Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 2014 Dec 30;43(6):e42. doi: 10.1093/nar/gku1380

Genome engineering using a synthetic gene circuit in Bacillus subtilis

Da-Eun Jeong 1, Seung-Hwan Park 1,2, Jae-Gu Pan 1, Eui-Joong Kim 3, Soo-Keun Choi 1,2,*
PMCID: PMC4381049  PMID: 25552415

Abstract

Genome engineering without leaving foreign DNA behind requires an efficient counter-selectable marker system. Here, we developed a genome engineering method in Bacillus subtilis using a synthetic gene circuit as a counter-selectable marker system. The system contained two repressible promoters (B. subtilis xylA (Pxyl) and spac (Pspac)) and two repressor genes (lacI and xylR). Pxyl-lacI was integrated into the B. subtilis genome with a target gene containing a desired mutation. The xylR and Pspac–chloramphenicol resistant genes (cat) were located on a helper plasmid. In the presence of xylose, repression of XylR by xylose induced LacI expression, the LacIs repressed the Pspac promoter and the cells become chloramphenicol sensitive. Thus, to survive in the presence of chloramphenicol, the cell must delete Pxyl-lacI by recombination between the wild-type and mutated target genes. The recombination leads to mutation of the target gene. The remaining helper plasmid was removed easily under the chloramphenicol absent condition. In this study, we showed base insertion, deletion and point mutation of the B. subtilis genome without leaving any foreign DNA behind. Additionally, we successfully deleted a 2-kb gene (amyE) and a 38-kb operon (ppsABCDE). This method will be useful to construct designer Bacillus strains for various industrial applications.

INTRODUCTION

Bacillus species are spore-forming Gram-positive bacteria and are the most frequently used bacteria for industrial enzyme production. Currently, about 60% of commercially available enzymes are produced from Bacillus species. Bacillus strains have also been used to produce nucleotides, vitamins, ribose and poly-γ-glutamic acid and as expression hosts to produce foreign recombination proteins (13). Industrial-scale production of commercial enzymes or metabolites requires strain engineering because wild-type Bacillus strains have not been adapted for overproducing specific enzymes or metabolites. Strain engineering often requires multiple mutations in the genome. However, the number of antibiotic selection markers available for use in Bacillus subtilis is limited. Thus, an effective method for genome engineering that is free of any antibiotic resistance markers is needed. Furthermore, the method must be usable to construct food-grade recombinant strains.

Genome modifications in B. subtilis have been achieved by using various positive selection markers, usually antibiotic-resistance markers. Traditional methods for the genome engineering without inserting any foreign DNA used negative selections that screened antibiotic-sensitive strains. Sometimes the mutant generation was based on the activity of a thermo-sensitive replication origin (4). However, the negative selections are laborious and time-consuming. Thus, a positive selection system using an efficient counter-selectable marker is required to facilitate genome engineering (5). Several counter-selectable markers based on the upp (6), blaI (7), mazF (8,9), araR (10) and hewI (11) genes have been used in Bacillus species. However, the method using upp, blaI or araR requires a strain with a specific mutation or insertion of a foreign gene in the chromosome. When these methods are applied to different strains, prerequisite mutants must be prepared. In the case of using toxic genes, such as mazF and hewI, tightly controlled expression is required. However, this is often unsuccessful and spontaneous resistant strains without the desired recombination are frequently generated. Thus, we developed a new and highly efficient marker-free method for Bacillus genome engineering without prior modifications of the bacterial strain.

Synthetic genetic circuits designed to program new biological behavior, dynamics and logic control have become valuable and widely applicable tools for studying genetics and cell biology. In addition to academic research, they have been applied commercially for the production of pharmaceuticals, biofuels and chemicals (12). In this study, we constructed a synthetic genetic circuit involving negative feedback loops; we also show its utility as a counter-selectable marker system. The system was demonstrated to be highly efficient for genome engineering in B. subtilis by constructing mutants having point modifications and deletions of a gene or an operon in the genome. Furthermore, the system showed that false-positive clones were generated infrequently.

MATERIALS AND METHODS

Strains and culture condition

The B. subtilis strains used in this study are listed in Table 1. Escherichia coli MC1061 was used to construct the recombinant plasmids. Bacillus cells were cultured in Luria-Bertani (LB), tryptic soy broth (TSB, Difco, Detroit, MI, USA) or trytic soy agar (TSA, Difco). To test the tryptophan auxotrophic phenotype, CHP minimal medium (13) supplemented with 1% glucose (CHPG1) was used. The cells were cultured in a 2× SG medium (14) for the protease assay. Transformation of B. subtilis was carried out by a method described previously (15). When required, the medium was supplemented with chloramphenicol (5 or 50 μg/ml), neomycin (10 μg/ml) or ampicillin (100 μg/ml).

Table 1. Bacillus strains used.

Strain Description Source
168 trpC2 Laboratory stock
BS5417 BS168 thrC::Pxyl-comK This study
BS5465 BS168 + pA-xylR2 This study
BS5438 BS168 + pA-xylR2 + pUlac-trpC1028 (single crossover) This study
BS5444 BS168 trpC+ This study
BS5446 BS168 trpC+ + pA-xylR2 This study
BS5449 BS168 trpC+ + pA-xylR2 + pUlac-aprE (single crossover) This study
BS5450 BS168 trpC+ + pA-xylR2 + pUlac-nprE (single crossover) This study
BS5451 BS168 trpC+ aprE + pA-xylR2 This study
BS5452 BS168 trpC+ nprE + pA-xylR2 This study
BS5456 BS168 trpC+ aprE + pA-xylR2 + pUlac-nprE (single crossover) This study
BS5458 BS168 trpC+ aprE nprE + pA-xylR2 This study
BS5460 BS168 trpC+ aprE This study
BS5461 BS168 trpC+ nprE This study
BS5462 BS168 trpC+ aprE nprE This study
BS5589 BS168 + pA-xylR2 + pUlac-amyE (single crossover) This study
BS5590 BS168 ΔamyE + pA-xylR2 This study
BS5591 BS168 + pA-xylR2 + pUlac-pps (single crossover) This study
BS5592 BS168 Δpps + pA-xylR2 This study

Plasmids

The primers used in this study are listed in Table 2. The helper plasmid (pA-xylR2) containing the Bacillus replication origin (rep), xylR repressor gene and spac promoter (Pspac)–chloramphenicol resistant gene (cat) fusion cassette was constructed as follows. The rep fragment was obtained by a polymerase chain reaction (PCR) with primers rep-F1 and rep-R1 from plasmid pAD123 (16). The PCR product was digested with AatII and PvuII and inserted into the corresponding sites of plasmid pUC18 to construct pUC18-rep. xylR was amplified by PCR from plasmid pAX01 (17) with primers xylR-F1 and xylR-R3. Plasmid pUC18-rep was digested with BglII and NsiI, and the large fragment was fused to the xylR fragment using a cold fusion cloning kit (System Biosciences Inc., Mountain View, CA, USA) to construct pUC-xylR. The Pspac promoter was obtained by PCR from plasmid pMUTIN4 (18) with primers Pspac-F2 and Pspac-R1. The cat structural gene was amplified from the plasmid pAD123 with primers Cm-F3 and Cm-R3, and fused to the Pspac promoter by fusion PCR to obtain the Pspaccat cassette. The plasmid pUC-xylR was digested with SphI and NheI, and the large fragment was fused to the Pspaccat cassette using a cold fusion cloning kit to construct pA-xylR. The pA-xylR was digested with BglII followed by self-ligation and introduced into B. subtilis SCK6 (19) to obtain pA-xylR2. The integration vector (pUlac-neo) containing the neomycin resistant gene (neo), the B. subtilis xylA promoter (Pxyl)-lacI fusion cassette and multiple cloning sites was constructed as follows. The Pxyl was obtained by PCR from the plasmid pAX01 with primers Pxyl-F3 and Pxyl-R2. lacI was amplified by PCR with primers lacI-F2 and lacI-R2 from pMUTIN4, and fused to Pxyl by fusion PCR to obtain the Pxyl-lacI cassette. Plasmid pUC18 was digested with AatII and PvuII, and the large fragment was fused to the Pxyl-lacI cassette using a cold fusion cloning kit to construct pUCxyl-lacI. The neo gene was amplified by PCR with primers neo-F5 and neo-R5 from plasmid pMLK83 (20), digested with HindIII and BamHI, and inserted into the corresponding sites of plasmid pUCxyl-lacI to construct pUlac-neo. To construct an insertion mutation in trpC of B. subtilis, the trpC gene from the chromosome of B. subtilis KCTC1028 was obtained by PCR with primers trpC-F2 and trpC-R2. The PCR fragment was digested with XhoI and XbaI and inserted into corresponding sites of pUlac-neo to construct the integration vector pUlac-trpC1028. The integration vector (pUlac-aprE) for the deletion mutation in aprE of B. subtilis 168 was constructed as follows. N- and C-terminus of aprE were amplified by PCR with primer sets aprE-D1/aprE-D2 and aprE-D3/aprE-D4, respectively, and fused into two PCR products by fusion PCR. The resulting aprE fragment was digested with XhoI and XbaI and inserted into corresponding sites of the pUlac-neo to construct integration vector pUlac-aprE. The integration vector (pUlac-nprE) for the point mutation in nprE of B. subtilis 168 was constructed as follows. The N- and C-termini of nprE were amplified by PCR with primer sets nprE-PM1/nprE-PM2 and nprE-PM3/nprE-PM4, respectively, and fused to two PCR products by fusion PCR. The resulting nprE fragment was digested with XhoI and XbaI, and inserted into corresponding sites of the pUlac-neo to construct the integration vector pUlac-nprE. The integration vector (pUlac-amyE) for the deletion of amyE of B. subtilis 168 was constructed as follows. N- and C-terminus of amyE were amplified by PCR with primer sets amyE-F5/amyE-R5 and amyE-F6/amyE-R6, respectively, and fused into two PCR products by fusion PCR. The resulting PCR fragment was digested with XhoI and XbaI and inserted into corresponding sites of the pUlac-neo to construct integration vector pUlac-amyE. The integration vector (pUlac-pps) for the deletion of pps operon of B. subtilis 168 was constructed as follows. N- and C-terminus of pps operon were amplified by PCR with primer sets pps-F1/pps-R1 and pps-F2/pps-R2, respectively, and fused into two PCR products by fusion PCR. The resulting PCR fragment was digested with XhoI and XbaI and inserted into corresponding sites of the pUlac-neo to construct integration vector pUlac-pps. The plasmids pA-xylR2 and pUlac-neo are available for the academic community, and their sequences were submitted to GenBank with the accession no. KP216525 and KP216524, respectively.

Table 2. Primers used.

Primer Sequence (5′ → 3′)1
rep-F1 ATAGACGTCAGATCTCGTACGATGCATAAACTGCATCCCTTA
rep-R1 ATACAGCTGGCTAGCATTATAGCATGCTATCCCACTTTATCCAATTTTC
xylR-F1 GTTTATGCATCGTACGCCGCGGGGATCCATGTTTATTTCAATGTTTTT
xylR-R3 CGAAAAGTGCCACCTGACGTCAGATCTTGATTAATTAATTCAGAACGC
Pspac-F2 GATAAAGTGGGATAGCATGCTACACAGCCCAGTCCAGACTATTCG
Pspac-R1 AATTGTTATCCGCTCACA
Cm-F3 ATTGTGAGCGGATAACAATTAAAAAGGATTGATTCTA
Cm-R3 GCCGATTCATTAATGCAGCTGGCTAGCAGATCTGCGAATGGCGACTAACGGGG
MCS CGAAAAGTGCCACCTGACGTCACTAGTCTCGAGGCTAGCCCCGGGTCTAGACATATGGCATGCCTGC AGCGTACGGTCGACGAATTC
Pxyl-F3 AGCGTACGGTCGACGAATTCCTAAAAAAAACATTGAAATA
Pxyl-R2 TTGTCATTTCCCCCTTTGAT
lacI-F2 ATCAAAGGGGGAAATGACAAATGAAACCAGTAACGTTATACGA
lacI-R2 GCCGATTCATTAATGCAGCTGGGATCCTAATATAAGCTTCGGGAGCTGCATGTGTCAGA
Neo-F5 TATAAGCTTTCGAGATCAGGGAATGAGTT
Neo-R5 AAAGGATCCAATAAATACGTAACCAACAT
trpC-F2 ATACTCGAGGCAGCAGTTCCGCTTTATCT
trpC-R2 ATATCTAGAGCCTGTGATTCCGCCGCAAG
aprE-D1 ATACTCGAGTCATTGACACAGAAGAAAAC
aprE-D2 TTTTAGCTTTTTCATCCAATGT
aprE-D3 ACATTGGATGAAAAAGCTAAAAGAATTGAAAAAAGAT
aprE-D4 ATATCTAGACGTTGATTAACCCTTTTCCA
nprE-PM1 ATACTCGAGCAATACATAATGACTGAATA
nprE-PM2 GTTTATGCAGCAGATTGATT
nprE-PM3 AATCAATCTGCTGCATAAACAGATAACAGCCAAAAAGTCT
nprE-PM4 ATATCTAGAGGTCACGGGCAGACTGAATG
amyE-F3 ATAGTCGACTCAAATAAGGAGTGTCAAGA
amyE-R4 ATAATGCATGATGGTTTCTTTCGGTAAGT
amyE-F5 CCTGACGTCACTAGTCTCGAGGCGTGAATGGGAAAAATAAG
amyE-R5 TTTCAGCACTCGCAGCCGCC
amyE-F6 GGCGGCTGCGAGTGCTGAAATGAGGGCAAGGCTAGACGGGAC
amyE-R6 CAGGCATGCCATATGTCTAGAGTGAAGGAACTGTTCTTTTT
pps-F1 CCTGACGTCACTAGTCTCGAGAGATGGGGAAAGTGAAAAAA
pps-R1 GAAAAAAGCAGAAAAATGAC
pps-F2 GTCATTTTTCTGCTTTTTTCTAAAGCGGATTAGCGGACAG
pps-R2 CAGGCATGCCATATGTCTAGAGGAATGCCTGGATGATAATA
pps-F3 CAAAAACCGGATCGCTCAGT
pps-R3 CGAAAAAAGTCCTAAAGCAT
ppsA-F1 TGTTTTAGATCCGCATTTAGC
ppsA-R1 TCGTTCCTGACGTATAAATG
ppsB-F1 GGCATTAAGCGTGGAGAGTG
ppsB-R1 GCCGTTACCCCTTTTACCAA
ppsE-F1 CACTAATGAATCCGTGAAGA
ppsE-R1 TTTCGTTAAGCCTGTATGCC

1Underlines indicate restriction enzyme sites.

Protease assay

Bacillus cells cultured in 1 ml of LB medium at 37°C for 16 h were inoculated in 10 ml of a 2× SG medium. After further culturing for 7 h at 37°C, the cultures were centrifuged to obtain the supernatants. Next, azocasein (Sigma, St. Louis, MO, USA) was dissolved at a concentration of 2% in an assay buffer containing 0.1 M sodium chloride, 0.01 M PIPES, 1 × 10−6 M zinc acetate and 5 mM calcium chloride (pH 7). The azocasein solution (300 μl) was then mixed with 100 μl of the supernatants from the Bacillus cultures and incubated in a 37°C water bath for 1 h. The reactions were stopped by adding 1.2 ml of 10% trichloroacetic acid, after which the reaction mixtures were allowed to stand at ambient temperature for 5 min. The tubes were then centrifuged for 3 min at 8000 × g, after which 600 μl of each supernatant was added to 700 μl of 1 M NaOH. The absorbance at 440 nm was then determined using a spectrophotometer.

RESULTS

Construction of a synthetic gene circuit

The regulatory network of synthetic gene circuits is artificial and can function as a molecular switch. The controllable switch can be applicable to signal a pop-in or pop-out of specific genes from chromosomes. In this study, a genetic circuit was constructed for the genome engineering of B. subtilis as a counter-selectable marker system. The system contained two repressible promoters and two repressor genes (Figure 1). Repressor 2 was transcribed from the promoter 1, and promoter 2 was located upstream of the reporter. Repressor 1 was expressed constitutively. In the absence of the inducer, the expressed repressor 1 repressed expression of repressor 2 from promoter 1, resulting in overexpression of the reporter. When inducer 1 was added to the system, promoter 1 was released from repression of the repressor 1 and overexpressed repressor 2. Repressor 2 blocked expression of the reporter from promoter 2. Thus, the promoter 1-repressor 2 cassette should be deleted to express the reporter, and could be used as a counter-selectable marker. The promoter 2-reporter cassette and repressor 1 gene were located on the plasmid so they could be removed later. We used B. subtilis xylA (Pxyl) and spac (Pspac) promoters for promoters 1 and 2, respectively. Pxyl can be induced by xylose. We also used xylR, lacI, and cat genes as the repressor 1, 2 and reporter genes, respectively.

Figure 1.

Figure 1.

A synthetic gene circuit containing two repressible promoters and two repressor genes for a counter-selectable marker system during genome engineering of B. subtilis.

Construction of an insertion mutant

B. subtilis 168 requires tryptophan to grow in a minimal medium. Sequence analysis of trp operon revealed that the tryptophan requirement phenotype (Trp) of the 168 strain came from a three base (ATT) deletion in the trpC gene (21). To obtain a Trp+ revertant, the bases (ATT) were inserted in the missing region of the trpC gene (Figure 3A). The scheme for constructing the Trp+ strain is depicted in Figure 2. The trpC gene harboring the missing three bases (ATT) was cloned into the integration vector containing the Pxyl-lacI cassette and neomycin resistant gene (neo). The vector was inserted into the B. subtilis 168 chromosome by single crossover integration. Then, the strain was transformed with the helper plasmid pA-xylR2. The resulting strain BS5438 showed resistance to both neomycin and chloramphenicol, because the constitutively expressed XylR repressed the lacI expression from the Pxyl promoter, and the repression led to overexpression of the cat gene from the Pspac promoter. If xylose were added to the cells, it would inhibit XylR function, and LacI would be overexpressed; cat expression from the Pspac promoter would be repressed so that the cells would now be chloramphenicol sensitive. Thus, the Pxyl-lacI cassette should be deleted to grow the cells in the presence of chloramphenicol. The deletion occurred by recombination between N or C fragments in Figure 2. The neo gene was also deleted by the recombination. To demonstrate this hypothesis, strain BS5438 was cultured overnight in 1 ml of TSB containing a high concentration of chloramphenicol (50 μg/ml) and 1% xylose at 37°C. After spreading the cultured cells onto a TSA plate containing 50 μg/ml chloramphenicol and 1% of xylose, the cells were cultured overnight at 37°C. One hundred colonies were randomly selected and grown on TSA containing 10 mg/ml neomycin or 5 mg/ml chloramphenicol. Among them, 99 colonies displayed the neomycin-sensitive phenotype, indicating that xylose efficiently induced the recombination to delete the Pxyl-lacI cassette and neo gene. Only 1% of the colonies were false positives. Recombination can occur with equal frequency between N or C fragments. One recombination returns the cells to the wild-type, and the other generates a mutation. When the randomly selected 100 colonies were cultured in a CHPG1 medium without tryptophan, 88 colonies were grown, indicating that 88% of the colonies were converted to the Trp+ phenotype. The trpC2 genes from the four Trp+ strains were amplified by PCR with primers trpC-F2 and trpC-R2, and were analyzed by sequencing. The result showed that all of them contained the three base (ATT) insertion into the trpC gene, which restored TrpC function. The resulting strain BS5446 was neomycin-sensitive, chloramphenicol-resistant and the Trp+ phenotypes (Figure 3B), and could grow in a minimal medium without adding tryptophan (Figure 3C).

Figure 3.

Figure 3.

(A) Insertion of nucleotides into the trpC gene of B. subtilis 168 to construct the B. subtilis 168 Trp+ strain. The numbers indicate nucleic acid sequence positions relative to the first nucleotide of the start codon. (B) Growth of B. subtilis 168 Trp+ harboring the helper plasmid. Growth inhibition of the Trp+ strain on TSA containing neomycin indicated that the Pxyl-lacI cassette and neo were deleted during in vivo recombination. Growth on TSA containing chloramphenicol revealed the presence of the helper plasmid. The Trp+ strain can be grown on a defined medium without a tryptophan supplement. (C) Growth of the Trp (black circles) and Trp+ (black squares) strains in a defined medium with or without a tryptophan supplement.

Figure 2.

Figure 2.

Strategy for constructing the B. subtilis 168 Trp+ strain using a synthetic gene circuit. The integration vector contains the B. subtilis trpC gene harboring three missing bases (ATT), the Pxyl-lacI cassette and the neomycin-resistant gene (neo). N and C represent N- and C-terminal parts of the B. subtilis trpC gene. The helper plasmid contains a xylR repressor gene, replication origin (rep) for Bacillus and the Pspaccat fusion cassette. The integration vector was inserted into the B. subtilis 168 chromosome by single crossover integration. In vivo recombination between the N or C fragments under the presence of xylose and chloramphenicol (Cm) resulted in the deletion of the Pxyl-lacI cassette and neo. The helper plasmid was removed to construct the B. subtilis Trp+ strain.

To remove the helper plasmid, the Trp+ strain BS5446 containing the helper plasmid pA-xylR2 was cultured in 1 ml of TSB for 24 h at 37°C, spread onto a TSA plate and further cultured overnight at 37°C. Then, 100 randomly selected colonies were picked and cultured on TSA or TSA containing 5 μg/ml chloramphenicol to select chloramphenicol-sensitive colonies. Among them, 36 colonies showed the chloramphenicol-sensitive phenotype, and no plasmids from them were detected. Thus, this result demonstrated that the helper plasmid could be easily removed.

Construction of deletion and point mutants

B. subtilis contains eight extracellular proteases (22). Among them, more than 95% of the extracellular proteolytic activity is contributed by the two major proteases, AprE and NprE (23). Inactivation of the two major proteases can significantly enhance the expression of heterologous proteins (24). We carried out the deletion and point mutations of aprE and nprE, respectively, by the method used in this study. For the deletion mutation, two bases (GT) were deleted from the aprE gene of B. subtilis 168 to construct the AprE strain (Figure 4A). To do this, the integration plasmid pUlac-aprE containing a two-base deletion in the aprE gene was introduced into strain BS5446 to integrate the plasmid into the chromosome. The resulting strain BS5449 was induced by xylose for recombination using the method described above. The recombinants showed neomycin-sensitive phenotypes in 42 clones among 50 randomly selected clones. The aprE genes were amplified by PCR from 10 randomly selected neomycin-sensitive clones. The nucleotide sequence analysis of the aprE genes showed that four clones contained deletion mutations in the aprE genes. The helper plasmid from the strain BS5451 (Trp+, AprE) was removed by the method described above to construct strain BS5460.

Figure 4.

Figure 4.

Deletion of nucleotides in the aprE gene (A) and point mutation in the nprE gene (B) of Bacillus subtilis 168 Trp+ strain to construct strains lacking AprE (AprE) and NprE (NprE). The numbers indicate nucleic acid sequence positions relative to the first nucleotide of the start codon. The point mutation created a stop codon in the NprE gene. (C) The protease assay of B. subtilis Trp+, AprE and NprE strains and a comparison of them with the WB800N strain in which eight extracellular proteases were deleted.

For the point mutation, a single base in the nprE gene was changed to create a stop codon, which resulted in the NprE phenotype (Figure 4B). To do this, the integration plasmid pUlac-nprE was introduced into strain BS5446. The resulting strain BS5450 was induced by xylose for recombination using the method described above. The recombinants showed neomycin-sensitive phenotypes in 43 clones among 50 randomly selected clones. The nprE genes were amplified by PCR from nine randomly selected neomycin-sensitive clones. The nucleotide sequence analysis of the nprE genes showed that all nine clones contained point mutations in the nprE gene. The helper plasmid from strain BS5452 (Trp+, NprE) was removed by the method described above to construct strain BS5461. Strain BS5462 (Trp+, AprE, NprE) was constructed by introducing the plasmid pUlac-nprE into strain BS5456, followed by inducing recombination and curing the helper plasmid. The deletion and point mutations in the aprE and nprE genes, respectively, were further confirmed by the protease assay in which extracellular protease activities were reduced in the mutants (Figure 4C).

Deletion of a gene or operon

For the broad application of our method, we applied the method to the deletion of a gene and operon from the genome. To delete an about 2-kb amyE gene, the integration plasmid pUlac-amyE was introduced into strain BS5465. The resulting strain BS5589 was induced by xylose for recombination using the method described above. The recombinants showed neomycin-sensitive phenotypes in 25 clones among 25 randomly selected clones. Amylase assays with the selected clones on the LB agar plate containing 1% starch revealed that 16 clones (64%) showed amylase negative phenotypes. The deletion of the amylase gene was further confirmed by PCR (Figure 5). Next, we confirmed that large-sized DNA fragments can also be deleted by using our method. The deletion target was a 38-kb pps operon containing five large-sized genes (ppsABCDE). To delete the pps operon, the integration plasmid pUlac-pps was introduced into strain BS5465. The resulting strain BS5591 was induced by xylose for recombination using the method described above. The recombinants showed neomycin-sensitive phenotypes in 47 clones among 50 randomly selected clones. PCR analysis revealed that 3 of the 47 neomycin-sensitive clones (6.4%) contained a deleted pps operon (Figure 6). The results confirmed that our method is a powerful tool for Bacillus genome engineering.

Figure 5.

Figure 5.

(A) Gene structures of wild-type (BS168) and deletion mutant of amyE gene (BS168 ΔamyE). Arrows above the genes indicate primer binding sites. (B) Amylase assay of BS168 (1) and BS ΔamyE (2) on an LB agar plate containing 1% starch. (C) PCR analyses of BS168 (1) and BS ΔamyE (2) with the indicated primer sets. Expected sizes of PCR products were shown in the table.

Figure 6.

Figure 6.

(A) Gene structures of wild-type (BS168) and deletion mutant of pps operon (BS168 Δpps). Arrows above the genes indicate primer binding sites. (B) PCR analyses of BS168 (1) and BS Δpps (2) with the indicated primer sets. Expected sizes of PCR products were shown in the table.

DISCUSSION

A synthetic gene circuit has been designed to construct logical devices including timers, counters, clocks, logic processors, pattern detectors and intercellular communication modules, and can be applied to various research, industrial and medical fields (25,26). Here, we designed a synthetic gene circuit for a counter-selectable marker system to engineer a genome. Some previously reported counter-selectable marker systems required prerequisite mutations or insertions of foreign genes into the chromosome, such as inactivation of the native upp gene, or replacement of the native araR gene with the Para-neo cassette (6,7,10). In a method that uses Xer recombination, the dif site, which is a recognition sequence for the native Xer site-specific recombinases, remained in the chromosome during deletion of the selectable marker gene (27). However, the remaining exogenous non-native sequences in the chromosome hamper the system to apply to food-grade genome engineering. In our system, the reporter system (Pspac-cat cassette) was located on the plasmid. After engineering the target gene, the plasmid can be removed easily from the cell. Thus, the system does not retain any foreign DNA fragments in the chromosome, and this enables the system to be applied to food-grade genome engineering.

mazF has been used as a counter-selectable marker without any residual exogenous sequences in the chromosome (8,9). mazF encodes an endoribonuclease that specifically cleaves ACA sequences of mRNAs, and is highly toxic when expressed in cells (28). Genome engineering using the mazF system resulted in many false-positive clones in our experimental condition, and was not a proper method. Recently, an improved method using a mini-mazF-cassette was reported (29). They used direct repeat (DR) sequences for the in vivo recombination in the amyE deletion and gfp insertion experiments, which resulted in the DR remaining in the chromosome during deletion of the selectable marker system. The report used a PCR cassette without the DR in the deletion of a large fragment. However, in this case, another DNA fragment for the in vivo recombination was need, and seven DNA fragments should be fused by PCR. The report emphasized that the toxic gene mazF was under the control of a B. subtilis xyl promoter, and its expression was able of tight control. In their system, the promoter is controlled by a host-encoded repressor, XylR, which showed considerable sequence similarities in the Bacillus group, suggesting that the mini-mazF-cassette system can possibly work in other Bacillus species (30). However, tight regulation of the promoter by host XylR is not guaranteed because the consensus sequences of the XylR binding sites vary in different subgroups of genomes (30). Our system contains B. subtilis xylR in a helper plasmid to control Pxyl in an integrative plasmid. Thus, our system can possibly be directly used in any transformable wild-type strains. In addition, the tightly controlled Pxyl by the XylR shows that our system is highly efficient and infrequently generates false positives.

In this system, the sizes of the ‘N’ and ‘C’ fragments for the recombination ranged approximately from 500 to 1100 base pairs. In a mini-mazF-cassette system, the authors used 500-bp fragments for the recombination (30). Previous reports showed that ∼70 bp of homology is required for detectable homologous recombination in B. subtilis, and the recombination frequency showed a linear dependence on substrate length within the range of 77–165 bp (31). Thus, for the efficient recombination, the sizes of the ‘N’ and ‘C’ fragments could be recommended to be greater than 200 base pairs.

Our system can be used to construct insertion, deletion and point mutations in the chromosome without genome information and prerequisite genetic background. Additionally, the selectable marker system is located on the plasmid, which can be easily removed later. These characteristics suggest that the system can be applied to food-grade engineering of other Bacillus species or previously used industrial Bacillus strains. Many Bacillus strains are being used in agriculture as biocontrol agents or biofertilizers. Live Bacillus cells are spread in the environment for agricultural application. Thus, food-grade strain engineering is indispensable for improving the agricultural Bacillus strains. Our system would be useful to engineer Bacillus strains for agricultural applications.

FUNDING

Export Promotion Technology Development Program of the Ministry of Agriculture, Food, and Rural Affairs; Industrial Source Technology Development Program of the Ministry of Trade, Industry, and Energy [10044909]; Military Biodefense Laboratory Program [FDC0901412]; KRIBB Research Initiative Program of Ministry of Science, ICT, and Future Planning, Republic of Korea. Funding for open access charge: Ministry of Trade, Industry, and Energy [10044909], Republic of Korea.

Conflict of interest statement. None declared.

REFERENCES

  • 1.Schallmey M., Singh A., Ward O.P. Developments in the use of Bacillus species for industrial production. Can. J. Microbiol. 2004;50:1–17. doi: 10.1139/w03-076. [DOI] [PubMed] [Google Scholar]
  • 2.Schumann W. Production of recombinant proteins in Bacillus subtilis. Adv. Appl. Microbiol. 2007;62:137–189. doi: 10.1016/S0065-2164(07)62006-1. [DOI] [PubMed] [Google Scholar]
  • 3.Pohl S., Harwood C.R. Heterologous protein secretion by Bacillus species from the cradle to the grave. Adv. Appl. Microbiol. 2010;73:1–25. doi: 10.1016/S0065-2164(10)73001-X. [DOI] [PubMed] [Google Scholar]
  • 4.Crutz A.M., Steinmetz M., Aymerich S., Richter R., Le Coq D. Induction of levansucrase in Bacillus subtilis: an antitermination mechanism negatively controlled by the phosphotransferase system. J. Bacteriol. 1990;172:1043–1050. doi: 10.1128/jb.172.2.1043-1050.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Reyrat J.M., Pelicic V., Gicquel B., Rappuoli R. Counterselectable markers: untapped tools for bacterial genetics and pathogenesis. Infect. Immun. 1998;66:4011–4017. doi: 10.1128/iai.66.9.4011-4017.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Fabret C., Ehrlich S.D., Noirot P. A new mutation delivery system for genome-scale approaches in Bacillus subtilis. Mol. Microbiol. 2002;46:25–36. doi: 10.1046/j.1365-2958.2002.03140.x. [DOI] [PubMed] [Google Scholar]
  • 7.Brans A., Filee P., Chevigne A., Claessens A., Joris B. New integrative method to generate Bacillus subtilis recombinant strains free of selection markers. Appl. Environ. Microbiol. 2004;70:7241–7250. doi: 10.1128/AEM.70.12.7241-7250.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zhang X.Z., Yan X., Cui Z.L., Hong Q., Li S.P. mazF, a novel counter-selectable marker for unmarked chromosomal manipulation in Bacillus subtilis. Nucleic Acids Res. 2006;34:e71. doi: 10.1093/nar/gkl358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Morimoto T., Ara K., Ozaki K., Ogasawara N. A new simple method to introduce marker-free deletions in the Bacillus subtilis genome. Genes Genet. Syst. 2009;84:315–318. doi: 10.1266/ggs.84.315. [DOI] [PubMed] [Google Scholar]
  • 10.Liu S., Endo K., Ara K., Ozaki K., Ogasawara N. Introduction of marker-free deletions in Bacillus subtilis using the AraR repressor and the ara promoter. Microbiology. 2008;154:2562–2570. doi: 10.1099/mic.0.2008/016881-0. [DOI] [PubMed] [Google Scholar]
  • 11.Wang Y., Weng J., Waseem R., Yin X., Zhang R., Shen Q. Bacillus subtilis genome editing using ssDNA with short homology regions. Nucleic Acids Res. 2012;40:e91. doi: 10.1093/nar/gks248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Slusarczyk A.L., Lin A., Weiss R. Foundations for the design and implementation of synthetic genetic circuits. Nat. Rev. Genet. 2012;13:406–420. doi: 10.1038/nrg3227. [DOI] [PubMed] [Google Scholar]
  • 13.Choi S.K., Saier M.H., Jr Regulation of sigL expression by the catabolite control protein CcpA involves a roadblock mechanism in Bacillus subtilis: potential connection between carbon and nitrogen metabolism. J. Bacteriol. 2005;187:6856–6861. doi: 10.1128/JB.187.19.6856-6861.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Nicholson W.L., Setlow P. Sporulation, Germination and Outgrowth. In: Harwood C.R., Cutting S.M., editors. Molecular Biological Methods for Bacillus. New York: John Wiley & Sons, Inc; 1990. pp. 391–450. [Google Scholar]
  • 15.Cutting S.M., van der Horn P.B. Genetic analysis. In: Harwood C.R., Cutting S.M., editors. Molecular Biological Methods for Bacillus. New York: John Wiley & Sons, Inc; 1990. pp. 24–74. [Google Scholar]
  • 16.Dunn A.K., Handelsman J. A vector for promoter trapping in Bacillus cereus. Gene. 1999;226:297–305. doi: 10.1016/s0378-1119(98)00544-7. [DOI] [PubMed] [Google Scholar]
  • 17.Hartl B., Wehrl W., Wiegert T., Homuth G., Schumann W. Development of a new integration site within the Bacillus subtilis chromosome and construction of compatible expression cassettes. J. Bacteriol. 2001;183:2696–2699. doi: 10.1128/JB.183.8.2696-2699.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Vagner V., Dervyn E., Ehrlich S.D. A vector for systematic gene inactivation in Bacillus subtilis. Microbiology. 1998;144:3097–3104. doi: 10.1099/00221287-144-11-3097. [DOI] [PubMed] [Google Scholar]
  • 19.Zhang X.Z., Zhang Y. Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis. Microb. Biotechnol. 2011;4:98–105. doi: 10.1111/j.1751-7915.2010.00230.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Karow M.L., Piggot P.J. Construction of gusA transcriptional fusion vectors for Bacillus subtilis and their utilization for studies of spore formation. Gene. 1995;163:69–74. doi: 10.1016/0378-1119(95)00402-r. [DOI] [PubMed] [Google Scholar]
  • 21.Albertini A.M., Galizzi A. The sequence of the trp operon of Bacillus subtilis 168 (trpC2) revisited. Microbiology. 1999;145:3319–3320. doi: 10.1099/00221287-145-12-3319. [DOI] [PubMed] [Google Scholar]
  • 22.Kunst F., Ogasawara N., Moszer I., Albertini A.M., Alloni G., Azevedo V., Bertero M.G., Bessieres P., Bolotin A., Borchert S., et al. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature. 1997;390:249–256. doi: 10.1038/36786. [DOI] [PubMed] [Google Scholar]
  • 23.Kawamura F., Doi R.H. Construction of a Bacillus subtilis double mutant deficient in extracellular alkaline and neutral proteases. J. Bacteriol. 1984;160:442–444. doi: 10.1128/jb.160.1.442-444.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wong S.L. Development of an inducible and enhancible expression and secretion system in Bacillus subtilis. Gene. 1989;83:215–223. doi: 10.1016/0378-1119(89)90107-8. [DOI] [PubMed] [Google Scholar]
  • 25.Khalil A.S., Collins J.J. Synthetic biology: applications come of age. Nat. Rev. Genet. 2010;11:367–379. doi: 10.1038/nrg2775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ruder W.C., Lu T., Collins J.J. Synthetic biology moving into the clinic. Science. 2011;333:1248–1252. doi: 10.1126/science.1206843. [DOI] [PubMed] [Google Scholar]
  • 27.Bloor A.E., Cranenburgh R.M. An efficient method of selectable marker gene excision by Xer recombination for gene replacement in bacterial chromosomes. Appl. Environ. Microbiol. 2006;72:2520–2525. doi: 10.1128/AEM.72.4.2520-2525.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zhang Y., Zhang J., Hara H., Kato I., Inouye M. Insights into the mRNA cleavage mechanism by MazF, an mRNA interferase. J. Biol. Chem. 2005;280:3143–3150. doi: 10.1074/jbc.M411811200. [DOI] [PubMed] [Google Scholar]
  • 29.Lin Z., Deng B., Jiao Z., Wu B., Xu X., Yu D., Li W. A versatile mini-mazF-cassette for marker-free targeted genetic modification in Bacillus subtilis. J. Microbiol. Meth. 2013;95:207–214. doi: 10.1016/j.mimet.2013.07.020. [DOI] [PubMed] [Google Scholar]
  • 30.Rodionov D.A., Mironov A.A., Gelfand M.S. Transcriptional regulation of pentose utilisation systems in the Bacillus/Clostridium group of bacteria. FEMS Microbiol. Lett. 2001;205:305–314. doi: 10.1111/j.1574-6968.2001.tb10965.x. [DOI] [PubMed] [Google Scholar]
  • 31.Khasanov F.K., Zvingila D.J., Zainullin A.A., Prozorov A.A., Bashkirov V.I. Homologous recombination between plasmid and chromosomal DNA in Bacillus subtilis requires approximately 70 bp of homology. Mol. Gen. Genet. 1992;234:494–497. doi: 10.1007/BF00538711. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES