Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Mar 31.
Published in final edited form as: J Biomol Screen. 2012 Apr 4;17(6):785–795. doi: 10.1177/1087057112440880

High-Content Analysis of Pro-Apoptotic EphA4 Dependence Receptor Functions using Small Molecule Libraries

Claudiu M Nelersa 1,3, Henry Barreras 1,3, Erik Runko 1,3, Jerome Ricard 1, Yan Shi 1, John L Bixby 1,2, Vance P Lemmon 1, Daniel J Liebl 1
PMCID: PMC4380140  NIHMSID: NIHMS673134  PMID: 22492230

Abstract

Small molecule compounds (SMCs) can provide an inexpensive and selective approach to modifying biological responses. High-content analysis (HCA) of SMC libraries can help identify candidate molecules that inhibit or activate cellular responses. In particular, regulation of cell death has important implications for many pathological conditions. Dependence receptors are a new classification of pro-apoptotic membrane receptors that, unlike classic death receptors, initiate apoptotic signals in the absence of their ligands. EphA4 has recently been identified as a dependence receptor that may have important functions in conditions as disparate as cancer biology and CNS injury and disease. To screen potential candidate SMCs that inhibit or activate EphA4-induced cell death, HCA of a SMC library was performed using stable EphA4-expressing NIH3T3 cells. Our results describe a high-content method for screening dependence receptor-signaling pathways, and demonstrate that several candidate SMCs can inhibit EphA4-mediated cell death.

Keywords: Ephrins, Eph receptors, Dependence Receptor, Apoptosis, High-Content Screen

Introduction

An improved understanding of cellular responses is critical for developing successful therapeutic strategies for human clinical trials. Several therapeutic strategies target cell death, including neuroprotective anti-apoptotic approaches following traumatic CNS injury1 and pro-apoptotic mechanisms in neoplasia.2 Apoptotic cell death has been shown to result from a variety of stimuli, such as absence of survival factors (deprivation response)3,4 or ligand-receptor induced apoptosis (instructive response).5 Members of the tumor necrosis factor receptor (TNFR) gene superfamily, such as TNFR1, Fas, and DR4/5, are well-described in their ability to initiate caspase-dependent cell death following ligand activation.6 Recently, a novel mechanism of apoptotic cell death was described for a family of receptors, termed dependence receptors, in which caspase-mediated cell death is initiated in the absence of ligand activation.7 Alternatively, when dependence receptors are bound to their ligand they transduce ‘positive’ signals that elicit biological processes such as survival, differentiation, and/or migratory responses. The netrin receptors, DCC and Unc5H1-3,8,9 p75NTR,10 the androgen receptor,11 Patched,12 αVβ3 integrin, APP,7 MET,13 TrkC14 and Neogenin/RGM15 have all been shown to have dependence receptor functions. Furthermore, we recently showed that the EphA4 receptor, which functions to regulate neuronal progenitor numbers during adult neurogenesis, is a new member of the dependence receptor family. In the absence of its ligand ephrinB3, EphA4 undergoes intracellular cleavage and activates caspase-dependent cell death, which can be blocked by restoring the ligand.16

In cancer biology, dependence receptors are recognized as potential tumor suppressors,17 and Eph receptors have been shown to regulate cancer cell death.18 In these cells, activation of dependence receptor signals would be a potential target for reducing growth. Conversely, following disease or injury, cell loss is deleterious to recovery, and blocking dependence receptor signals might promote recovery.19 This is most evident in CNS injury, after which neurons and glia are highly susceptible to cell death that is both acute and progressive. Unfortunately, few agents have been identified to adequately block cell death following CNS injury; therefore, we sought to identify new compounds that might inhibit dependence receptor-mediated cell death. Targeted therapies typically employ one of three strategies: the use of function blocking monoclonal antibodies (mAbs), anti-sense oligonucleotides (AONs), or small molecule compounds (SMCs). We chose to test SMCs because they have therapeutic advantages over mAbs and AONs, such as increased stability, potential for oral delivery, moderate cost, and available for many defined targets. In particular, many SMCs are efficient at crossing the blood-brain barrier and plasma membranes, and have been previously developed to target multiple cellular processes such as growth factor/receptor responses, signal transduction pathways, cell cycle control, and cell death. Here we describe a simplified cellular modeling system that uses high-content analysis (HCA) of 3T3 cells expressing EphA4 to assess the ability of SMCs to modulate EphA4-mediated cell death signals. In addition, we have developed a reliable EphA4 ligand (i.e. the ectodomain of ephrinB3 protein) as a way to block EphA4-mediated cell death, which was used as a control to compare with SMC candidates.

Materials and Methods

Establishment of EphA4-V5 and V5 NIH 3T3 stable cell lines

Stable cell lines expressing EphA4-V5 (EphA4-3T3) or V5 alone (Vector-3T3) were generated by subcloning the murine EphA4 into pcDNA3.1-V5 vector (Life Technologies). This construct, which encodes the full-length mouse EphA4 receptor with a C-terminal V5 epitope, was described elsewhere.16 The construct was transfected into NIH 3T3 cells using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s instructions. Clonal cell lines were derived from a non-clonal cell population using single-cell dilution cloning, and cultured in DMEM/F12 medium (Life Technologies), supplemented with 10% FBS (Hyclone), 100 units/ml penicillin, 100 μg/ml streptomycin (Penicillin-Streptomycin, Life Technologies), and 800 μg/ml G418 (Geneticin®, Life Technologies) for selection. Immunostaining against the V5 epitope was employed to demonstrate effectiveness of transfection, and cells were routinely cultured in 100-mm culture plates at 37°C and 5% CO2 at subconfluency. Cells were harvested every 2–3 days following 0.05% w/v Trypsin (Life Technologies) treatment and reseeded at a density of 1,000,000 cells/dish (100-mm plate) in DMEM/F12 medium containing G418.

Protein Preparation and Immunoblotting

Crude membrane/cytosolic preparations were extracted from stable cell lines. At 80% confluency, vector-3T3 or EphA4-3T3 cells were stimulated with either ephrinB1 or ephrinB3 aggregates at 1 μg/ml concentration for 1 hr. The cells were then rinsed with PBS and were scraped off in the presence of 1X TENN buffer (50 mm Tris pH7.4, 5 mM EDTA, 150 mM NaCl) containing 1% Triton X-100 and a cocktail of protease (Complete®, Roche) and phosphatase (1 mM sodium orthovanadate, 2 mM sodium pyrophosphate) inhibitors. The cells were homogenized 50 times with a glass Dounce homogenizer (Wheaton) and then sonicated (5 Watts [RMS] for 5 seconds on a Misonix Microson ultrasonic cell disruptor) to disrupt cell membrane integrity. The homogenate was centrifuged at 12,000 rpm for 15 min at 4°C to pellet cytoskeletal components. The supernatant was transferred to a new tube and the protein concentration was quantified using the Lowry protein assay (BioRad) against a BSA standard curve. 10 μg of proteins were incubated with 0.1 μg of antibody (anti-V5 from Life Technologies, # R960-25 or anti-EphA4 from Santa Cruz # sc-921) in a 500 μl volume of TENN buffer and tubes were rotated overnight at 4°C. Then 25 μl of Protein G Plus-Agarose beads (Calbiochem) were added to each tube for a period of at least 3 hrs at 4°C. The beads were spun down at 12,000 rpm for 1 min, the supernatant removed, and the pellet was washed twice in 500 μl PBS followed by 2 washes in 500 μl PBST (PBS with 1% Triton X-100). The Protein-Antibody-Bead complexes were dissociated by boiling for 5 min in 25 μl sample loading buffer and the proteins were then loaded onto a 7.5% polyacrylamide gel. After electrophoresis, the proteins were transferred to a nitrocellulose membrane, which was blocked in 5% non-fat milk/TBST or BSA solution and probed with the primary antibodies (anti-V5, anti-EphA4, and anti-phosphotyrosine from BD Biosciences # 61000). After several TBST washes, the membranes were probed with the appropriate HRP-conjugated secondary antibodies (eBioscience # 18-8816-33 anti-rabbit, 18-8814-33 anti-goat, 18-8817-33 anti-mouse), washed several times in TBST and the proteins were visualized on X-ray film (MidSci blue autoradiography film) using enhanced chemiluminescence detection (SuperSignal West Pico solution, ThermoScientific).

Immunostaining

EphA4-3T3 cells were plated at 5 X 103 cells/well on 13 mm round coverslips in 24-well plates (Falcon) on round coverslips and they were incubated at 37° C and 5% CO2 for 24 hrs in DMEM/F12 supplemented with 10% FBS. After this period, they were further incubated for another 24 hrs in DMEM/F12 and 10% FBS in the presence or absence of 1 μg/ml preclustered ephrinB3-Fc (R&D Systems, Inc. # 395-EB-200) or ectodomain (ed)-ephrinB3. Cells were then fixed in 4% paraformaldehyde (PFA) for 10 min at RT, washed twice with PBS, and then permeabilized with 0.4% Triton-X100 for 10 min. The wells were blocked with 5% BSA for 30 min, after which they were treated with 1 μg/ml mouse anti-V5 antibody (Life Technologies) diluted in PBS, followed by incubation with AlexaFluor 488-conjugated goat anti-mouse antibodies (Life Technologies # A-11001) for 30 min, and 10 μg/ml Hoechst33258 solution (Life Technologies) was then added for 10 min at RT. After one wash with PBS, the coverslips were mounted on Snowcoat X-tra microslides (Leica) and images were acquired using a Zeiss Axiovert 200M microscope.

Generation of soluble ephrinB1 and ephrinB3 ectodomain protein fragments

The gene fragment coding for amino acids 26–236 of mouse ephrinB1 extracellular domain was amplified by PCR and cloned between the NcoI and EcoRI restriction sites of the pET32a vector (Novagen) using the forward primer 5′CATCCCATGGATACGCCGTTGGCCAAGAAC and the reverse primer 5′GGCGAATTCTCACTTGGAGTTGAAGAAGCTGTC. The gene fragment coding for amino acids 28-227 of mouse ephrinB3 extracellular domain was amplified by PCR and cloned between the NcoI and EcoRI restriction sites of the pET32a vector (Novagen) using the forward primer 5′CATGCCATGGAACTCAGCCTGGAGCCTG and the reverse primer 5′GGCGAATTCTCACACTGCGGGCATGCTG. The proteins were expressed in E.coli AD494 (DE3) pLysS strain (Novagen), and purified via sequential column chromatography. Briefly, cultures were grown at 37°C with shaking at 225 rpm up to an OD600 = 0.6, and protein expression was induced with 1 mM IPTG for 16 hrs at 20°C. Cells were harvested, lysed, and the nucleic acids from the crude extract were precipitated with 0.3% polyethylenimine (Sigma). Proteins in the supernatant were precipitated with 0.8 M ammonium sulfate (AMS). The AMS pellet was resuspended in buffer A (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 10 mM imidazole, 10% v/v glycerol) and was run on a Ni2+ column (PorosMC, GE Healthcare) over a 10–500 mM imidazole gradient. The fractions from the Ni column containing the protein were pooled and run on an anion exchange column (MonoQ HR 10/10, GE Healthcare). The eluate was further run on a size-exclusion column (Superdex 200, GE Healthcare) in a buffer containing 150 mM NaCl, 20mM Tris-HCl pH 7.5, 10% glycerol, 1 mM EDTA, and 1mM DTT. The protein eluted in the void volume as soluble aggregates, and purity was confirmed by Coomassie staining after polyacrylamide gel electrophoresis.

Dynamic light scattering (DLS)

DLS measurements of ectodomain ephrinB3 and B1 (ed-ephrins) were performed using a DynaPro-99-E-50 instrument (Wyatt Technology Corp. Santa Barbara, CA) in the batch mode. The data were collected at RT, with the laser power at 80% at a wavelength of 828.7 nm. A protein sample with a concentration of 0.4 mg/ml in a buffer containing 150 mM NaCl, 20mM Tris-HCl pH 7.5, 10% glycerol, 1 mM EDTA, was filtered through a 0.2 μm pore membrane, centrifuged for 15 min at 14,000 g and then loaded into a 12 μl quartz cuvette. At least 10 measurements of scattered light intensity with a sum of squares (SOS) values less than 100 were recorded. Scattering data was analyzed using DYNAMICS V6 software version 6.3.40 (Wyatt Technology Corp. Santa Barbara, CA).

EphA4-mediated cell death assay and high-content analysis of SMC libraries

To use HCA potential inhibitors/activators of EphA4-mediated cell death, we employed the following procedure. (1) EphA4-3T3 or Vector-3T3 cells were plated at 103, 104 or 105 cells/well on 96-well plates (Falcon) and they were incubated in DMEM/F12 (Life Technologies) supplemented with 10% FBS at 37°C and 5% CO2 for 24 hours. (2) The following day the medium was changed to serum-free DMEM/F12 supplemented with 0.5, 5, or 50 μM SMCs from ICCB Known Bioactives Library (Enzo Life Sciences) in the presence or absence of 1 μg/ml ed-ephrinB3. In the control wells, the medium was changed to DMEM/F12 only, or DMEM/F12 supplemented with one of the following: 5% FBS, or 1 μg/ml ed-ephrinB3 or ed-ephrinB1, or 1 μg/ml preclustered ephrinB3-Fc or ephrinB1-Fc (R&D Systems, Inc. # 395-EB-200 and 473-EB-200 respectively). For the Fc reagents, clustering was performed with goat anti-human Fc antibodies (Jackson ImmunoResearch, # 109-005-098) (1:10 anti-Fc:ligand) for 1 hour at 37°C. The cells were further incubated for 24, 48, and 72 hrs at 37°C and 5% CO2, after which they were treated with 10 μg/ml Hoechst33258 solution and 5 μM Sytox® Red (Life Technologies). (4) The live/dead cells were automatically counted using the Cellomics® ArrayScan® VTI Live HCS Reader (Thermo Scientific). The images were taken at a 5x magnification, and each well was divided into 49 fields, of which 3 were scanned and counted. The cells were stained for 10 minutes before imaging and the chamber was set at 37°C and 5% CO2. We found that a seeding concentration of 104 cells/well in 150 μl medium and an incubation time of 48 hrs after removing the FBS were the optimal conditions to produce at least 50 to 60% cell death.

Statistics

GraphPad’s InStat software was used for the Student’s two-tailed t test to compare two experimental groups. One-way analysis of variance on ranks (ANOVA) was done for multiple comparisons. Differences were considered statistically significant if p values were less than 0.05. Mean values were reported and graphed together with the standard error of mean. We used the formula Z′ = 1 – {(3 × positive control SD) – (3 × negative control SD)}/(positive control mean – negative control mean), where the positive control was EphA4-3T3 cells stimulated with ephrinB3 and the negative control was unstimulated EphA4-3T3 cells.

Results

Development of the dependence receptor cell death model in clonal cell lines

EphA4 receptors are newly defined dependence receptors that undergo intracellular cleavage that leads to caspase-mediated cell death (see Figure 1A schematic).16 To evaluate EphA4 dependence receptor functions, stable NIH 3T3 cell lines expressing V5-tagged EphA416 (EphA4-3T3) or control vector alone (vector-3T3) were generated and examined for expression and activation (Figure 1B–1D). A murine cell line model was chosen because it offers the possibility of further testing “hit” SMCs in primary cultures and in vivo wild-type or genetically modified murine models, as well as complex animal models of disease. In addition, human and mouse EphA4 have a high degree of homology (98.58% amino acid sequence identity). Immunostaining for the V5 tag showed strong expression of EphA4 in NIH-3T3 cells, and application of soluble ephrinB3-Fc ligands resulted in punctate EphA4 expression that likely reflects receptor clustering (Fig. 1B; see inset). To confirm cell surface expression of EphA4 in the stable cell line, we examined whether application of soluble ephrinB3 could induce EphA4 phosphorylation. Immunoprecipitation and Western blot analysis showed robust EphA4 protein expression in the EphA4-3T3 cell line, and a significant enhancement in EphA4 phosphorylation upon ephrinB3-Fc stimulation (Fig. 1C, 1D). Following 48 hrs serum withdrawal, we also observed a 21 kDa cleavage fragment in EphA4-3T3 cells that was attenuated following ephrinB3 stimulation or in the presence of the broad-caspase inhibitor z-VAD-fmk, similar to previous findings using transiently transfected HEK293T and immortalized neuronal 13.S.24 cells.16

Figure 1.

Figure 1

Open in a new tab

Modeling EphA4-mediated cell death. (A) Schematic depiction of the EphA4 receptor as a dependence receptor. In the absence of their ligand, dependence receptors initiate apoptotic cell death by inducing caspase activation and are cleaved by caspases. (B) Clustering of EphA4 (green) following application of soluble ephrinB3-Fc in clonal EphA4-3T3 cells. Cells were counterstained with Hoechst (blue). The inset is a high magnification image showing EphA4 clustering. (C) Immunoprecipitations and Western blot analysis show that EphA4-3T3 but not vector-3T3 cells express detectable levels of EphA4-V5 when IPs were performed using either anti-V5 or anti-EphA4 antibodies. The addition of ephrinB3-Fc or ephrinB1-Fc did not change the expression level of EphA4, but ephrinB3-Fc application did increase EphA4 phosphorylation as compared to ephrinB1 stimulation. (D) Densitometry quantification of ephrinB3-Fc and ephrinB1-Fc on EphA4 phosphorylation as compared to PBS control. (E) Immunoprecipitation and Western blot analysis of cleaved EphA4 show that the amount of a cleavage fragment of ~21 kDa is attenuated in the presence of ephrinB3 or the broad-caspase inhibitor z-VAD-fmk.

These studies support the use of stable EphA4-expressing cell lines for modeling EphA4-mediated cell death in the presence and absence of ephrinB3 stimulation.

Analysis of EphA4-mediated cell death in a 96-well format

To screen the SMC library, vector-3T3 or EphA4-3T3 cells were seeded in 96-well plates in serum-containing medium. Outer wells of the 96-well plate were not used due to variability in medium evaporation that affected the cell death response. This phenomenon occurs commonly in 96-well plates and is known as the edge effect.20 There are plates designed to overcome the edge effect (e.g. Nunc Edge 96-Well Plate, Thermo Scientific Inc.), however, more consistent results were obtained using only the 60 inner wells of a 96-well plate.

After 24 hours the serum-containing medium was replaced with serum-free medium for 48 hr to induce stress in the presence (positive control) or absence (negative control) of ephrinB3-Fc or SMCs (Fig. 2A). Cell survival was examined using a Sytox® cell dead stain, and compared to total Hoechst (blue) labeling (Fig. 2B) on the Cellomics® ArrayScan® VTI Live HCS Reader.

Figure 2.

Figure 2

Open in a new tab

HCA analysis in 96-well plates can be used to screen EphA4-mediated cell death, and ephrinB3 reduces cell death following serum deprivation. (A) Schematic representation of screening SMCs (#) on serum derived EphA4-3T3 cells. Vector-3T3 cells (negative cell death control), EphA4-3T3 serum-free cells (sf) (positive cell death control), and EphA4-3T3 in the presence of soluble ephrinB3 (positive inhibition of EphA4-mediated cell death control) were included in addition to SMCs. (B) Vector-3T3 and EphA4-3T3 cells undergo significant levels of cell death upon serum deprivation as indicated by Sytox (red) labeling. The application of clustered ephrinB3-Fc blocks EphA4-mediated cell death as indicated by a decrease in Sytox-positive cells. (C) Quantification of cell death as percentage of Sytox positive cells of vector-3T3 and EphA4-3T3 cells in the presence (serum) or absence (sf) of serum and ephrinB3-Fc. Significance is shown as the difference in survival between serum free (sf) EphA4-3T3 cells and sf vector-3T3 cells or ephrinB3 treated EphA4-3T3 cells (*** p< 0.001). (D) Graded increase in cell death is mediated by length of serum-deprivation. (E) Determination of the optimal concentration of EphA4-3T3 cells needed to give a rate of 50–60% cell death upon serum deprivation.

Vector-3T3 and EphA4-3T3 cells grown in serum showed little to no cell death; however, when these cells were grown in serum-free medium for 48hr, a significant increase in cell death was observed (Fig. 2B, 2C). Furthermore, the over-expression of EphA4 augmented cell death in the absence of serum, which was blocked by addition of ephrinB3-Fc (Fig. 2B, 2C). Cell death was consistent with our previous results obtained by using other methods for cell death detection such as trypan blue exclusion and TUNEL staining.16 The ability of ephrinB3 to block EphA4-mediated cell death further supports the dependence receptor functions for EphA4 and ephrinB3 in our assay.16

In time-course serum withdrawal experiments we observed a proportional increase in the percentage of cell death with time and cell concentration, with the optimal incubation period for stress-induced cell death reaching 50–60% being 48h, with an optimal seeding concentration of 1 X 104 cells/well (Fig. 2D, 2E).

We also evaluated whether clustered ephrinB3-Fc molecules block Eph-mediated cell death as compared to clustered ephrinB1-Fc, unclustered ephrinB3-Fc, and control Fc molecules. Eph receptor activation is known to require receptor aggregation to fully activate Eph signaling, and subsequently inhibit dependence receptor-mediated cell death.16 We found that application of pre-clustered ephrinB3-Fc molecules significantly reduced EphA4-mediated cell death by 60 to 75% at doses ranging from 0.5 to 2.0 μg/ml, respectively, as compared to clustered ephrinB1-Fc, unclustered ephrinB1 and ephrinB3, and Fc-only controls (Fig. 3A). No significant differences were observed among negative controls. The test for tolerance of cells to the SMC solvent showed that dimethyl sulfoxide (DMSO), which is typically used to dissolve many SMCs, altered cell survival in concentrations above 1%. However in our experiments, the final DMSO concentration in the medium is between 0.3 to 0.5%, and we did not observe any toxic effects on cell survival (not shown). Finally we showed that our assay was robust, with a calculated Z′ factor21 of 0.58. Together, these findings suggest that EphA4 stable cell lines provide a good assay system for screening SMCs to identify potential inhibitors of cell death.

Figure 3.

Figure 3

Open in a new tab

Development of ectodomain ed-ephrinB3 protein that self-aggregates and blocks EphA4-mediated cell death. (A) Comparison of ephrinB3 on blocking EphA4-mediated cell death using clustered and unclustered ephrinB3-Fc and ephrinB1-Fc as compared to ed-ephrinB3 and ed-ephrinB1. Fc-only and vehicle controls were employed to compare efficacy. Significance is shown as the difference in survival between EphA4-3T3 cells treated with ed-ephrinB3 or clustered ephrinB3-Fc and serum free (sf) EphA4-3T3 cells (*** p< 0.001). (B) Purification of ed-ephrinB3 through a series of steps: 0.8M ammonium sulfate precipitation, immobilized metal ion affinity chromatography (Ni2+ column), anion exchange chromatography (MonoQ), size exclusion chromatography (Superdex 75). (C) Ed-ephrinB3 profile on size exclusion chromatography (Superdex 75 column). (D) DLS profile of ed-ephrinB3. The peak indicates that ed-ephrinB3 preparation is monomodal and polydisperse, with an average apparent hydrodynamic radius of approximately 21 nm.

Production of ephrinB1 and ephrinB3 soluble aggregates

The use of ephrin-Fc molecules to block Eph-mediated cell death has several disadvantages that include the expense of purchasing large quantities of ephrin-Fc, Fc controls and anti-human antibodies to cluster Fc-containing molecules, the variability resulting from the need to adequately cluster ephrin-Fc to generate biologically active molecules, and the requirement to maintain clustered molecules following delivery in animal models. In order to circumvent these problems, we generated soluble ephrinB1 and ephrinB3 ectodomain proteins (ed-ephrinB1 and ed-ephrinB3, respectively) that formed natural aggregates following purification by Fast Protein Liquid Chromatography (FPLC) (Fig. 3B, 3C). We successfully used these proteins to replace the ephrin-Fc molecules in our HCA assays. The purified proteins were of predicted size as revealed by denaturing gel electrophoresis analysis (Fig. 3B for ed-ephrinB3; ed-ephrinB1 not shown). Both proteins eluted in the void volume fractions during size exclusion chromatography, with little to no monomers detected, suggesting that these proteins self-aggregate (Fig. 3C). The exclusion limit of the column that we used (Superdex 200, GE Healthcare) suggests that the size of these aggregates is at least 1,300 kDa. In order to more precisely assess the molecular weight of the ed-ephrin protein aggregates we conducted dynamic light scattering (DLS) experiments on these proteins. Consistent with gel-filtration data, purified ed-ephrinB3 protein shows a large average apparent hydrodynamic radius of 21 nm (Fig. 3D). This suggests a molecular weight of 4,165 kDa, which would correspond to an average of 104 monomers per particle of protein aggregate, assuming a globular shaped protein. Analysis of the ed-ephrinB3 aggregates reagents as compared to ephrinB3-Fc molecules showed a similar ability to inhibit EphA4-mediated cell death as compared to ephrinB3-Fc molecules (Fig. 3A). These findings demonstrate that ed-ephrinB3 may function as a simple, reliable, and cost effective compound to block EphA4-mediated cell death; however, soluble ed-ephrinB3 would only be effective for Eph-mediated cell death and presumably would not inhibit other dependence receptors. For this reason, we used a high-content analysis (HCA) approach to identify intracellular signaling molecules that may function as common inhibitors of cell death including, but is not necessarily restricted to, Eph-mediated cell death.

Small molecule screen using HCA platform

Using an HCA approach, we analyzed an SMC bioactive library for compounds that might improve survival in EphA4-3T3 cells following serum deprivation. The ICCB Known Bioactives library (Enzo Life Sciences) contains 480 biologically active compounds that include bioactive lipids, nuclear receptor ligands, ion channel ligands, protease inhibitors, kinase inhibitors and activators, guanine nucleotide binding protein-coupled receptor ligands and signal transduction modulators. As a control for the EphA4 specificity, the SMCs were also examined on the control vector-3T3 cell line (not shown). Only compounds that significantly increased or decreased cell death of EphA4-3T3 but not on vector-3T3 cells were considered to have a specific effect on EphA4-mediated cell death. In evaluating the effects of SMCs on EphA4-3T3 survival, SMCs could potentially fall into 1 of 4 groups: (1) little to no effect; (2) significant change in survival in the absence of ed-ephrinB3, with no additive ed-ephrinB3 effect; (3) significant change in survival with an additive or enhanced ed-ephrinB3 effect; or (4) toxic. In figure 4, we show representative SMCs for classification groups 2, 3 and 4 as compared to control conditions in which EphA4-3T3 cells are not serum deprived (control), serum-deprived (vehicle) controls, and serum-deprived plus 1 μg/ml ed-ephrinB3. Numerous SMCs showed little or no effect (not shown).

Figure 4.

Figure 4

Open in a new tab

High content analysis (HCA) of SMCs to block EphA4-mediated cell death in EphA4-3T3 cells. Representative SMCs can enhance cell survival in EphA4-3T3. The SMCs concentrations are shown at the bottom of the table. Significance is shown as the difference in survival between serum-free (sf) EphA4-3T3 cells (vehicle) and EphA4-3T3 cells treated with SMCs in the presence or absence of ed-ephrin B3 (*** p< 0.001), or sf EphA4-3T3 cells (ed-ephrinB3) and EphA4-3T3 (SMCs) in the presence or absence of ed-ephrin B3 (###p< 0.001).

Figure 4 shows that application of ed-ephrinB3 reduced the number of Sytox-positive EphA4-3T3 cells by 50% following serum deprivation. Conversely, cell death of vector-3T3 cells following serum withdrawal remained virtually unchanged in the presence of ed-ephrinB3 (not shown). To identify potential cell death inhibitors, SMCs were added in the presence and absence of ed-ephrinB3. Most of the SMCs tested fell into group 1 (little to no effect), however, a number of SMCs significantly reduced cell death comparable to the effect of ed-ephrinB3 (Fig. 4). In particular, LY294002, a phosphatidylinositol 3-kinase (PI3K) inhibitor, improved EphA4-3T3 cell survival similar to ed-ephrinB3 alone. In addition, the presence of both LY294002 and ed-ephrinB3 showed an additive effect at 0.5 μM concentration, suggesting that PI3K and Eph ‘dependence receptor’ signaling may be independent of each other. Trends towards improved survival in the presence of ed-ephrinB3 were observed at higher concentrations but were not significantly different. U1026, a MEK (MAP/ERK kinase) inhibitor, showed similar improvements in cell survival with no additive effects at concentrations of 0.5 and 5.0 μM, however it becomes toxic at 50 μM. These results support the possibility that MAP/ERK kinase plays a role in Eph-mediated cell death. Fluprostenol, a prostaglandin F receptor agonist, showed significant improvements in cell survival at all concentrations tested in the presence or absence of ed-ephrinB3. Rapamycin, an mTOR (mammalian target of rapamycin) inhibitor, while toxic at the 50 μM concentration, improved cell survival at 0.5 and 5.0 μM more than ed-ephrinB3 alone and no additive effects were observed in the presence of both rapamycin and ed-ephrinB3. Finally, TPEN (N,N,N′,N′-tetrakis-2-pyridylmethyl-ethylenediamine), an intracellular Zn2+ chelator, was toxic at all concentrations tested in both EphA4-3T3 and vector-3T3 cell lines, and addition of ed-ephrinB3 did not improve cell survival. Together, these studies support an HCA approach to screening inhibitors of EphA4-mediated cell death, as well as the potential involvement of MEK/ERK and FRAP in dependence receptor signaling cascades, however additional studies are needed.

Discussion

Dependence receptors have been implicated in various pathological conditions such as cancer, CNS injury, and disease,22 however therapeutic targeting of dependence receptor mechanisms has presented numerous challenges for investigators. This is primarily because dependence receptors do not induce cell death following ligand-receptor interactions, but in fact, are cleaved and activated in the absence of their respective ligands. As a result, little is known about the signal transduction pathways that ultimately activate downstream caspases to induce cellular apoptosis. In order to study these responses, we created a HCA approach to screen large numbers of molecules that might inhibit or activate dependence receptor signaling.

For the present study we chose to examine EphA4-mediated cell death, which is involved in numerous physiological and pathological processes, such as CNS development,23 cancer pathogenesis including glioma24 and melanoma,25 and adult neurogenesis.16 This makes the EphA4 receptor a good target for drug therapies. Previous studies have identified small peptides26 or small molecule drugs27,28 that bind to the extracellular domain of EphA4 receptors and inhibit ephrin binding. Other compounds bind directly to the intracellular kinase domain and inhibit the tyrosine kinase receptor function of EphA4.29,30 However, we have recently shown that EphA4-mediated cell death activity is enhanced in the absence of ligand binding and is independent of its kinase activity.16 In fact, EphA4-mediated cell death is a direct result of receptor cleavage of the intracellular EphA4 domain by caspase-3 or caspase-like molecules of the intracellular EphA4 domain, which leads to a unique signaling cascade involving caspase activation. Although, common to many dependence receptors, this pathway remains poorly defined. Therefore, this study sought to develop an HCA screen to allow identification of downstream molecules that are involved in EphA4 signaling following cleavage by identifying SMCs that might interfere with or activate EphA4-mediated cell death. We chose to use a cell count assay based on Sytox®Red to examine cell death, although alternative assays that measure total fluorescence/luminosity of live/dead cells (MTT Assay, Sigma Inc., Cell Titer Glo Assay, Promega) or caspase-activity (Fluorescent Caspase-3/7 Assay, Sigma) may also be possible. One advantage to employing fluorescence/luminosity assays is the simplicity and ability to use more common fluorescent plate readers as compared to the Cellomics® ArrayScan® VTI Live HCS Reader. Disadvantages of using fluorescence/luminosity live/dead assays include a relative analysis of cell death that requires a standard curve, low background, high signal to noise ratio, and highly consistent seeding. In contrast, the Cellomics® ArrayScan® VTI Live HCS Reader quantifies the ratio of live and dead cells to provide percent cell viability. Finally, employing caspase-activity assays has the advantage of demonstrating selectivity for apoptosis, but is more expensive for large HCA experiments.

Ligand replacement strategies are also a reasonable approach to blocking dependence receptor-mediated cell death; however, this strategy is largely confined to receptor specific inhibition. For EphA4, ephrinB3 is one of several potential ligands, including A-class ephrins, which may bind and inhibit EphA4-mediated cell death. EphrinB3 also binds to EphB3, another potential dependence receptor in the Eph receptor family.31 To inhibit EphA4- and EphB3-mediated cell death, we have developed and purified an ectodomain ephrinB3 (ed-ephrinB3) protein with binding/activating ability similar to commercially available ephrinB3-Fc molecules. The self-aggregating properties of this protein led to receptor activation, and also led to reduced receptor cleavage and reduced cell death, properties that can be achieved only through antibody-mediated “pre-clustering” when using ephrinB3-Fc molecules. Ed-ephrinB3 provides a cheaper, simpler and more reliable method for blocking EphA4-mediated cell death.

Another strategy to block or enhance Eph-mediated cell death is through the inhibition or activation of downstream signaling molecules, which may have an additional benefit of affecting multiple dependence receptor types. HCA provides a reasonable approach to identifying downstream mediators of dependence receptor-induced cell death. Our study represents a starting point by screening a small library of SMCs with known bioactivities on EphA4-mediated cell death to identify unique candidates that could be screened using other dependence receptors or libraries. Two protein inhibitors were identified that reduced cell death and showed no additive effects when applied with soluble ed-ephrinB3. In particular, the mTOR inhibitor rapamycin and the MAP/ERK (MEK) inhibitor, U1029, may reveal potential components of the EphA4-dependence receptor-signaling pathway. Rapamycin has already been shown to be an anti-apoptotic agent by means of reducing the levels of activated caspase-9 and caspase-3,32 two known potential effectors of the EphA4 dependence receptor pathway.16 Similarly, MAP/ERK kinases are known to be activated by Ephs33,34 and do play roles in cell survival. These candidates will need to be confirmed and evaluated as downstream mediators of other dependence receptors. Identifying potential activators of EphA4-mediated cell death is more difficult, since toxicity can complicate initial analysis. To overcome this limitation, parallel analysis of vector-3T3 control cell lines provides a tool to evaluate toxicity effects independent of EphA4-mediated cell death, where enhanced cell death in EphA4-3T3 but not vector-3T3 cells would support a pro-dependence receptor function and not toxicity. Together, these approaches may help function to identify novel inhibitors or activators of dependence receptor-induced cell death, and provide a therapeutic strategy to block or enhance these effects in the setting of injury or cancer, respectively.

Acknowledgments

We would like to thank Dr. Pavan Vaidyanathan for critical reading of the manuscript. This work was supported by the Miami Project to Cure Paralysis, DOD W81XWH-05-1-0061 (DJL, VPL, JLB), NIH NS049545 (DJL), NS059866 (JLB), HD057632 (VPL), The Walter G. Ross Foundation (VPL), North Dade Medical Foundation (CMN), Christopher and Dana Reeve Foundation Fellowship Award (ER) and a NINDS/NIH T32 NS007459 (ER).

References

  • 1.Yuan J. Neuroprotective strategies targeting apoptotic and necrotic cell death for stroke. Apoptosis. 2009;14(4):469–77. doi: 10.1007/s10495-008-0304-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ashkenazi A. Directing cancer cells to self-destruct with pro-apoptotic receptor agonists. Nat Rev Drug Discov. 2008;7(12):1001–12. doi: 10.1038/nrd2637. [DOI] [PubMed] [Google Scholar]
  • 3.Van Parijs L, Ibraghimov A, Abbas AK. The roles of costimulation and Fas in T cell apoptosis and peripheral tolerance. Immunity. 1996;4(3):321–8. doi: 10.1016/s1074-7613(00)80440-9. [DOI] [PubMed] [Google Scholar]
  • 4.Strasser A. Life and death during lymphocyte development and function: evidence for two distinct killing mechanisms. Curr Opin Immunol. 1995;7(2):228–34. doi: 10.1016/0952-7915(95)80007-7. [DOI] [PubMed] [Google Scholar]
  • 5.Ashkenazi A, Dixit VM. Death receptors: signaling and modulation. Science. 1998;281(5381):1305–8. doi: 10.1126/science.281.5381.1305. [DOI] [PubMed] [Google Scholar]
  • 6.Haase G, Pettmann B, Raoul C, Henderson CE. Signaling by death receptors in the nervous system. Curr Opin Neurobiol. 2008;18(3):284–91. doi: 10.1016/j.conb.2008.07.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Mehlen P, Bredesen DE. The dependence receptor hypothesis. Apoptosis. 2004;9(1):37–49. doi: 10.1023/B:APPT.0000012120.66221.b2. [DOI] [PubMed] [Google Scholar]
  • 8.Llambi F, Causeret F, Bloch-Gallego E, Mehlen P. Netrin-1 acts as a survival factor via its receptors UNC5H and DCC. Embo J. 2001;20(11):2715–22. doi: 10.1093/emboj/20.11.2715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Llambi F, Lourenco FC, Gozuacik D, Guix C, Pays L, Del Rio G, Kimchi A, Mehlen P. The dependence receptor UNC5H2 mediates apoptosis through DAP-kinase. Embo J. 2005;24(6):1192–201. doi: 10.1038/sj.emboj.7600584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Rabizadeh S, Oh J, Zhong LT, Yang J, Bitler CM, Butcher LL, Bredesen DE. Induction of apoptosis by the low-affinity NGF receptor. Science. 1993;261(5119):345–8. doi: 10.1126/science.8332899. [DOI] [PubMed] [Google Scholar]
  • 11.Ellerby LM, Hackam AS, Propp SS, Ellerby HM, Rabizadeh S, Cashman NR, Trifiro MA, Pinsky L, Wellington CL, Salvesen GS, Hayden MR, Bredesen DE. Kennedy’s disease: caspase cleavage of the androgen receptor is a crucial event in cytotoxicity. J Neurochem. 1999;72(1):185–95. doi: 10.1046/j.1471-4159.1999.0720185.x. [DOI] [PubMed] [Google Scholar]
  • 12.Thibert C, Teillet MA, Lapointe F, Mazelin L, Le Douarin NM, Mehlen P. Inhibition of neuroepithelial patched-induced apoptosis by sonic hedgehog. Science. 2003;301(5634):843–6. doi: 10.1126/science.1085405. [DOI] [PubMed] [Google Scholar]
  • 13.Tulasne D, Deheuninck J, Lourenco FC, Lamballe F, Ji Z, Leroy C, Puchois E, Moumen A, Maina F, Mehlen P, Fafeur V. Proapoptotic function of the MET tyrosine kinase receptor through caspase cleavage. Mol Cell Biol. 2004;24(23):10328–39. doi: 10.1128/MCB.24.23.10328-10339.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Tauszig-Delamasure S, Yu LY, Cabrera JR, Bouzas-Rodriguez J, Mermet-Bouvier C, Guix C, Bordeaux MC, Arumae U, Mehlen P. The TrkC receptor induces apoptosis when the dependence receptor notion meets the neurotrophin paradigm. Proc Natl Acad Sci U S A. 2007;104(33):13361–6. doi: 10.1073/pnas.0701243104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Matsunaga E, Tauszig-Delamasure S, Monnier PP, Mueller BK, Strittmatter SM, Mehlen P, Chedotal A. RGM and its receptor neogenin regulate neuronal survival. Nat Cell Biol. 2004;6(8):749–55. doi: 10.1038/ncb1157. [DOI] [PubMed] [Google Scholar]
  • 16.Furne C, Ricard J, Cabrera JR, Pays L, Bethea JR, Mehlen P, Liebl DJ. EphrinB3 is an anti-apoptotic ligand that inhibits the dependence receptor functions of EphA4 receptors during adult neurogenesis. Biochim Biophys Acta. 2009;1793(2):231–8. doi: 10.1016/j.bbamcr.2008.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Mehlen P, Bredesen DE. Meeting report: cellular dependence--old concept, new mechanisms. Sci STKE. 2003;2003(213):pe55. doi: 10.1126/stke.2132003pe55. [DOI] [PubMed] [Google Scholar]
  • 18.Dohn M, Jiang J, Chen X. Receptor tyrosine kinase EphA2 is regulated by p53-family proteins and induces apoptosis. Oncogene. 2001;20(45):6503–15. doi: 10.1038/sj.onc.1204816. [DOI] [PubMed] [Google Scholar]
  • 19.Chao MV. Dependence receptors: what is the mechanism? Sci STKE. 2003;2003(200):PE38. doi: 10.1126/stke.2003.200.pe38. [DOI] [PubMed] [Google Scholar]
  • 20.Zimmermann HF, John GT, Trauthwein H, Dingerdissen U, Huthmacher K. Rapid evaluation of oxygen and water permeation through microplate sealing tapes. Biotechnol Prog. 2003;19(3):1061–3. doi: 10.1021/bp025774t. [DOI] [PubMed] [Google Scholar]
  • 21.Zhang JH, Chung TD, Oldenburg KR. A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays. J Biomol Screen. 1999;4(2):67–73. doi: 10.1177/108705719900400206. [DOI] [PubMed] [Google Scholar]
  • 22.Mehlen P, Bredesen DE. Dependence receptors: from basic research to drug development. Sci Signal. 2011;4(157):mr2. doi: 10.1126/scisignal.2001521. [DOI] [PubMed] [Google Scholar]
  • 23.Canty AJ, Greferath U, Turnley AM, Murphy M. Eph tyrosine kinase receptor EphA4 is required for the topographic mapping of the corticospinal tract. Proc Natl Acad Sci U S A. 2006;103(42):15629–34. doi: 10.1073/pnas.0607350103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Fukai J, Yokote H, Yamanaka R, Arao T, Nishio K, Itakura T. EphA4 promotes cell proliferation and migration through a novel EphA4-FGFR1 signaling pathway in the human glioma U251 cell line. Mol Cancer Ther. 2008;7(9):2768–78. doi: 10.1158/1535-7163.MCT-07-2263. [DOI] [PubMed] [Google Scholar]
  • 25.Easty DJ, Bennett DC. Protein tyrosine kinases in malignant melanoma. Melanoma Res. 2000;10(5):401–11. doi: 10.1097/00008390-200010000-00001. [DOI] [PubMed] [Google Scholar]
  • 26.Murai KK, Nguyen LN, Koolpe M, McLennan R, Krull CE, Pasquale EB. Targeting the EphA4 receptor in the nervous system with biologically active peptides. Mol Cell Neurosci. 2003;24(4):1000–11. doi: 10.1016/j.mcn.2003.08.006. [DOI] [PubMed] [Google Scholar]
  • 27.Noberini R, Koolpe M, Peddibhotla S, Dahl R, Su Y, Cosford ND, Roth GP, Pasquale EB. Small molecules can selectively inhibit ephrin binding to the EphA4 and EphA2 receptors. J Biol Chem. 2008;283(43):29461–72. doi: 10.1074/jbc.M804103200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Qin H, Shi J, Noberini R, Pasquale EB, Song J. Crystal structure and NMR binding reveal that two small molecule antagonists target the high affinity ephrin-binding channel of the EphA4 receptor. J Biol Chem. 2008;283(43):29473–84. doi: 10.1074/jbc.M804114200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Caligiuri M, Molz L, Liu Q, Kaplan F, Xu JP, Majeti JZ, Ramos-Kelsey R, Murthi K, Lievens S, Tavernier J, Kley N. MASPIT: three-hybrid trap for quantitative proteome fingerprinting of small molecule-protein interactions in mammalian cells. Chem Biol. 2006;13(7):711–22. doi: 10.1016/j.chembiol.2006.05.008. [DOI] [PubMed] [Google Scholar]
  • 30.Karaman MW, Herrgard S, Treiber DK, Gallant P, Atteridge CE, Campbell BT, Chan KW, Ciceri P, Davis MI, Edeen PT, Faraoni R, Floyd M, Hunt JP, Lockhart DJ, Milanov ZV, Morrison MJ, Pallares G, Patel HK, Pritchard S, Wodicka LM, Zarrinkar PP. A quantitative analysis of kinase inhibitor selectivity. Nat Biotechnol. 2008;26(1):127–32. doi: 10.1038/nbt1358. [DOI] [PubMed] [Google Scholar]
  • 31.Theus MH, Ricard J, Bethea JR, Liebl DJ. EphB3 limits the expansion of neural progenitor cells in the subventricular zone by regulating p53 during homeostasis and following traumatic brain injury. Stem Cells. 2010;28(7):1231–42. doi: 10.1002/stem.449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ravikumar B, Berger Z, Vacher C, O’Kane CJ, Rubinsztein DC. Rapamycin pre-treatment protects against apoptosis. Hum Mol Genet. 2006;15(7):1209–16. doi: 10.1093/hmg/ddl036. [DOI] [PubMed] [Google Scholar]
  • 33.Miao H, Wei BR, Peehl DM, Li Q, Alexandrou T, Schelling JR, Rhim JS, Sedor JR, Burnett E, Wang B. Activation of EphA receptor tyrosine kinase inhibits the Ras/MAPK pathway. Nat Cell Biol. 2001;3(5):527–30. doi: 10.1038/35074604. [DOI] [PubMed] [Google Scholar]
  • 34.Vindis C, Cerretti DP, Daniel TO, Huynh-Do U. EphB1 recruits c-Src and p52Shc to activate MAPK/ERK and promote chemotaxis. J Cell Biol. 2003;162(4):661–71. doi: 10.1083/jcb.200302073. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES