Skip to main content
PLOS One logoLink to PLOS One
. 2015 Mar 30;10(3):e0123026. doi: 10.1371/journal.pone.0123026

Baseline Survey of Root-Associated Microbes of Taxus chinensis (Pilger) Rehd

Qian Zhang 1,#, Hongwei Liu 1,#, Guiling Sun 2, Iain W Wilson 3, Jianqiang Wu 2, Angela Hoffman 4, Junwen Cheng 5, Deyou Qiu 1,*
Editor: Seon-Woo Lee6
PMCID: PMC4378922  PMID: 25821956

Abstract

Taxol (paclitaxel) a diterpenoid is one of the most effective anticancer drugs identified. Biosynthesis of taxol was considered restricted to the Taxus genera until Stierle et al. discovered that an endophytic fungus isolated from Taxus brevifolia could independently synthesize taxol. Little is known about the mechanism of taxol biosynthesis in microbes, but it has been speculated that its biosynthesis may differ from plants. The microbiome from the roots of Taxus chinensis have been extensively investigated with culture-dependent methods to identify taxol synthesizing microbes, but not using culture independent methods.,Using bar-coded high-throughput sequencing in combination with a metagenomics approach, we surveyed the microbial diversity and gene composition of the root-associated microbiomefrom Taxus chinensis (Pilger) Rehd. High-throughput amplicon sequencing revealed 187 fungal OTUs which is higher than any previously reported fungal number identified with the culture-dependent method, suggesting that T. chinensis roots harbor novel and diverse fungi. Some operational taxonomic units (OTU) identified were identical to reported microbe strains possessing the ability to synthesis taxol and several genes previously associated with taxol biosynthesis were identified through metagenomics analysis.

Introduction

Taxol (paclitaxel), a complex diterpenoid first isolated from the bark of pacific yew tree (Taxus brevifolia), is widely used in chemotherapy treatment of lung, ovarian and breast cancer [1, 2]. The supply of taxol is currently constrained and supplied by a number of routes including harvesting from relatively slow-growing Taxus trees [3]. Thus, alternative sources for taxol have been actively explored for the past 20 years, including a search for taxol-producing microorganisms [4].

Fungal endophytes are well known sources of diverse biologically active secondary metabolites, with a number of applications as pharmaceutical products. In 1993, Stierle and colleagues discovered that an endophytic fungus from Taxus brevifolia could independently synthesize taxol [5]. This groundbreaking work resulted in the identification of a large number of endophytes isolated from Taxus species [6] and other medicinal plants [7–9], and the study of their ability to synthesize taxol and other chemicals with therapeutic uses. Other than fungi, several bacterial strains were subsequently found to have the capacity to produce taxol [10, 11] (S1 Table).

Potential advantages of microbial taxol production include fast growth at high cell density, relatively easy genetic manipulation, and the possibility of scaling up to an industrial level [12]. Current research on microbe-related taxol-production focuses on screening taxol-producing endophytic microbes [5], heterologous expression of taxol precursors in microorganisms [13] improving taxol yield by genome shuffling [14], genetic engineering [15], and process optimization [16].

Many studies have focused on biosynthesis of taxol. In Taxus, the biosynthetic pathway of taxol has been clearly elucidated, consisting of 13 genes (S2 Table). There have been several reports focusing on the molecular basis of taxol-production in microorganisms; however, little is known about the synthesis mechanism of taxol in microbes. Taxus-derived genes or their fragments responsible for taxol synthesis have been used as molecular probes for the screening of microorganisms [17]. Several genes that encode the corresponding taxol pathway enzymes previously found in Taxus spp. were reported to exist in endophytic fungi [18–21]. However, studies also showed that existence of these genes does not guarantee the ability to synthesize taxol. For example, among 12 endophytic fungal strains containing the taxadiene synthase gene (TS), which encodes a rate-limiting enzyme in the taxol biosynthetic pathway in Taxus, only 3 strains could synthesize taxol [22]. Even in the strains that possess a functional TS gene, the ability to synthesize the precursor for taxol has not been verified. It has been speculated that the biosynthesis pathway of taxol in microbes is different from that in Taxus [17], which is supported by the finding that candidate taxol biosynthetic genes from the taxol synthesizing Penicillium aurantiogriseum NRRL 62431 were significantly different and had evolved independently from plants [23].

Next generation sequencing technologies have enabled metagenomic and metagenetic analysis of soil microorganism species and gene composition of microbiota [24, 25]. However, there are currently no studies characterizing species and gene composition of root associated microbiome of the roots from Taxus. In this study, we used bar-coded high-throughput sequencing with primers targeting the 16S and 18S rRNA genes to survey root associated bacterial and fungal diversity of Taxus root, in conjunction with a metagenome approach to survey microbial species and gene composition in its root associated microbiome. We also studied genes putatively associated with taxol biosynthesis in the Taxus root associated microbiome to estimate the prevalence of taxol biosynthetic genes in the root associated microbiome.

Results and Discussion

The aim of our study was to investigate the root-associated microbiome from Taxus using next generation sequencing to sequence 16S and 18S amplicons derived from Taxus roots. To enrich for microbial endophytes, roots were sampled fresh and their surfaces rigorously washed to remove external microflora. The isolated DNA was subjected to amplification using oligonucleotides that were designed to specifically amplify 16S (V5F-V3R) and 18S (EF4–518). Microbes were tentatively identified to OTUs using sequence homology to known species present in the NCBI database. These results must be treated with caution, as most matches were not to type strains, and therefore there is the possibility of incorrect identification.

From the 16S bacterial library, a total of 24,750 sequences were obtained with the V5F-V3R primer set. Only high quality sequences consisting of 20,538 sequences with a length distribution around 480–530 bp were used for analysis. In total, 913 OTUs were identified based on 97% sequence similarity. The majority of these OTUs were from Proteobacteria (63.24%), Acidobacteria (14.35%), Bacteroidetes (7.83%) and Actinobacteria (7.18%). Of the 21 most abundant OTUs, 15 were from Proteobacteria (Table 1). At the class level, the OTUs were mainly from Alphaproteobacteria (25.67%), Gammaproteobacteria (20.75%) and Betaproteobacteria (13.38%) (Fig 1). These 913 OTUs consisted of 158 genera. Shannon index of 16S sequences data was 7.25, Chao1 was 1918.57, and the PD_whole_tree was 51.55. In the U.S. Pat. No. 5,561,055, there is one bacterium disclosed, which was referred to as Erwinia taxi, for the production of taxol (later characterized as Sphingomonas taxi), which was isolated from Taxus canadensis. From our data, three OTUs (accounting for 0.24% of the total sequences) from the genus Sphingomonas were identified in the root of Taxus chinensis. BLASTn analysis to GenBank indicated that none of these three OTUs matched any reported species that have taxol-producing capacity.

Table 1. GenBank accession number, taxonomy, and reads number of the 21 most abundant OTUs in 16S pyrosequencing.

ID GenBank # % Identity Match Phylum Class Order Family Reads No.
TR871 JF833490 99 Uncultured Steroidobacter sp. Proteobacteria Gammaproteobacteria Xanthomonadales Sinobacteraceae 807
TR568 JF958143 99 Burkholderia sp. Proteobacteria Betaproteobacteria Burkholderiales Burkholderiaceae 764
TR621 JX424780 100 Bradyrhizobium elkanii Proteobacteria Alphaproteobacteria Rhizobiales Bradyrhizobiaceae 590
TR764 EF075691 99 Uncultured gamma proteobacterium clone Proteobacteria Gammaproteobacteria 342
TR494 AB808756 100 Streptomyces sp. Actinobacteria Actinobacteridae Actinomycetales Streptomycineae 327
TR679 CP005950 100 Rhizobium etli Proteobacteria Alphaproteobacteria Rhizobiales Rhizobiaceae 211
TR430 EF665802 98 Uncultured gamma proteobacterium clone Proteobacteria Gammaproteobacteria 204
TR087 EF075624 100 Uncultured Acidobacteria bacterium clone Acidobacteria 202
TR035 EF075887 98 uncultured alpha proteobacterium Proteobacteria Alphaproteobacteria 180
TR026 FJ570455 98 Uncultured gamma proteobacterium clone Proteobacteria Gammaproteobacteria 165
TR509 EF072247 99 uncultured Acidobacteriaceae bacterium Acidobacteria Acidobacteriales Acidobacteriaceae 162
TR658 KF150437 100 Dyella marensis Proteobacteria Gammaproteobacteria Xanthomonadales Xanthomonadaceae 153
TR045 JX545161 99 Uncultured Caulobacter sp. Proteobacteria Alphaproteobacteria Caulobacterales Caulobacteraceae 143
TR405 EF075573 99 Uncultured Sphingobacteriales bacterium clone Bacteroidetes Sphingobacteriia Sphingobacteriales 126
TR383 GU047629 99 uncultured Caulobacteraceae bacterium Proteobacteria Alphaproteobacteria Caulobacterales Caulobacteraceae 124
TR123 EU440697 99 uncultured Rhodospirillaceae bacterium Proteobacteria Alphaproteobacteria Rhodospirillales Rhodospirillaceae 110
TR647 AY673350 99 Acidobacteria bacterium Ellin7184 Acidobacteria 105
TR897 EF075729 99 uncultured Rubrivivax sp. Proteobacteria Betaproteobacteria Burkholderiales Rubrivivax 105
TR231 HQ882705 99 Duganella sp. Proteobacteria Betaproteobacteria Burkholderiales Oxalobacteraceae 104
TR315 JQ701563 97 uncultured Phyllobacteriaceae bacterium Proteobacteria Alphaproteobacteria Rhizobiales Phyllobacteriaceae 96
TR118 EF072359 97 uncultured Flavobacteriia bacterium Bacteroidetes Flavobacteriia 92

Fig 1. Bacterial diversity as a percentage associated with root endophyte of Taxus chinensis (Pilger) Rehd.—using 16s pyro-sequencing.

Fig 1

Through analysis of the sequences obtained from the 18S-derived library, we identified a total of 110,272 sequences obtained with the primer set EF4–518. A total of 34,739 reads were included for analysis after filtering for quality. The average length of these high quality reads was 363 bp. In total, 187 OTUs were defined based on the 97% sequence similarity criteria. These OTUs mainly belonged to Basidiomycota (62.624%) and Ascomycota (33.018%). From the 20 most abundant OTUs, 12 were from Basidiomycota (Table 2). At the Class level, the majority of OTUs were from Agaricomycetes (62.55%), Eurotiomycetes (16.00%) and Leotiomycetes (14.66%) (Fig 2). These 187 OTUs consisted of 69 genera. Shannon index of 18S sequences data was 3.90, chao1 was 252.62, and the PD_whole_tree was 8.41. Five genera were found to contain reported species with taxol production capacity, Aspergillus (1 OTU, 22 sequences, 0.063% of total sequences), Bionectria (1 OTU, 3 sequences, 0.009% of total sequences), Cladosporium (1 OTU, 39 sequences, 0.112% of total sequences), Alternaria (1 OTU, 100 sequences, 0.288% of total sequences) and Pestalotiopsis (1 OTU, 1 sequence, 0.003% of total sequences). Sequence similarity analysis using BLASTn against the GenBank nucleotide sequences showed that sequence of the OTU from Alternaria genus was highly similar to the fungal strain Alternaria sp. Tax-4 that possesses taxol-production capacity (Accession No. KF193057, with a 99% query cover, 99% identity, e-value = 0.0).

Table 2. GenBank accession number, taxonomy, and reads number of the 20 most abundant OTUs in 18S pyrosequencing.

ID GenBank # % Identity Match Phylum Class Order Family Reads No.
63 DQ873608 99 Hyphodontia barba-jovis isolate 2037a Basidiomycota Agaricomycetes Corticiales Corticiaceae 8188
150 DQ440644 99 Hemimycena gracilis Basidiomycota Agaricomycetes Agaricales Tricholomataceae 4374
1 EF024609 95 Uncultured Boletaceae clone Basidiomycota Agaricomycetes Boletales 4284
46 FJ358327 99 Chaetothyriales sp. TRN247 Ascomycota Eurotiomycetes Chaetothyriales 3957
142 JN938729 99 Phialocephala sp. Ascomycota Leotiomycetes Helotiales mitosporic Helotiales 3196
6 DQ898724 99 Sistotrema athelioides Basidiomycota Agaricomycetes Corticiales Corticiaceae 1987
145 DQ520103 99 Craterocolla cerasi Basidiomycota Agaricomycetes Sebacinales Sebacinaceae 1405
34 GQ330619 99 Uncultured Helotiales clone Ascomycota Leotiomycetes Helotiales 1175
70 DQ444856 99 Hydropus marginellus Basidiomycota Agaricomycetes Agaricales Tricholomataceae 618
12 JQ926736 99 Hohenbuehelia sp. Basidiomycota Agaricomycetes Agaricales Pleurotaceae 524
181 GQ404741 99 uncultured Ascomycota Ascomycota 492
175 HQ661373 99 Uncultured Scytalidium Ascomycota 475
148 JN940455 99 Macrolepiota mastoidea Basidiomycota Agaricomycetes Agaricales Agaricaceae 350
70 DQ444856 99 Hydropus marginellus Basidiomycota Agaricomycetes Agaricales Tricholomataceae 331
68 JN939906 100 Coprinellus congregatus Basidiomycota Agaricomycetes Agaricales Psathyrellaceae 299
169 JN940003 97 Polyporus cf. grammocephalus 1 KH-2011 Basidiomycota Agaricomycetes Polyporales Polyporaceae 167
36 HQ840409 99 Ilyonectria radicicola Ascomycota Sordariomycetes Hypocreales Nectriaceae 164
162 JX158869 94 uncultured Eupenicillium Ascomycota Eurotiomycetes Eurotiales Trichocomaceae 155
67 DQ440644 99 Hemimycena gracilis Basidiomycota Agaricomycetes Agaricales Trichocomaceae 135
176 FJ358327 100 Chaetothyriales sp. Ascomycota Eurotiomycetes Chaetothyriales 135

Fig 2. Fungal diversity as a percentage associated with root endophyte of Taxus chinensis (Pilger) Rehd.—using 18s pyro-sequencing.

Fig 2

The microbiome colonizing the root surface and the endophytic compartment (within the root) contribute to plant growth, productivity, carbon sequestration and secondary metabolite biosynthesis [6–8]. The high throughput next generation sequencing technologies together with the bioinformatic pipelines have enabled the description of culture-independent microflora associated with numerous environmental and human microbiomes and to reveal meta-genomic composition. For example, sequencing of the bacterial 16S ribosomal RNA gene showed different bacterial communities are strongly influenced by soil type, and some bacteria vary quantitatively between plants of different developmental stage and genotype [24]. The root-associated microbiome from fresh roots of T. chinensis appear to be associated with a broad spectrum of endophytic microbial taxa, and phylotypes representing a number of phyla. Some taxa that were ubiquitous across Taxus plants, such as Aspergillus and Hypocrea, have also been observed in previous studies focusing on microbial diversity of Taxus [6]. Our study revealed a higher species richness and diversity than previous studies (e.g., 29 fungal isolates in Xiong et al. 2013 [17]). Diversity of endophytic fungi of Taxus spp. have been explored by isolating culturable fungi on PDA (Potato dextrose agar) and SMA (Sabouraud Maltose Agar) culture medium [6,17]. A number of fungi have been reported as endophytes in different Taxus species. Caruso et al. (2000) isolated and identified 25 different genera in T. baccata [26]. Wang et al. (2008) found 5 genera and 3 unidentified fungi in T. mairei [27]. Liu et al. (2009) reported 26 genera in T. chinensis [28]. Rivera-Orduña et al. (2011) found 29 fungal isolates in 24 genera in T. globosa (Mexican yew) [6]. Xiong et al. (2013) found 29 fungal isolates in 8 genera in T. media [17]. However, non-culturable endophytic isolates cannot be found using these conventional methods. To overcome this problem, in this study we used high-throughput sequencing technology on libraries derived from 16S and 18S amplicons from freshly isolated DNA samples, and found it more powerful and more efficient than traditional morphological identification and Sanger sequencing in characterizing community structure. Our high-throughput amplicon sequencing revealed 187 fungal OTUs which is higher than any previously reported fungal number identified with the culture-dependent method [6,17,26,27,28], suggesting that T. chinensis roots harbor novel and diverse fungi.

It should be noted that most fungi reported as endophytes in Taxus have been identified as ascomycetes and their anamorphs. Basidiomycetous endophytes have only been reported in limited number of studies. For example, the fungal isolates belonged to Ascomycota (77.2%) and Basidiomycota (22.8%) in Rivera-Orduña et al. (2011) study [6]. All the fungal isolates belonged to Ascomycota (100%) in Xiong et al. (2013) [17]. Our results show that the majority of the fungal OTUs belonged to Basidiomycota (62.624%). Previous studies have also showed Penicillium and Hopoxylon [6], Colletotrichum and Glomerella [17] are dominant genera. However, these 4 genera were not detected in our study. We found Hyphodontia (24.713%), Hemimycena (12.994%), Phialocephala (9.243%) are the three dominant genera, and to our knowledge, this is the first time these three genera were reported in any Taxus sp. The difference between our results and Rivera-Orduña et al (2011) [6] or Xiong et al (2013) [17] may be due to tissue specificity, as we used fresh root as biological samples in this study, while bark, branches, leaves and roots were used in Rivera-Orduña et al (2011) [6] and bark pieces and leaves were used in Xiong et al. (2013) [17].

Plants are hosts of a variety of microbes including fungi and bacteria. Bacteria possess a higher rate of metabolism than fungi. It was expected that larger quantities of taxol could be extracted in shorter periods from bacteria. However, only one bacterium, Erwinia taxi has been reported to possess the capacity to synthesize taxol [29]. It would be highly desirable to find other bacteria having highly metabolic capacities isolated from different species of Taxus for the production of taxol and related taxanes. In addition, some strains (e.g. Moraxella sp., Bacillus macerans, Bacillus circulans, and Micrococcus sp.) had been reported to be able to remove the xylosyl group from 7-xylosyltaxanes, an important step in taxol semi-synthesis [30].

Using clone libraries, Gammaproteobacteria, Betaproteobacteria, and Actinobacteria were found to be more abundant in the rhizosphere of T. media from the temperate region, and Acidobacteria was more abundant in the subtropical Taxus mairei rhizosphere [31]. In our study, Actinobacteria and Acidobacteria were also abundant phyla, with Proteobacteria being the most abundant phylum. Proteobacteria is widespread in natural ecosystems of plant species. For various pine forest soils in British Columbia, Proteobacteria contributed to about 50% of the total clone library [32]. Filion et al. (2004) determined that the majority of 16S rRNA gene clones obtained from the rhizosphere of healthy spruce seedlings grouped with the Proteobacteria (27%) [33]. Our study is the first report of Proteobacteria being dominant in the root of T. chinensis.

Metagenomic analysis that consisted of sequencing a DNA library derived from the T. chinensis root DNA showed that Alphaproteobacteria, Gammaproteobacteria and Bacilli were the most dominant bacterial phyla, and Saccharomycetes, Glomeromycetes and Sordariomycetes were the dominant fungi (Fig 3). Five bacterial genera (Erwinia, Curtobacterium, Pantoea, Bacillus and Sphingomonas) were reported to have species with taxol-production capacity, accounting for 14.9% of total contigs (S3 Table). Thirty-six fungal genera were found to have reported species with taxol-production capacity (S4 Table). Five species with known taxol-production capacity (Colletotrichum gloeosporioides, Guignardia mangiferae, Fusarium solani, Aspergillus flavus, Pestalotiopsis microspora) were identified by our metagenomic sequencing work (Fig 3).

Fig 3. Bacterial and fungal diversity as a percentage associated with root endophyte of Taxus chinensis (Pilger) Rehd—using meta-genome sequencing.

Fig 3

a: bacterial; b: fungal.

In our metagenomic analysis, we obtained 20,267.65 MB bp (around 20 G) data. Sequences from host plant were filtered using SOAPaligner (Version 2.21, http://soap.genomics.org.cn/soapaligner.html) with a match requirement of 95% sequence identity to the transcriptome sequences of Taxus chinensis and we got 323.5 Mbp clean data. Therefore, the percentage of microbes DNA in our metagenomic library is 1.6% and the percentage of DNA contamination of plant genes is 98.4%. IDBA_UD assembly identified 386,581 genes using metagenomic analysis. There were 634 genes (S5 Table) similar to those known to participate in taxol synthesis in Taxus, with protein sequence identities ranging from 24.11% to 98.8% (S5 Table). Similar sequence identities have been reported from other taxol-producing fungi [17]. Notably, one gene (gene_TR2_205230) was found to be similar to the gene for taxadiene synthase (TS) in Taxus mairei (accession No. ABW82998.1), with max score = 112, total score = 112, query cover = 81%, E-value = 4e-27, identity = 47.37%), which might be a key and rate limiting gene for the biosynthesis of taxol in Taxus root endophytic microbes.

Metagenomic analysis of the 16S and 18S sequences aided in identification of different microbial compositions (Figs 1, 2, and 3). 16S rDNA sequencing detected 10 unambiguous classes of endophytic microbes, and identified Alphaproteobacteria, Gammaproteobacteria and Betaproteobacteria as the 3 most abundant classes (Fig 1). 18S rDNA pyrosequencing detected 6 unambiguous classes of endophytic microbes, and showed Agaricomycetes, Eurotiomycetes and Leotiomycetes to be the three most abundant classes (Fig 2). However, metagenomic analysis detected 14 bacterial classes and 19 fungal classes respectively representing different dominant classes (Fig 3). This may be partially due to a deeper sequencing and our metagenomic analysis, as we obtained 20G data which is larger than 16s and 18S rDNA pyrosequencing. This would be expected, since the library preparation for the two analyzes are very different (16S and 18S analyses enriching microbial sequences due to primer specificities). These 16S and 18S metagenomics methodologies may enrich for different sequences (species), suggesting that different methodologies should be used to achieve comprehensive microbiome surveys.

In the yew tree, taxol biosynthesis involves 19 enzymatic steps from the universal diterpenoid precursor geranylgeranyl diphosphate (GGPP) produced by the plastidial methyl erythritol phosphate pathway [34]. Several reports have suggested that endophytic fungi contain genes encoding the pathway enzymes previously identified in Taxus spp. [18–21, 35, 36]. The reported presence of previously identified taxol genes of Taxus spp. in endophytic fungi were based on the results of PCR experiments using primers designed according to the published sequences of taxol biosynthetic genes from Taxus trees. The sequences they provided indicated that the fungal amplicons were virtually identical to the Taxus clones [19,20] and this lead to speculation that horizontal gene transfer occurred between microbes and Taxus plant [19,20]. However, recently it was shown that taxol biosynthesis was possible for P. aurantiogriseum NRRL 62431 and that putative taxol biosynthetic genes identified by whole genome sequencing were quite different from those in hosts C. avellana and T. baccata in terms of amino acid sequences, and may evolved independently [23]. Our metagenomic analysis showed one gene shared 47.37% identity with cDNA of TS from Taxus mairei (accession no. ABE82998.1) (Max score = 112, query cover = 81%, E-value = 4e-27). This result is consistent with Xiong et al. (2013) that the TS gene from the fungi shares low similarity with that from Taxus plant [17] and the genome sequencing of P. aurantiogriseum NRRL 62431 [23]. Therefore, it is likely that many of the highly similar taxol biosynthetic genes identified in the past few years from microbes are due to contamination from plant DNA during endophyte preparations.

Studies have shown that microbes can interact with each other or with host plants to affect taxol production [37, 38]. Addition of endophytic fungi (Fusarium mairei) culture broth (EFCB) in cell suspension cultures of Taxus cuspidata resulted in a greater than 2 fold yield than that in cultures of plant cell or endophytic fungi alone [38]. Taxol-producing endophytes may change the transcription of plant taxol biosynthetic genes and thus influence taxol content of intact Taxus plants and/or tissues [39] Resident fungi within a host plant could interact with one another to stimulate taxol biosynthesis, either directly or through their metabolites. Co-culture of SSM001 (an endophyte that was proposed to produce taxol), with a bark fungus (Alternaria or Phomopsis) caused a 3 to 8 fold increase in taxol production [40].Our survey of the endophytic community composition on T. chinesensis provides a starting point for analyzing interactions between endophytes, and also the interaction between endophytes and their host plant. Considering that many endophytes are pathogens or symbiont of host plants, our baseline survey of root endophytic microbes of Taxus plant can be helpful for disease control, cultivation management and taxol production by Taxus plants. Given the importance of the root-associated microbiome and the current lack of information about these communities, metagenetic analyses such as the one we described here may be warranted for other agronomically important plant species.

Conclusions

Taxol is currently commercially obtained from a number of routes including; plantation yew trees, semisynthetic synthesis from an intermediates such as baccatin III or 10-deacetyllbaccatin III found in renewable needles of Taxus, or plant cell cultures [41]. Despite early optimism, taxane synthesis from endophytic taxol-producing microbes has not been economical due to low and variable yields. Our study begins a large-scale identification of candidate genes involved taxol biosynthesis in the root endophytes of Taxus using a metagenomics approach. Surveying varied microbiome from Taxus spp with culture independent techniques may provide a way to improve the metabolic engineering of taxol biosynthesis in culturable microbes by identifying superior taxol biosynthesis genes that could be inserted into non-taxol synthesizing hosts. Alternatively it may be possible to inoculate Taxus species with unculturable taxol synthesizing microbes to enhance taxol yields from these trees, or select for more culture amenable variants from normally unculturable taxol synthesizing species.

Our study has revealed a rich diversity of mictobes in the Taxus root endophytic microbiome with some OTUs identified identical to reported microbe strains possessing taxol-synthesis abilities. Metagenomics analysis confirmed that the taxol biosynthetic pathway may differ between these microbes and Taxus, indicating that taxol biosynthesis in Taxus root endophytes may have evolved independently. Our findings can shed new light on biodiversity of endophytes in Taxus root and how taxol-producing endophytes synthesize taxol, and will facilitate metabolic engineering for the industrial production of taxol from microbes.

Methods

Root sampling and DNA extraction

Plant roots were carried out on private land with the permission granted by Mr. Mingyun Yin. One 5-year—old live plants of Taxus chinensis (Pilger) Rehd. was collected in June 2013 from Fengxin County (114°45`E, 28°34`N) in Jiangxi province of China. The taxol-producing capability of this plant was comfired by LC-MS method. The annual average temperature is 17.3°C, and annual rainfall is 1612 mm in the site. To study the root-associated microbiome, fresh roots of Taxus chinensis (Pilger) Rehd. were harvested, sealed in plastic bags placed in a car refrigerator, immediately transported to the laboratory, washed with tap water, and then rinsed three times with sterile distilled water to remove external root microbiome. To remove fungal spores or hyphae (e.g. arbuscular mycorrhizal funi) on the root surface, roots were sonicated at low frequency for 3 min (30-s bursts followed by 30-s rests performed three times). Genomic DNA was then extracted from fine fresh roots (0.2 g) with Fungal DNAout Kit (TIANDZ, Beijing, China). The extracted DNA was dissolved in 50 μL TE buffer, quantified by spectrophotometry and stored at -20°C for further use.

16S and 18S rRNA gene amplicon preparation

Primer set V5F (forward: TCACGTACTA+CCGTCAATTCMTTTGAGTTT—V3R (reverse: ACTCCTACGGGAGGCAGCAG) and EF4 (forward: GGAAGGGG/AT GTATTTATTAG)− 518 (reverse: ATTACCGCGGCTGCTGG) were used to amplify 16S and 18S rRNA gene fragments respectively. Primer set V5F-V3R amplified the variable V3-V5 region of all bacteria. Primer set EF4-518 targeted 18S rDNA of all fungi. To perform 454 pyrosequencing, DNA primer sequences first adapted with 454 Life Science A or B sequencing adapters (19 bp), then fused with 8-bp barcoded primers: Primer B (GCCTTGCCAGCCCGCTCAG) + barcode + forward primer and Primer A (GCCTCCCTCGCGCCATCAG) + reversed primer. PCR was performed in 50-μL reaction mixtures containing 1.25 mM deoxynucleoside triphosphate, 2μL (15μM) primers, 2U Taq DNA polymerase (TaKaRa, Japan), and 50 ng (1:l) genomic DNA as template. PCR procedures were as follows: 35 cycles (95°C for 45 s, 58°C for 45 s, and 72°C for 1 min) with a final extension at 72°C for 7 min. PCR reaction mixtures were purified using QIAquick PCR Purification kit (QIAGEN), and quantified using a NanoDrop ND-1000 photometer (Thermo Scientific, USA).

Metagenome library preparation

DNA library preparation followed the manufacturer’s instruction (paired-end sample preparation guide, Illumina). The base-calling pipeline (version Illumina Pipeline-0.3) was used to process the raw fluorescent images and call sequences.

Pyrosequencing platform

16S and 18s amplicons were sequenced on the Roche 454 GS Titanium FLX platform and WGS DNA was sequenced on Illumina platform according to the manufacturer’s specifications.

Processing of 16S pyrosequencing data

Sequences were trimmed for those below quality score of 25 and 200 bp in length using Quantitative Insights Into Microbial Ecology (QIIME) pipeline (http://qiime.org/scripts/split_libraries.html). The remaining sequences were assigned to samples based on unique 8-bp barcodes. Sequences were binned into Operational Taxonomic Units (OTUs) with 97% identity threshold. Each representative sequence was assigned a taxonomy using the RDP classifier [42] trained on the 4 February 2011 Greengenes reference sequences. Once OTUs were assigned taxonomy, all OTUs annotated as chloroplasts, Viridiplantae or Archaea were removed from the OTU table, resulting in the set of usable OTUs. Representative sequences of the most 20 abundant OTUs were then searched for the best BLAST hit on NCBI. A series of subsets of each library in different sizes (10, 110, 210, 310 with a step of 100) with 10 replicates were used to calculate diversity and richness indices. Representative sequence that was assigned to previously reported genus with taxol-production capacity species (S1 Table) was blasted in GenBank for further species level taxonomy identification.

Processing of 18S pyrosequencing data

For 18S data, sequences were trimmed and binned into OTUs similar to that of 16S data. Each representative sequence was assigned to taxonomy against a subset of Silva 104 database (http://www.arb-silva.de/download/archive/qiime/). The OTUs defined at 97% similarity were used to perform rarefaction analysis and to calculate the richness and diversity indices. Representative sequences of the most 20 abundant OTUs were then searched for the best BLAST hit on NCBI. Representative sequence that was assigned to previously reported genus with taxol-production capacity species (S1 Table) was blasted in GenBank for further species level taxonomy identification. The pyrosequencing reads have been deposited at GenBank with accession number SRP040943.

Metagenomic analysis

Sequences from host plant were filtered using SOAPaligner (Version 2.21, http://soap.genomics.org.cn/soapaligner.html) with a match requirement of 95% sequence identity. Reads were assembled by IDBA_UD (http://i.cs.hku.hk/~alse/hkubrg/projects/idba_ud/index.html) with k value between 31 and 61 with a step of 10. Gene taxonomic assignments were made on the basis of BLASTP search (e-value < 10−5) of the NCBI-NR database. Gene functional annotations were made by BLASTP [43] search (E-value < 10−5) with eggNOG and KEGG (v48.2) databases.

Availability of supporting data

The pyrosequencing reads have been deposited were deposited in GenBank (NCBI) under the accession numbers SRP040943.

Supporting Information

S1 Table. List of reported microbes with taxol production capability.

(DOCX)

S2 Table. List of the 13 reported taxol biosynthetic enzymes in Taxus sp.

(DOC)

S3 Table. List of bacterial genus and reads number in meta-genome sequencing.

(XLS)

S4 Table. List of fungal genus and reads number in meta-genome sequencing.

(XLS)

S5 Table. List of gene annotation with IDBA_UD assembly.

(XLSX)

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This work was supported by a grant for National non-profit Research Institutions of Chinese Academy of Forestry (CAFYBB2012042), NSFC grant 31300105 and a grant for the cooperation between Zhejiang Forrestry Academy and Chinese Academy of Forestry (2013SY17). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Suffness M, Wall ME. Discovery and development of taxol In: Suffness M (ed) Taxol science and applications. CRC Press, Boca Raton: 1995. pp 3–25 [Google Scholar]
  • 2. Arbuck SG, Blaylock BA. Taxol: clinical results and current issues in development In: Suffness M (ed), Taxol: Science and Applications. CRC Press, Boca Raton, Florida: 1995. pp. 379–415. [Google Scholar]
  • 3.Wall ME, Wani MC. Paclitaxel: from discovery to clinic. In: Georg GI, Chen TT, Ojima I, Vyas DM (eds), Taxane Anticancer Agents: Basic Science and Current Status ACS Symposium Series, 583. 1995. pp. 18–30.
  • 4. Strobel GA, Hess WM, Ford E, Sidhu RS, Yang X. Taxol from fungal endophytes and the issue of biodiversity. J Ind Microbiol 1996;17: 417–423. [Google Scholar]
  • 5. Stierle A, Strobel G, Stierle D. Taxol and taxane production by Taxomyces andreanae, an endophytic fungus of Pacific yew. Science. 1993; 260: 214–216. [DOI] [PubMed] [Google Scholar]
  • 6. Rivera-Orduña FN, Suarez-Sanchez RA, Flores-Bustamante ZR, Gracida-Rodriguez JN, Flores-Cotera LB. Diversity of endophytic fungi of Taxus globosa (Mexican yew). Fungal Divers. 2011; 47: 65–74. [Google Scholar]
  • 7. Kumar DDS, Hyde KD. Biodiversity and tissue-recurrence of endophytic fungi in Tripterygium wilfordii . Fungal Divers. 2004; 7:69–90. [Google Scholar]
  • 8. Huang WY, Cai YZ, Surveswaran S, Hyde KD, Corke H, Sun M. Molecular phylogenetic identification of endophytic fungi isolated from three Artemisia species. Fungal Divers. 2009; 36:69–88. [Google Scholar]
  • 9. Lin X, Huang YJ, Zheng ZH, Su WJ, Qian XM, Shen YM. Endophytes from the pharmaceutical plant, Annona squamosa: isolation, bioactivity, identification and diversity of its polyketide synthase gene. Fungal Divers. 2010; 41:41–51. [Google Scholar]
  • 10. Kang JC, Jin R, Wen T, He J, Lei BX. Recent research advances on endophytic fungi producing taxol. Mycosystema 2011; 30: 168–179. [Google Scholar]
  • 11. Lou J, Niu XL, Yan F, Pan J, Zhu XD. Recent progresses in the studies of taxol and taxane-producing fungi. Mycosystema 2011; 30: 158–167. [Google Scholar]
  • 12. Flores-Bustamante ZR, Rivera-Orduna FN, Martinez-Cardenas A, Flores-Cotera LB. Microbial paclitaxel: advances and perspectives. J Antibiot. 2010; 63:460–467. 10.1038/ja.2010.83 [DOI] [PubMed] [Google Scholar]
  • 13. Ajikumar PK, Xiao WH, Tyo KE, Wang Y, Simeon F, Leonard E, Mucha O, Phon TH, Pfeifer B, Stephanopoulos G. Isoprenoid pathway optimization for Taxol precursor overproduction in Escherichia coli . Science 2010; 330:70–74. 10.1126/science.1191652 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Zhao K, Ping WX, Zhang LN, Liu J, Lin Y, Jin T,et al. Screening and breeding of high taxol producing fungi by genome shuffling. Sci China Ser C: Life Sci. 2008; 51:222–231. [DOI] [PubMed] [Google Scholar]
  • 15. Wang Y, Guo B, Miao Z, Tang K. Transformation of taxol-producing endophytic fungi by restriction enzyme-mediated integration (REMI). FEMS Microbiol Lett. 2007; 273:253–259. [DOI] [PubMed] [Google Scholar]
  • 16. Li JY, Sidhu RS, Bollon A, Strobel GA. Stimulation of taxol production in liquid cultures of Pestalotiopsis microspora . Mycol Res. 1998; 102:461–464. [Google Scholar]
  • 17. Xiong ZQ, Yang YY, Zhao N, Wang Y. Diversity of endophytic fungi and screening of fungal paclitaxel producer from Anglojap yew, Taxus x media . BMC Microbiol. 2013; 13:71 10.1186/1471-2180-13-71 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Zhang P, Zhou PP, Jiang C, Yu H, Yu LJ. Screening of taxol-producing fungi based on PCR amplification from Taxus . Biotechnol Lett. 2008; 30:2119–2123. 10.1007/s10529-008-9801-7 [DOI] [PubMed] [Google Scholar]
  • 19. Staniek A, Woerdenbag HJ, Kayser O. Taxomyces andreanae: a presumed paclitaxel producer demystified? Plant Med. 2009; 75:1–6. [DOI] [PubMed] [Google Scholar]
  • 20. Miao Z, Wang Y, Yu X, Guo B, Tang K. A new endophytic taxane producing fungus from Taxus chinensis . Appl Biochem Micobiol. 2009; 45:81–86. [PubMed] [Google Scholar]
  • 21. Kumaran RS, Kim HJ, Hur BK. Taxol promising fungal endophyte, Pestalotiopsis species isolated from Taxus cuspidata . J Biosci Bioeng. 2010; 110:541–546. 10.1016/j.jbiosc.2010.06.007 [DOI] [PubMed] [Google Scholar]
  • 22. Zhou X, Wang Z, Jiang K, Wei Y, Lin J, Sun X, et al. Screening of taxol-producing endophytic fungi from Taxus chinensis var. mairei . Appl Biochem Microbiol. 2007; 43:439–443. [PubMed] [Google Scholar]
  • 23. Yang YF, Zhao HN, Barrero RA, Zhang BH, Sun GL, Wilson IW, et al. Genome sequencing and analysis of the paclitaxel-producing endophytic fungus Penicillium aurantiogriseum NRRL 62431. BMC Genomics 2014; 15:69 10.1186/1471-2164-15-69 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Lundberg DS, Lebeis SL, Paredes SH, Yourstone S, Gehring J, Malfatti S, et al. Defining the core Arabidopsis thaliana root microbiome. Nature 2012; 488:86–90. 10.1038/nature11237 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Bulgarelli D, Rott M, Schlaeppi K, Ver Loren van Themaat E, Ahmadinejad N, Assenza F, et al. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature 2012; 488(7409):91–95. 10.1038/nature11336 [DOI] [PubMed] [Google Scholar]
  • 26. Caruso M, Colombo AL, Fedeli L, Pavesi A, Quaroni S, Saracchi M, et al. Isolation of endophytic fungi and actinomycetes. Ann Microbiol. 2000; 50(1): 3–13. [Google Scholar]
  • 27. Wang YT, Lo HS, Wang PH. Endophytic fungi from Taxus mairei in Taiwan: first report of Colletotrichum gloeosporioides as an endophyte of Taxus mairei . Bot Stud. 2008; 49: 39–43. [Google Scholar]
  • 28. Liu K, Ding X, Deng B, Chen W. Isolation and characterization of endophytic taxol-producing fungi from Taxus chinensis . J Ind Microbiol Biotechnol. 2009; 36:1171–1177. 10.1007/s10295-009-0598-8 [DOI] [PubMed] [Google Scholar]
  • 29.Page M, Landry N. Bacterial mass production of taxanes with Erwinia. US Patent 5561055, 1996.
  • 30. Hanson RL, Howell JM, Brzozowski DB, Sullivan SA, Patel RN, Szarka LJ. Enzymatic hydrolysis of 7-xylosyltaxanes by xylosidase from Moraxella sp. Biotechnol Appl Biochem. 1997; 26:153–158. [Google Scholar]
  • 31. Hao DC, Ge GB, Yang L. Bacterial diversity of Taxus rhizosphere: culture-independent and culture-dependent approaches. FEMS Microbiol Lett. 2008; 284:204–212. 10.1111/j.1574-6968.2008.01201.x [DOI] [PubMed] [Google Scholar]
  • 32. Axelrood PE, Chow ML, Radomski CC, McDermott JM, Davies J. Molecular characterization of bacterial diversity from British Columbia forest soils subjected to disturbance. Can J Microbiol. 2002; 8(7):655–674. [DOI] [PubMed] [Google Scholar]
  • 33. Filion M, Hamelin RC, Bernier L, St-Arnaud M. Molecular profiling of rhizosphere microbial communities associated with healthy and diseased black spruce (Picea mariana) seedlings grown in a nursery. Appl Environ Microbiol. 2004; 70(6):3541–3551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Croteau R, Ketchum RE, Long RM, Kaspera R, Wildung MR. Taxol biosynthesis and molecular genetics. Phytochem Rev. 2006; 5:75–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Zhang P, Zhou P-P, Yu L-J. An endophytic taxol-producing fungus from Taxus media, Cladosporium cladosporioides MD2. Curr Microbiol. 2009; 59:227–232. 10.1007/s00284-008-9270-1 [DOI] [PubMed] [Google Scholar]
  • 36. Zhang P, Zhou P-P, Yu L-J. An endophytic taxol-producing fungus from Taxus x media, Aspergillus candidus MD3. FEMS Microbiol Lett. 2009; 293:155–159. 10.1111/j.1574-6968.2009.01481.x [DOI] [PubMed] [Google Scholar]
  • 37. Mirjalili MH, Farzaneh M, Bonfill M, Rezadoost H, Ghassempour A. Isolation and characterization of Stemphylium sedicola SBU-16 as a new endophytic taxol-producing fungus from Taxus baccata grown in Iran. FEMS Microbiol Lett. 2012; 328:122–129. 10.1111/j.1574-6968.2011.02488.x [DOI] [PubMed] [Google Scholar]
  • 38. Li YC, Tao WY. Interactions of taxol-producing endophytic fungus with its host (Taxus spp.) during taxol accumulation. Cell Biol Int. 2009; 33:106–112. 10.1016/j.cellbi.2008.10.007 [DOI] [PubMed] [Google Scholar]
  • 39. Soliman SS, Trobacher CP, Tsao R, Greenwood JS, Raizada MN. A fungal endophyte induces transcription of genes encoding a redundant fungicide pathway in its host plant. BMC Plant Biol. 2013; 13:93 10.1186/1471-2229-13-93 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Soliman SSM, Raizada MN. Interactions between co-habitating fungi elicit synthesis of taxol from an endophytic fungus in host Taxus plants. Front Microbio. 2013; 4:3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Malik S, Cusidó RM, Mirjalili MH, Moyano E, Palazón J, Bonfill M. Production of the anticancer drug taxol in Taxus baccata suspension cultures: A review.Process Bioche 2011;46:23–34. [Google Scholar]
  • 42. Sul WJ, Cole JR, Jesus EDC, Wang Q, Farris RJ, Fish A, et al. Bacterial community comparisons by taxonomy-supervised analysis independent of sequence alignment and clustering. Proc Natl Acad Sci USA. 2011; 108: 14637–14642. 10.1073/pnas.1111435108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997; 25(17):3389–3402. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. List of reported microbes with taxol production capability.

(DOCX)

S2 Table. List of the 13 reported taxol biosynthetic enzymes in Taxus sp.

(DOC)

S3 Table. List of bacterial genus and reads number in meta-genome sequencing.

(XLS)

S4 Table. List of fungal genus and reads number in meta-genome sequencing.

(XLS)

S5 Table. List of gene annotation with IDBA_UD assembly.

(XLSX)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

The pyrosequencing reads have been deposited were deposited in GenBank (NCBI) under the accession numbers SRP040943.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES