bontrop RE. Unprecedented polymorphism of Mhc-DRB region configurations in rhesus macaques. J Immunol. 2000;164:3193–3199. doi: 10.4049/jimmunol.164.6.3193. [DOI] [PubMed] [Google Scholar]
  • 19.Dunham R, Pagliardini P, Gordon S, Sumpter B, Engram J, Moanna A, Paiardini M, Mandl JN, Lawson B, Garg S, McClure HM, Xu YX, Ibegbu C, Easley K, Katz N, Pandrea I, Apetrei C, Sodora DL, Staprans SI, Feinberg MB, Silvestri G. The AIDS resistance of naturally SIV-infected sooty mangabeys is independent of cellular immunity to the virus. Blood. 2006;108:209–217. doi: 10.1182/blood-2005-12-4897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Foley C, O’Farrelly C, Meade KG. Technical note: Comparative analyses of the quality and yield of genomic DNA from invasive and noninvasive, automated and manual extraction methods. J Dairy Sci. 2011;94:3159–3165. doi: 10.3168/jds.2010-3987. [DOI] [PubMed] [Google Scholar]
  • 21.Greene JM, Wiseman RW, Lank SM, Bimber BN, Karl JA, Burwitz BJ, Lhost JJ, Hawkins OE, Kunstman KJ, Broman KW, Wolinsky SM, Hildebrand WH, O’Connor DH. Differential MHC class I expression in distinct leukocyte subsets. BMC Immunol. 2011;12:39. doi: 10.1186/1471-2172-12-39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hirsch VM, Olmsted RA, Murphey-Corb M, Purcell RH, Johnson PR. An African primate lentivirus (SIVsm) closely related to HIV-2. Nature. 1989;339:389–392. doi: 10.1038/339389a0. [DOI] [PubMed] [Google Scholar]
  • 23.International HIVCS. Pereyra F, Jia X, McLaren PJ, Telenti A, de Bakker PI, Walker BD, Ripke S, Brumme CJ, Pulit SL, Carrington M, Kadie CM, Carlson JM, Heckerman D, Graham RR, Plenge RM, Deeks SG, Gianniny L, Crawford G, Sullivan J, Gonzalez E, Davies L, Camargo A, Moore JM, Beattie N, Gupta S, Crenshaw A, Burtt NP, Guiducci C, Gupta N, Gao X, Qi Y, Yuki Y, Piechocka-Trocha A, Cutrell E, Rosenberg R, Moss KL, Lemay P, O’Leary J, Schaefer T, Verma P, Toth I, Block B, Baker B, Rothchild A, Lian J, Proudfoot J, Alvino DM, Vine S, Addo MM, Allen TM, Altfeld M, Henn MR, Le Gall S, Streeck H, Haas DW, Kuritzkes DR, Robbins GK, Shafer RW, Gulick RM, Shikuma CM, Haubrich R, Riddler S, Sax PE, Daar ES, Ribaudo HJ, Agan B, Agarwal S, Ahern RL, Allen BL, Altidor S, Altschuler EL, Ambardar S, Anastos K, Anderson B, Anderson V, Andrady U, Antoniskis D, Bangsberg D, Barbaro D, Barrie W, Bartczak J, Barton S, Basden P, Basgoz N, Bazner S, Bellos NC, Benson AM, Berger J, Bernard NF, Bernard AM, Birch C, Bodner SJ, Bolan RK, Boudreaux ET, Bradley M, Braun JF, Brndjar JE, Brown SJ, Brown K, Brown ST, Burack J, Bush LM, Cafaro V, Campbell O, Campbell J, Carlson RH, Carmichael JK, Casey KK, Cavacuiti C, Celestin G, Chambers ST, Chez N, Chirch LM, Cimoch PJ, Cohen D, Cohn LE, Conway B, Cooper DA, Cornelson B, Cox DT, Cristofano MV, Cuchural G, Jr, Czartoski JL, Dahman JM, Daly JS, Davis BT, Davis K, Davod SM, DeJesus E, Dietz CA, Dunham E, Dunn ME, Ellerin TB, Eron JJ, Fangman JJ, Farel CE, Ferlazzo H, Fidler S, Fleenor-Ford A, Frankel R, Freedberg KA, French NK, Fuchs JD, Fuller JD, Gaberman J, Gallant JE, Gandhi RT, Garcia E, Garmon D, Gathe JC, Jr, Gaultier CR, Gebre W, Gilman FD, Gilson I, Goepfert PA, Gottlieb MS, Goulston C, Groger RK, Gurley TD, Haber S, Hardwicke R, Hardy WD, Harrigan PR, Hawkins TN, Heath S, Hecht FM, Henry WK, Hladek M, Hoffman RP, Horton JM, Hsu RK, Huhn GD, Hunt P, Hupert MJ, Illeman ML, Jaeger H, Jellinger RM, John M, Johnson JA, Johnson KL, Johnson H, Johnson K, Joly J, Jordan WC, Kauffman CA, Khanlou H, Killian RK, Kim AY, Kim DD, Kinder CA, Kirchner JT, Kogelman L, Kojic EM, Korthuis PT, Kurisu W, Kwon DS, LaMar M, Lampiris H, Lanzafame M, Lederman MM, Lee DM, Lee JM, Lee MJ, Lee ET, Lemoine J, Levy JA, Llibre JM, Liguori MA, Little SJ, Liu AY, Lopez AJ, Loutfy MR, Loy D, Mohammed DY, Man A, Mansour MK, Marconi VC, Markowitz M, Marques R, Martin JN, Martin HL, Jr, Mayer KH, McElrath MJ, McGhee TA, McGovern BH, McGowan K, McIntyre D, McLeod GX, Menezes P, Mesa G, Metroka CE, Meyer-Olson D, Miller AO, Montgomery K, Mounzer KC, Nagami EH, Nagin I, Nahass RG, Nelson MO, Nielsen C, Norene DL, O’Connor DH, Ojikutu BO, Okulicz J, Oladehin OO, Oldfield EC, 3rdOlender SA, Ostrowski M, Owen WF, Jr, Pae E, Parsonnet J, Pavlatos AM, Perlmutter AM, Pierce MN, Pincus JM, Pisani L, Price LJ, Proia L, Prokesch RC, Pujet HC, Ramgopal M, Rathod A, Rausch M, Ravishankar J, Rhame FS, Richards CS, Richman DD, Rodes B, Rodriguez M, Rose RC, 3rdRosenberg ES, Rosenthal D, Ross PE, Rubin DS, Rumbaugh E, Saenz L, Salvaggio MR, Sanchez WC, Sanjana VM, Santiago S, Schmidt W, Schuitemaker H, Sestak PM, Shalit P, Shay W, Shirvani VN, Silebi VI, Sizemore JM, Jr, Skolnik PR, Sokol-Anderson M, Sosman JM, Stabile P, Stapleton JT, Starrett S, Stein F, Stellbrink HJ, Sterman FL, Stone VE, Stone DR, Tambussi G, Taplitz RA, Tedaldi EM, Telenti A, Theisen W, Torres R, Tosiello L, Tremblay C, Tribble MA, Trinh PD, Tsao A, Ueda P, Vaccaro A, Valadas E, Vanig TJ, Vecino I, Vega VM, Veikley W, Wade BH, Walworth C, Wanidworanun C, Ward DJ, Warner DA, Weber RD, Webster D, Weis S, Wheeler DA, White DJ, Wilkins E, Winston A, Wlodaver CG, van’t Wout A, Wright DP, Yang OO, Yurdin DL, Zabukovic BW, Zachary KC, Zeeman B, Zhao M. The major genetic determinants of HIV-1 control affect HLA class I peptide presentation. Science. 2010;330:1551–1557. doi: 10.1126/science.1195271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Johnson ZP, Eady RD, Ahmad SF, Agravat S, Morris T, Else J, Lank SM, Wiseman RW, O’Connor DH, Penedo MC, Larsen CP, Kean LS. Immunogenetic Management Software: a new tool for visualization and analysis of complex immunogenetic datasets. Immunogenetics. 2012;64:329–336. doi: 10.1007/s00251-011-0587-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Klatt NR, Silvestri G, Hirsch V. Nonpathogenic simian immunodeficiency virus infections. Cold Spring Harb Perspect Med. 2012;2:a007153. doi: 10.1101/cshperspect.a007153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Korber B, Muldoon M, Theiler J, Gao F, Gupta R, Lapedes A, Hahn BH, Wolinsky S, Bhattacharya T. Timing the ancestor of the HIV-1 pandemic strains. Science. 2000;288:1789–1796. doi: 10.1126/science.288.5472.1789. [DOI] [PubMed] [Google Scholar]
  • 27.Martinot AJ, Meythaler M, Pozzi LA, Dalecki Boisvert K, Knight H, Walsh D, Westmoreland S, Anderson DC, Kaur A, O’Neil SP. Acute SIV infection in sooty mangabey monkeys is characterized by rapid virus clearance from lymph nodes and absence of productive infection in germinal centers. PLoS One. 2013;8:e57785. doi: 10.1371/journal.pone.0057785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Marx PA, Li Y, Lerche NW, Sutjipto S, Gettie A, Yee JA, Brotman BH, Prince AM, Hanson A, Webster RG, et al. Isolation of a simian immunodeficiency virus related to human immunodeficiency virus type 2 from a west African pet sooty mangabey. J Virol. 1991;65:4480–4485. doi: 10.1128/jvi.65.8.4480-4485.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.McGary CS, Cervasi B, Chahroudi A, Micci L, Taaffe J, Meeker T, Silvestri G, Davenport MP, Paiardini M. Increased stability and limited proliferation of CD4+ central memory T cells differentiate nonprogressive simian immunodeficiency virus (SIV) infection of sooty mangabeys from progressive SIV infection of rhesus macaques. J Virol. 2014;88:4533–4542. doi: 10.1128/JVI.03515-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Mee ET, Badhan A, Karl JA, Wiseman RW, Cutler K, Knapp LA, Almond N, O’Connor DH, Rose NJ. MHC haplotype frequencies in a UK breeding colony of Mauritian cynomolgus macaques mirror those found in a distinct population from the same geographic origin. J Med Primatol. 2009;38:1–14. doi: 10.1111/j.1600-0684.2008.00299.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Munch J, Schindler M, Wildum S, Rucker E, Bailer N, Knoop V, Novembre FJ, Kirchhoff F. Primary sooty mangabey simian immunodeficiency virus and human immunodeficiency virus type 2 nef alleles modulate cell surface expression of various human receptors and enhance viral infectivity and replication. J Virol. 2005;79:10547–10560. doi: 10.1128/JVI.79.16.10547-10560.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Nagy S, Poczai P, Cernak I, Gorji AM, Hegedus G, Taller J. PICcalc: an online program to calculate polymorphic information content for molecular genetic studies. Biochem Genet. 2012;50:670–672. doi: 10.1007/s10528-012-9509-1. [DOI] [PubMed] [Google Scholar]
  • 33.Nomura T, Matano T. Association of MHC-I genotypes with disease progression in HIV/SIV infections. Front Microbiol. 2012;3:234. doi: 10.3389/fmicb.2012.00234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Nomura T, Yamamoto H, Takahashi N, Naruse TK, Kimura A, Matano T. Identification of SIV Nef CD8(+) T cell epitopes restricted by a MHC class I haplotype associated with lower viral loads in a macaque AIDS model. Biochem Biophys Res Commun. 2014;450:942–947. doi: 10.1016/j.bbrc.2014.06.072. [DOI] [PubMed] [Google Scholar]
  • 35.O’Connor SL, Blasky AJ, Pendley CJ, Becker EA, Wiseman RW, Karl JA, Hughes AL, O’Connor DH. Comprehensive characterization of MHC class II haplotypes in Mauritian cynomolgus macaques. Immunogenetics. 2007;59:449–462. doi: 10.1007/s00251-007-0209-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.O’Connor SL, Lhost JJ, Becker EA, Detmer AM, Johnson RC, Macnair CE, Wiseman RW, Karl JA, Greene JM, Burwitz BJ, Bimber BN, Lank SM, Tuscher JJ, Mee ET, Rose NJ, Desrosiers RC, Hughes AL, Friedrich TC, Carrington M, O’Connor DH. MHC heterozygote advantage in simian immunodeficiency virus-infected Mauritian cynomolgus macaques. Sci Transl Med. 2010;2:22ra18. doi: 10.1126/scitranslmed.3000524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Pandrea I, Apetrei C, Gordon S, Barbercheck J, Dufour J, Bohm R, Sumpter B, Roques P, Marx PA, Hirsch VM, Kaur A, Lackner AA, Veazey RS, Silvestri G. Paucity of CD4+CCR5+ T cells is a typical feature of natural SIV hosts. Blood. 2007;109:1069–1076. doi: 10.1182/blood-2006-05-024364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Penedo MC, Bontrop RE, Heijmans CM, Otting N, Noort R, Rouweler AJ, de Groot N, de Groot NG, Ward T, Doxiadis GG. Microsatellite typing of the rhesus macaque MHC region. Immunogenetics. 2005;57:198–209. doi: 10.1007/s00251-005-0787-1. [DOI] [PubMed] [Google Scholar]
  • 39.Raveendran M, Harris RA, Milosavljevic A, Johnson Z, Shelledy W, Cameron J, Rogers J. Designing new microsatellite markers for linkage and population genetic analyses in rhesus macaques and other nonhuman primates. Genomics. 2006;88:706–710. doi: 10.1016/j.ygeno.2006.08.009. [DOI] [PubMed] [Google Scholar]
  • 40.Rey-Cuille MA, Berthier JL, Bomsel-Demontoy MC, Chaduc Y, Montagnier L, Hovanessian AG, Chakrabarti LA. Simian immunodeficiency virus replicates to high levels in sooty mangabeys without inducing disease. J Virol. 1998;72:3872–3886. doi: 10.1128/jvi.72.5.3872-3886.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Rogers J, Garcia R, Shelledy W, Kaplan J, Arya A, Johnson Z, Bergstrom M, Novakowski L, Nair P, Vinson A, Newman D, Heckman G, Cameron J. An initial genetic linkage map of the rhesus macaque (Macaca mulatta) genome using human microsatellite loci. Genomics. 2006;87:30–38. doi: 10.1016/j.ygeno.2005.10.004. [DOI] [PubMed] [Google Scholar]
  • 42.Salemi M, Strimmer K, Hall WW, Duffy M, Delaporte E, Mboup S, Peeters M, Vandamme AM. Dating the common ancestor of SIVcpz and HIV-1 group M and the origin of HIV-1 subtypes using a new method to uncover clock-like molecular evolution. Faseb Journal. 2001;15:276–278. doi: 10.1096/fj.00-0449fje. [DOI] [PubMed] [Google Scholar]
  • 43.Sharma P, Chennareddi L, Greene-Hartsfield EZ, Villinger F, Cohen JK, Herndon JG. Hematology and serum chemistry values of sooty mangabeys (Cercocebus atys): comparison with rhesus monkeys. J Med Primatol. 2014;43:78–88. doi: 10.1111/jmp.12091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Sharp PM, Hahn BH. Origins of HIV and the AIDS pandemic. Cold Spring Harb Perspect Med. 2011;1:a006841. doi: 10.1101/cshperspect.a006841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Silvestri G. AIDS pathogenesis: a tale of two monkeys. J Med Primatol. 2008;37 (Suppl 2):6–12. doi: 10.1111/j.1600-0684.2008.00328.x. [DOI] [PubMed] [Google Scholar]
  • 46.Silvestri G. Naturally SIV-infected sooty mangabeys: are we closer to understanding why they do not develop AIDS? J Med Primatol. 2005;34:243–252. doi: 10.1111/j.1600-0684.2005.00122.x. [DOI] [PubMed] [Google Scholar]
  • 47.Silvestri G, Fedanov A, Germon S, Kozyr N, Kaiser WJ, Garber DA, McClure H, Feinberg MB, Staprans SI. Divergent host responses during primary simian immunodeficiency virus SIVsm infection of natural sooty mangabey and nonnatural rhesus macaque hosts. J Virol. 2005;79:4043–4054. doi: 10.1128/JVI.79.7.4043-4054.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Silvestri G, Paiardini M, Pandrea I, Lederman MM, Sodora DL. Understanding the benign nature of SIV infection in natural hosts. J Clin Invest. 2007;117:3148–3154. doi: 10.1172/JCI33034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Singh P, Kaur G, Sharma G, Mehra NK. Immunogenetic basis of HIV-1 infection, transmission and disease progression. Vaccine. 2008;26:2966–2980. doi: 10.1016/j.vaccine.2008.01.012. [DOI] [PubMed] [Google Scholar]
  • 50.Sodora DL, Allan JS, Apetrei C, Brenchley JM, Douek DC, Else JG, Estes JD, Hahn BH, Hirsch VM, Kaur A, Kirchhoff F, Muller-Trutwin M, Pandrea I, Schmitz JE, Silvestri G. Toward an AIDS vaccine: lessons from natural simian immunodeficiency virus infections of African nonhuman primate hosts. Nat Med. 2009;15:861–865. doi: 10.1038/nm.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Sopper S, Matz-Rensing K, Muhl T, Heeney J, Stahl-Hennig C, Sauermann U. Host factors determine differential disease progression after infection with nef-deleted simian immunodeficiency virus. J Gen Virol. 2014 doi: 10.1099/vir.0.066563-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Sumpter B, Dunham R, Gordon S, Engram J, Hennessy M, Kinter A, Paiardini M, Cervasi B, Klatt N, McClure H, Milush JM, Staprans S, Sodora DL, Silvestri G. Correlates of preserved CD4(+) T cell homeostasis during natural, nonpathogenic simian immunodeficiency virus infection of sooty mangabeys: implications for AIDS pathogenesis. J Immunol. 2007;178:1680–1691. doi: 10.4049/jimmunol.178.3.1680. [DOI] [PubMed] [Google Scholar]
  • 53.Sundaravaradan V, Mir KD, Sodora DL. Double-negative T cells during HIV/SIV infections: potential pinch hitters in the T-cell lineup. Curr Opin HIV AIDS. 2012;7:164–171. doi: 10.1097/COH.0b013e3283504a66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Sundaravaradan V, Saleem R, Micci L, Gasper MA, Ortiz AM, Else J, Silvestri G, Paiardini M, Aitchison JD, Sodora DL. Multifunctional double-negative T cells in sooty mangabeys mediate T-helper functions irrespective of SIV infection. PLoS Pathog. 2013;9:e1003441. doi: 10.1371/journal.ppat.1003441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Sussman RW, Tattersall I. Distribution, Abundance, and Putative Ecological Strategy of Macaca fascicularison the Island of Mauritius, Southwestern Indian Ocean. Folia Primatologica. 1986;46:28–43. [Google Scholar]
  • 56.VandeWoude S, Apetrei C. Going wild: lessons from naturally occurring T-lymphotropic lentiviruses. Clin Microbiol Rev. 2006;19:728–762. doi: 10.1128/CMR.00009-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Wiseman RW, Karl JA, Bohn PS, Nimityongskul FA, Starrett GJ, O’Connor DH. Haplessly hoping: macaque major histocompatibility complex made easy. ILAR J. 2013;54:196–210. doi: 10.1093/ilar/ilt036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Wiseman RW, Wojcechowskyj JA, Greene JM, Blasky AJ, Gopon T, Soma T, Friedrich TC, O’Connor SL, O’Connor DH. Simian immunodeficiency virus SIVmac239 infection of major histocompatibility complex-identical cynomolgus macaques from Mauritius. J Virol. 2007;81:349–361. doi: 10.1128/JVI.01841-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Worobey M, Telfer P, Souquiere S, Hunter M, Coleman CA, Metzger MJ, Reed P, Makuwa M, Hearn G, Honarvar S, Roques P, Apetrei C, Kazanji M, Marx PA. Island biogeography reveals the deep history of SIV. Science. 2010;329:1487. doi: 10.1126/science.1193550. [DOI] [PubMed] [Google Scholar]
  • 60.Zhang H, Zhao B, Han X, Wang Z, Liu B, Lu C, Zhang M, Liu J, Chen O, Hu Q, Jiang F, Shang H. Associations of HLA class I antigen specificities and haplotypes with disease progression in HIV-1-infected Hans in Northern China. Hum Immunol. 2013;74:1636–1642. doi: 10.1016/j.humimm.2013.08.287. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp TableS1. Supplemental Table 1.

Primer panels. Three, multiplexed primer panels were used to genotype each animal in this study. This table lists the microsatellite marker primers included in each panel along with the expected fragment length range for each individual microsatellite marker.

RESOURCES