Skip to main content
PLOS One logoLink to PLOS One
. 2015 Apr 1;10(4):e0124208. doi: 10.1371/journal.pone.0124208

Correction: Detection of MPLW515L/K Mutations and Determination of Allele Frequencies with a Single-Tube PCR Assay

The PLOS ONE Staff
PMCID: PMC4382280  PMID: 25830290

There are errors in the first sentence of the “Targeted deep sequencing” section of the Materials and Methods. The correct sentence is: A 169-bp fragment containing the human MPL sequence (43349278 to 43349446 of NC_000001.11) was PCR-amplified from genomic or standard plasmid DNA using forward (5′- TGACCGCTCTGCATCTAGTGC -3′) and reverse (5′-GGTCACAGAGCGAACCAAGA-3′) primers (see above).

There is an error in Fig. 1. The first primer sequence in Fig. 1A is incorrect. Please view Fig. 1 here.

Fig 1. Detection of MPLW515L/K mutations using DARMS-PCR.

Fig 1

(A) The primers used in the DARMS-PCR assay. The two inner primers harbored sequences (underlined) that matched MPLW515L or W515K, but not the wild-type allele. Other mismatches (capital letters) were introduced into the inner primers to reduce the annealing of the mutant-specific primers to the wild-type sequence. The reverse primers were labeled with FAM (5-carboxyfluorescein hydrate) at the 5′ terminus. (B) A schematic representation of DARMS-PCR products. The two outer primers were designed to generate a 169-base-pair (bp) PCR product from all MPL alleles. The F_inner and R_inner primers annealed specifically to the MPLW515L and W515K alleles, respectively; in combination with the outer primers, they generated 84- and 128-bp PCR products, respectively. From a mutant allele, both 169-bp and 84- or 128-bp fragments were amplified, while, only the 169-bp fragment was generated from the wild-type allele. (C) Demonstration of DARMS-PCR. A capillary electropherogram of DARMS-PCR products showing three peaks derived from wild-type MPL, W515L, and W515K. This result was obtained when PCR was performed with a standard DNA mixture containing equal ratios of MPL wild-type, W515L, and W515K alleles with a total copy number of 105. The horizontal axis represents the fragment length, and the vertical axis represents the fluorescence intensity.

Reference


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES