Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Apr 3.
Published in final edited form as: Leukemia. 2011 Aug 9;26(2):340–348. doi: 10.1038/leu.2011.192

MRK003, a Gamma Secretase Inhibitor exhibits promising in vitro pre-clinical activity in Multiple Myeloma and Non Hodgkin's Lymphoma

Vijay Ramakrishnan 1, Stephen Ansell 1, Jessica Haug 1, Deanna Grote 1, Teresa Kimlinger 1, Mary Stenson 1, Michael Timm 1, Linda Wellik 1, Timothy Halling 1, S Vincent Rajkumar 1, Shaji Kumar 1
PMCID: PMC4384189  NIHMSID: NIHMS675012  PMID: 21826062

Abstract

Notch stimulated signaling cascade results in transcriptional regulation of genes involved in cell fate decision, apoptosis and proliferation and has been implicated in various malignancies. Here, we investigated the impact of MRK003, an inhibitor of this pathway, on myeloma and lymphoma cells. We first studied the expression patterns of notch receptors and ligands on multiple myeloma (MM) and non-Hodgkin's lymphoma (NHL) cell lines. Next, we used a gamma secretase inhibitor, MRK003 to test the importance of notch stimulated pathways in MM and NHL disease biology. We observed expression of notch receptors and ligands on MM and NHL cell lines. MRK003 treatment induced caspase dependent apoptosis and inhibited proliferation of MM and NHL cell lines and patient cells. Examination of signaling events following treatment showed time dependent decrease in levels of Notch Intracellular Domain (NICD), Hes1 and c-Myc. MRK003 down regulated cyclin D1, Bcl-Xl and Xiap levels in NHL cells and p21, Bcl-2 and Bcl-Xl in MM cells. In addition, MRK003 caused an up regulation of pAkt indicating cross talk with other important signaling pathways implicated in MM. We evaluated MRK003 in combination with AKTi and observed synergy in killing MM and NHL cell lines examined.

Keywords: myeloma, non-Hodgkin's lymphoma, notch, GSI, apoptosis

Introduction

Multiple myeloma (MM) is a malignancy of the plasma cells and remains incurable despite recent advances in therapy. Non-Hodgkin's lymphoma (NHL) is the most common cancer of the lymphatic system and represents a heterogenous group of diseases. Depending on the type of NHL, the response to treatment could vary greatly from being curable to being resistant to available therapies. Novel therapies based on the disease biology are required to improve patient outcome in both these cancers.

Notch proteins are high molecular weight transmembrane proteins that are implicated in a broad spectrum of cellular events including embryonic development, cell fate determination, differentiation, proliferation and apoptosis (1). Notch proteins are expressed on cell membranes as a heterodimer (2) and its activation requires the interaction of notch ligands expressed on adjacent cells (3). Two major families of notch ligands have been reported, namely Delta like (Dll) and Jagged. Upon ligand binding, notch undergoes sequential cleavage first at the extracellular domain by a metalloprotease (4, 5). This cleavage is followed by a cleavage at the transmembrane domain by γ-secretase complex (6, 7). This releases notch intracellular domain (NICD) to the cytoplasm, which then enters the nucleus and promotes transcription of several genes including Hes1, c-Myc, p21, NF-κB and cyclin D1 (8-12).

Dysregulated notch signaling has been reported in several solid tumors (13-15). In hematological malignancies, chromosomal alterations and activating mutations of Notch1 have been found to occur in patients with T-cell acute lymphoblastic leukemias (T-ALL), with the activating mutations seen in over 50% of patients (16-19). A recent study has identified activating mutations in PEST domain of Notch 2 protein in diffuse large B cell lymphoma (20). However, the importance of Notch pathway in tumorigenesis is not fully understood. Few reports demonstrated activated Notch to induce apoptosis and protect cells from drug induced apoptosis in B cell malignancies (21, 22). However, few others have reported Notch pathway to be oncogenic and inhibiting Notch stimulated pathway using γ-secretase inhibitors (GSI) have demonstrated growth inhibition and apoptosis of MM and Hodgkin's lymphoma cell lines (23-25). In addition, notch pathway has been shown to be up-regulated following myeloma cell interaction with the bone marrow stromal cells (BMSC) (21, 26). This up-regulation leads to enhanced growth arrest and protection of myeloma cells from chemotherapy.

Here, we report pre-clinical activity of MRK003, a GSI, on MM and NHL cell lines and patient cells in vitro. Pre-clinical studies in T-ALL, breast cancer, lung cancer and pancreatic ductal adenocarcinoma using MRK003 have reported potent notch pathway inhibition and induction of apoptosis (27-30). We observed that MRK003 induced apoptosis and inhibited proliferation of MM and NHL cell lines. MRK003 led to down regulation of canonical pathway members in both MM and NHL cells. Our results also showed up regulation of pAkt following drug treatment. Based on our mechanistic studies, we tested MRK003 in combination with Akt1/2 kinase inhibitor (Akti) and observed synergy in killing MM and NHL cells.

Materials and methods

Multiple myeloma cell lines and Non-Hodgkin's lymphoma cell lines

Dexamethasone sensitive (MM1.S) and resistant (MM1.R) human MM cell lines; doxorubicin resistant (DOX 40), and melphalan resistant (LR5) RPMI 8226 human MM cell lines and sensitive RPMI 8226 cell line, OPM-2, NCI-H929 and U266 cell lines were used for the current study. The lymphoma cell lines used included Ramos (Burkitt lymphoma), Dohh2 and Karpas 422 (Follicular lymphoma) and Granta 519 (Mantle Cell lymphoma). All the cell lines were cultured in RPMI 1640 media (Sigma Chemical, St. Louis, MO) that contained 10% fetal bovine serum, 2 mM L-glutamine (GIBCO, Grand Island, NY), 100 U/mL penicillin, and 100 μg/mL streptomycin.

Patient cells

Freshly obtained BM aspirates from patients were collected with informed consent and were processed to obtain myeloma cells or stromal cells as previously described (31, 32). Lymphoma cells were harvested from tissue samples of lymphoma patients. Lymph nodes or spleen were forced through wire screens to suspend cells. All patient cells were cultured in RPMI 1640 media (Sigma Chemical) that contained 20% fetal bovine serum, 2 mM L-glutamine (GIBCO), 100 U/mL penicillin, and 100 μg/mL streptomycin.

MRK003 and Akt1/2 kinase inhibitor (Akti)

MRK003, a cyclic sulfamide γ-secretase inhibitor was synthesized and provided by Merck & Co., Inc. (Whitehouse Station, NJ) under a Material Transfer Agreement. Stock solutions were made in DMSO at a concentration of 100mM, aliquoted and stored at -20 °C. Akti was purchased from Sigma- Aldrich Corp. (St. Louis, MO). Stock solutions were made in DMSO at a concentration of 10mM, aliquoted and stored at 4°C. The drugs were subsequently diluted in RPMI-1640 medium at the desired concentration prior to use.

Reverse Transcriptase PCR

Total RNA was isolated from cell lines using an RNeasy® Kit as described by the manufacturer (Qiagen, Inc., Valencia, CA). 100 ng of RNA was used in a one-step reverse-transcriptase polymerase chain reaction (RT-PCR) kit as described by the manufacturer (Qiagen, Inc.). Primer sequences used were:Notch1: Forward: CAGCTGCACTTCATGTACGTG Reverse: GGCAGACACAGCCGCATGCAGC Notch 2: Forward: CCACCAGGCACTCGGGGCCTA Reverse: GGAGTAATAAGGAGGCTGGCG Notch 3: Forward: AAGCGGCTAAAGGTAGAGGAG Reverse: GCATCGGCTGTGACAGCTGTG Notch 4: Forward: TGGGTATCTCTGCCAGTGTGC Reverse: CAGTGGCAGATGAAACCCAGG Dll1: Forward: GAGGGAGGCCTCGTGGA Reverse: AGACCCGAAGTGCCTTTGTA Dll3: Forward: CGGATGCACTCAACAACCT Reverse: GAAGATGGCAGGTAGCTCAA Dll4: Forward: GCATTGTTTACATTGCATCCTG Reverse: GCAAACCCCAGCAAGAGAC Jagged 1: Forward: CTATGATGAGGGGGATGCT Reverse: CGTCCATTCAGGCACTGG Jagged 2: Forward: TGGGATGCCTGGCACA Reverse: CCGGCAGATGCAGGA. PCR amplified fragments were analyzed by electrophoresing using a 1% agarose gel

Cell viability and proliferation assays

Myeloma and lymphoma cells were incubated with the indicated concentrations of MRK003 or Akti or the combination in a 96 well flat bottomed culture tray for 48hrs. Post incubation, viability and proliferation was measured using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrasodium bromide (MTT) (Chemicon International Inc., Temecula, CA) colorimetric assay and tritium uptake studies respectively as previously described (33, 34). All experiments were performed in triplicate.

Apoptosis measurement

Apoptosis of MM and lymphoma cell lines was assayed as described before (33, 34). Briefly control or drug treated cells were subjected to two washes with annexin binding buffer (ABB). 100μl cells (107 cells per ml) were treated with 3μl annexin V- FITC (Caltag, Burlingame, CA) for 15mins at room temperature. Cells were washed again with ABB and resuspended in 500μl of ABB containing 5μl of 1mg/ml propidium iodide (Sigma Chemical). The samples were subsequently run on a Canto flow cytometer (BD Biosciences, San Jose, CA). Experiments were repeated thrice.

For patient cells, fresh bone marrow cells were subject to ACK lyse, washed, resuspended in RPMI/10% FCS and plated in 24 well tissue culture plates for a 48hrs. Cultures were harvested, washed once in PBS and resuspended in 1 ml PBS/3% BSA. 100μl of the cell suspension was stained with APO 2.7 PE (Beckman Coulter, Miami, FL) or isotype control PE for a minimum of fifteen minutes. Cells were washed once with PBS and resuspended in 1% paraformaldehyde and stored at 4°C, in the dark, until run on the Canto flow cytometer (BD Biosciences).

Caspase assay

Levels of caspase 3, 8, and 9 were indirectly determined by the production of FL1 fluorescence by cleaved substrate using kits from OncoImmunin (Gaithersburg, MD). PhiPhiLux G1D2 (catalog# A304R1G-3) was used for the detection of caspase 3, while CaspaLux 8 L1D2 (catalog# CPL8R1L-3) and CaspaLux 9 M1D2 (catalog# CPL9R1M-3) were used for the detection of caspases 8 and 9. Samples were run on Canto flow cytometer (BD Biosciences). Experiments were repeated thrice.

Western Blotting

MM cell line RPMI8226, NHL cell line DOHH2 and two freshly isolated CD138+ cells from two MM patients were used for this experiment. Cells were harvested and lysed with RIPA buffer (50mM HEPES (pH 7.4), 150mM NaCl, 1% Triton X-100, 30mM sodium pyrophosphate, 5mM EDTA, 2mM Na3VO4, 5mM NaF, 1mM phenylmethyl-sulfonyl-fluoride (PMSF) and protease inhibitor cocktail). Protein lysate concentrations were measured using BCA assay (Pierce, Rockford, IL). Equal amounts of protein were loaded on Tris-Glycine gels and transferred onto nitrocellulose membranes. Membranes were probed with NICD, c-Myc, cyclin D1, p21, p65, pAkt, Akt, pErk, Erk, Mcl1, Bcl2, Bcl-Xl, Xiap (Cell Signaling, Danvers, MA), Hes1, p50, p52, RelB and c-Rel (Santa Cruz Biotechnology, Santa Cruz, CA). Blots were reprobed with anti- β actin antibody (Cell signaling) as a control. Experiments were repeated thrice.

Angiogenesis assay

We performed in vitro angiogenesis assay to test the effect of MRK003 to inhibit angiogenesis as described earlier (35). We co-cultured human endothelial cells with human fibroblasts and myoblasts in a 24 well plate with media. After two weeks, the endothelial cells, due to their ability to proliferate and migrate form a network of spindles. The co-cultured endothelial cells were treated with one of the following, VEGF (positive control) or suramin (negative control) or indicated doses of MRK003. In addition, a couple of wells were not subjected to any treatment (no treatment control).

Isobologram analysis

Interaction between MRK003 and Akti was analyzed using the CalcuSyn™ software program (Biosoft, Ferguson, MO). This program is based upon the Chou-Talalay method, which calculates a combination index (CI), and analysis is performed based on the following equation: CI = (D)1/(Dx)1 + (D)2/(Dx)2 + (D)1(D)2/(Dx)1(Dx)2, where (D)1 and (D)2 are the doses of drug 1 and drug 2 that have x effect when used in combination, and (Dx)1 and (Dx)2 are the doses of drug 1 and drug 2 that have the same x effect when used alone (36). A CI of 1.0 indicates an additive effect, whereas CI values below 1.0 indicate synergism.

Results

MM and NHL cells express notch receptors and ligands

We first wished to examine the expression patterns of notch and their ligands on MM and NHL cells. We examined expression levels of all four notch isoforms (notch 1, 2, 3 and 4). We observed high levels of expression of notch 2 in all MM (Figure 1A) and NHL (Figure 1B) cell lines tested. Notch 1 was expressed in all MM cell lines except U266, with high levels of expression observed in MM1S and MM1R (Figure 1A). All lymphoma lines tested expressed notch 1 with high levels of expression in granta cells (Figure 1B). RPMI8226, MM1S and MM1R cells did not express notch 3 whereas U266 cells expressed high levels of notch 3 (Figure 1A). MM cell lines H929 and MM1S were observed to not express notch 4 (Figure 1A). The burkitt lymphoma cell line Ramos was negative for notch 3 and notch 4 (Figure 1B).

Figure 1. Expression of notch receptors and ligands on MM and NHL cell lines.

Figure 1

Open in a new tab

By using gene specific primers and performing reverse transcriptase-PCRs, we examined the expression patterns of notch receptors and ligands on MM cells. Expression of notch receptors (notch 1-4) on A) MM cells and B) NHL cells are shown. Expression of notch ligands Dll (Dll1, 3 and 4) and Jagged 2 on C) MM cells and D) NHL cells are shown. No MM or NHL cells examined expressed Jagged 1.

We also examined expression levels of notch ligands Dll (Dll1, 3 and 4) and Jagged (Jagged 1 and 2). MM cell line MM1R was found to not express Dll1 while all other cell line expressed detectable levels. MM1R and U266 did not express Dll3 whereas H929 and LR5 did not express Dll4 (Figure 1C). All lymphoma cell lines examined expressed Dll1, 3 and 4 (Figure 1D). All MM and NHL cell lines examined were negative for Jagged 1 expression (data not shown). However, jagged 2 was expressed on all MM cell lines and NHL cell lines except karpas cell line (Figure 1C and D).

MRK003 induces cytotoxicity and inhibits proliferation in all MM and NHL cell lines

In order to understand the importance of notch pathway in MM and NHL disease biology, we used MRK003, a GSI to inhibit this pathway. When cells were incubated with indicated concentrations of MRK003 for indicated time points, we observed drug induced cell death in all MM and NHL cell lines tested with IC50 values of 15-30μM in MM cell lines and 15-25μM in NHL cell lines (Figure 2A and 2B). Granta 519 was resistant to MRK003 treatment at concentrations tested. We observed that MRK003 was able to inhibit proliferation of both MM and NHL cells (Figure 2C and 2D). MRK003 induced apoptosis at similar levels in all MM cell lines tested with MM1S cells being the most sensitive. However, MRK003 was able to more potently inhibit the proliferation of MM1S, MM1R, H929 and U266 cells at lower concentrations when compared to RPMI8226, Dox40 and LR5 cells (Figure 2A and 2C).

Figure 2. MRK003 induces cytotoxicity, inhibits proliferation and overcomes protective effects of the tumor microenvironment.

Figure 2

Open in a new tab

When cells were cultured in the presence of indicated concentrations of MRK003 for 48 hours, we observed dose dependent cytotoxicity induced by the drug in A) MM cells and B) NHL cells. MRK003 concentrations are indicated on the X-axis and viability (% of control) is indicated on the Y-axis. When cells were cultured in the presence of indicated concentrations of MRK003 for 48 hours, we observed the ability of MRK003 to inhibit proliferation of C) MM cells and D) NHL cells. MRK003 concentrations are indicated on the X-axis and counts per minute (% of control) are indicated on the Y-axis. E) MM1S cells were co-cultured with bone marrow stromal cells and incubated with indicated concentrations of MRK003 for 48 hours. There was an increase in proliferation of MM1S cells when co-cultured with stromal cells. MRK003 was still able to inhibit the proliferation of MM1S cells, though at slightly higher concentrations. MRK003 concentrations are indicated on the X-axis and counts per minute (% of control) are indicated on the Y-axis. When F) MM1S or G) Dohh2 cells were cultured in the presence of pro-angiogenic cytokines IL6, IGF or VEGF and incubated with indicated concentrations of MRK003 for 48 hours. MRK003 was able to inhibit the cytokine induced proliferation indicating the potential as anti-MM and anti-NHL agent in vivo. MRK003 concentrations are indicated on the X-axis and counts per minute (% of control) are indicated on the Y-axis.

MRK003 overcomes protective effects of the microenvironment on MM and NHL cells

It is known that cellular and non-cellular components of the tumor microenvironment protects MM and NHL cells from the cytotoxic effects of many drugs. We examined the ability of MRK003 to inhibit proliferation of MM and NHL cells when cultured with components of the microenvironment. First, we cultured the MM cell line MM1S in the presence or absence of patient derived bone marrow stromal cells (BMSCs) and incubated with indicated concentrations of MRK003. MRK003 was able to inhibit proliferation of MM1S cells at similar levels both in the presence or absence of BMSCs (Figure 2E). We co-cultured MM1S or Dohh2 cell lines in the presence or absence of cytokines found in high amounts in the microenvironment, namely VEGF, IL6 or IGF. Cells were incubated with indicated concentrations of MRK003. MRK003 was able to inhibit the cytokine induced increase in proliferation of both MM (Figure 2F) and NHL cells (Figure 2G).

MRK003 induces apoptosis in MM and NHL cell lines and patient cells in vitro

Next, we wanted to address if MRK003 induced cytotoxicity is mediated through apoptotic cell death. For this, we incubated MM1S, RPMI8226 or Dohh2 cells with indicated concentrations of MRK003 for 6, 12, 24 or 48 hrs. We observed time dependent increase in cells undergoing apoptosis in all the cell lines studied (Figure 3A, 3B and 3C). In order to better understand the mechanism of drug induced apoptosis, we measured levels of activated caspases. We observed time dependent increase in activated caspase levels (caspase 3, 8 and 9) in both MM1S and Dohh2 cells (Figure 3D and 3E). This confirmed the involvement of caspases in MRK003 induced apoptosis though additional mechanisms of cell death could be involved.

Figure 3. MRK003 leads to an increase in apoptotic cell death in MM and NHL cells.

Figure 3

Open in a new tab

A) When MM1S or B) RPMI8226 or C) Dohh2 cells were incubated with MRK003 (20μM) for indicated time points, we observed time dependent increase in apoptosis. Annexin V-FITC staining is represented on the X-axis and propidium iodide (PI) staining is represented on the Y-axis. % cells viable are indicated in the viable quadrant. D) When MM1.S or E) Dohh2 cells were treated with MRK003 (20μM) for 48 hours, induction of apoptosis was accompanied by cleavage of caspase 3, caspase 8, and caspase 9 as demonstrated by flow cytometry. MRK003 induces apoptosis of freshly isolated F) patient MM and G) patient NHL cells when cultured with the indicated drug concentrations for 48 hours as measured using Apo 2.7-PE staining and flow cytometry. Patient numbers are indicated on the X-axis and viability (% of control) is indicated on the Y-axis

We then studied if MRK003 induced apoptotic cell death in MM and NHL patient derived cells. For this, we incubated patient cells with indicated concentrations of the drug and measured cells undergoing apoptosis and observed varying degree of dose dependent increase in apoptotic cells in MM patients (Figure 3F) and NHL patients (Figure 3G).

Canonical pathway members are down regulated by MRK003

We next examined the signaling events modulated by MRK003 in both MM and NHL cells that might be responsible for the increased apoptotic cell death observed. We observed that MRK003 treatment resulted in down regulation of the notch intracellular domain (NICD) and the transcription factor Hes1 with a more pronounced down regulation observed in the NHL cell line Dohh2 (Figure 4B) than in the MM cell line RPMI8226 (Figure 4A). We also observed down regulation of other canonical pathway members, namely c-Myc and p21 with the down regulation being more pronounced in RPMI8226 (Figure 4A) than Dohh2 (Figure 4B). Cyclin D1, another canonical down stream target of Notch was down regulated only in Dohh2 cells (Figure 4B) and not in RPMI8226 cells (Figure 4A).

Figure 4. MRK003 inhibits activated notch, canonical down stream targets and anti-apoptotic proteins in MM and NHL cells.

Figure 4

Open in a new tab

A) When RPMI8226 or B) Dohh2 cells were incubated with 20μM of MRK003 for the indicated time points we observed down regulation of NICD, Hes1 and c-Myc in both cells. Cyclin D1 was down regulated post MRK003 treatment in Dohh2 cells whereas p21 was down regulated post MRK003 treatment in RPMI8226 cells. β-actin was used as a loading control. Next, we analyzed changes in other important signaling pathways and anti-apoptotic proteins implicated in MM and NHL disease biology post MRK003 treatment. When C) RPMI8226 or D) Dohh2 cells were incubated with 20μM of MRK003 for the indicated time points we observed up-regulation of pAkt in both cell lines. pErk was down regulated in RPMI8226 cells whereas pErk was up-regulated in Dohh2 cells. Both Bcl2 and Bcl-Xl were down regulated in RPMI8226 cells post MRK003 treatment. In Dohh2 cells, we observed down regulation of Bcl-Xl and Xiap protein levels post MRK003 treatment. β-actin was used as a loading control. In order to examine if MRK003 regulates expression levels of important proteins of the NF-κB pathway, we incubated E) RPMI8226 cells or F) Dohh2 cells with 20μM of MRK003 for indicated time points. We examined expression levels of p65, p50, p52, RelB and c-Rel post MRK003 treatment. In RPMI8226 cells, there was an increase in the expression of RelB post drug treatment. In Dohh2 cells, there was a decrease in the expression of p65 post drug treatment. β-actin was used as a loading control. G) When MM patient 1 cells were incubated with 20μM of MRK003 for indicated time points, we observed down regulation of cyclin D1, p21, p65, p50, p52, RelB and down stream anti apoptotic proteins Mcl1, Bcl2 and Bcl-Xl. H) When MM patient 2 cells were incubated with 20μM of MRK003 for 24hrs, we observed down regulation of canonical pathway members NICD, c-Myc and a slight reduction of Hes1. Also observed was reduction in the levels of Mcl1 and Xiap.

MRK003 modulates other signaling pathways and down regulates several anti-apoptotic proteins in MM and NHL cells

The PI3K/Akt and Ras/Mek/Erk pathways are both important in MM and NHL disease biology. In order to understand if MRK003 indirectly modulates these pathways, we examined the expression levels of important members of these pathways. MRK003 treatment resulted in decreased pErk expression in RPMI8226 cells. However, pERK was up regulated post MRK003 treatment in Dohh2 cells indicating differential pathway regulation in MM and NHL cells (Figure 4C and 4D). pAkt was found to be slightly up-regulated following MRK003 treatment in both RPMI8226 cells and Dohh2 cells indicating cross-talk between the PI3K/Akt pathway and the notch pathway (Figure 4C and 4D).

In addition, we also studied if MRK003 treatment led to down regulation of important anti-apoptotic proteins. MRK003 did not decrease levels of Mcl1 in both RPMI8226 and Dohh2 cells (Figure 4C and 4D). However, MRK003 resulted in down regulation of Bcl2 and Bcl-Xl in RPMI8226 cells (Figure 4C). In Dohh2 cells, MRK003 caused down regulation of Bcl-Xl and Xiap (Figure 4D).

MRK003 modulates NF-κB pathway

Given that notch stimulated pathway activates NF-κB pathway (11), we next wished to investigate if MRK003 acts by inhibiting the NF-κB pathway. In RPMI8226 cells, MRK003 did not change the expression levels of p65, p50, p52 and c-Rel (Figure 4E). However, MRK003 induced the expression of RelB, which might indicate partial activation of the non-canonical NF-κB pathway (Figure 4E). In Dohh2 cells, MRK003 led to down regulation of p65 with no change in the expression of other NF-κB proteins (Figure 4F).

MRK003 influences changes in both canonical and non canonical pathway members in MM patient cells

CD138+ cells from two MM patient cells (patient 1 and 2) were treated with indicated concentrations of MRK003. In patient 1, we observed that among the canonical pathway members, there was down regulation of only cyclin D1 and p21 (Figure 4G). We were unable to detect expression levels of other canonical pathway proteins in patient 1. However, in patient 2, we observed down regulation of NICD, Hes1 and c-Myc with no change in p21 levels (Figure 4H). Next, we observed that in patient 1 MRK003 was able to inhibit the NF-κB pathway as evidenced by the down regulation of p65, p50, p52 and RelB. This was accompanied by reduction in levels of anti apoptotic proteins Bcl2, Bcl-Xl and Mcl1 (Figure 4G). In patient 2, however, we did not observe any influence of MRK003 on the NF-κB pathway. However, we observed down regulation of Mcl1, Xiap and a slight down regulation of Bcl2 (Figure 4H). Clearly, MRK003 elicits its effects through different mechanisms in different patient cells.

MRK003 inhibits angiogenesis in vitro

Expression of notch ligand Dll4 is known to be regulated by Vascular Endothelial Growth Factor (VEGF) (37, 38). Abolishing Dll4 expression leads to increase in non-productive vascularity and decrease in tumor growth (38). Given that MM cells and NHL cells express Dll4 (Figure 1C and 1D) and given that there is increased secretion of VEGF and other pro-angiogenic cytokines by the tumor cell and cells of the microenvironment (39, 40), it remains likely that inhibiting Dll4 in particular or inhibiting the notch pathway might lead to decrease in angiogensis. Our results show that MRK003 is able to inhibit angiogensis in vitro at concentrations much lower than apoptotic concentrations. MRK003 was not found to affect angiogenesis when used at concentrations equal to or lower than 1μM (Figure 5). At 10μM, a concentration lower than its apoptotic concentration, MRK003 inhibited angiogenesis significantly (Figure 5). Vascular Endothelial Growth Factor (VEGF) was used as a positive control and suramin was used as a negative control.

Figure 5. MRK003 inhibits angiogenesis in vitro.

Figure 5

Open in a new tab

In this experiment, we performed in vitro angiogenesis assay to observe possible anti-angiogenic capability of MRK003. Suramin was used as a negative control and VEGF as a positive control. MRK003 caused a decrease in tubule formation. There was no decrease in tubule formation when 1μM of MRK003 was used. However, there was a significant and almost complete decrease in tubule formation at 10μM, a concentration lower than the IC50 value of MRK003 on MM and NHL cells indicating the ability of MRK003 to inhibit angiogenesis.

MRK003 synergizes with Akti in MM and NHL cells

Since MRK003 treatment resulted in up regulation of pAkt, we hypothesized that MRK003 might synergize in killing MM and NHL cells when used in combination with an inhibitor of the PI3K/Akt pathway. To address this, we pre-treated both MM and NHL cells with indicated concentrations of Akti. Sixteen hours later, these cells were treated with MRK003 and incubated for an additional 32hrs. Viability of cells post drug treatment was measured. We observed synergy when MRK003 was used in combination with Akti (Table 1A and B)

Table 1. MRK003 synergizes with AKTi in killing A) MM and B) lymphoma cells in vitro.

A)
Myeloma Cell Lines
Cell Lines Drug Concentration (μM) % Viability Ci
MM1S MRK003 20.0 90.0
AKTi 2.5 48.9
MRK003 + AKTi 20.0 + 2.5 21.0 0.720
MM1R MRK003 20.0 90.5
AKTi 2.5 49.1
MRK003 + AKTi 20.0 + 2.5 15.8 0.572
H929 MRK003 20.0 98.6
AKTi 2.5 59.6
MRK003 + AKTi 20.0 + 2.5 16.8 0.730
OPM2 MRK003 20.0 99.8
AKTi 2.5 65.3
MRK003 + AKTi 20.0 + 2.5 16.5 0.671
DOX40 MRK003 20.0 85.0
AKTi 6.0 46.2
MRK003 + AKTi 20.0 + 6.0 16.0 0.572
RPMI8226 MRK003 20.0 54.4
AKTi 6.0 46.1
MRK003 + AKTi 20.0 + 6.0 17.8 0.863
U266 MRK003 25.0 74.5
AKTi 4.0 90.2
MRK003 + AKTi 25.0 + 4.0 27.0 0.798
B)
Lymphoma Cell Lines
Cell Lines Drug Concentration (μM) % Viability Ci
DOHH2 MRK003 15.0 73.4
AKTi 2.0 71.7
MRK003 + AKTi 15.0 + 2.0 42.7 0.752
RAMOS MRK003 15.0 78.6
AKTi 2.0 73.5
MRK003 + AKTi 15.0 + 2.0 41.7 0.188
GRANTA MRK003 20.0 64.4
AKTi 5.0 70.2
MRK003 + AKTi 20.0 + 5.0 23.3 0.586
Open in a new tab

We pre incubated A) MM cell lines or B) lymphoma cell lines with various concentrations of AKTi for 16 hrs followed by treatment with indicated concentrations of MRK003 for 32hrs. We observed synergy when the drugs were used in combination in all the cell lines tested. Concentrations at which maximum synergy were observed are shown in the table. Combination index (CI) values were calculated using the CalcuSyn™ software. CI values <1 indicates synergy.

Discussion

Notch pathway has been implicated in the pathogenesis and progression of different tumors. Expression of the receptors as well as the ligands has been reported in the different tumors studied. In this study we first studied expression levels of notch receptors and their ligands on MM and NHL cell lines. Both MM and NHL cell lines were found to express more than one notch receptor and ligand and the expression was quite heterogeneous. Interestingly, none of the cell lines expressed Jagged1 in the current study in contrast to a prior report (23).

Next, we studied the pre-clinical activity of MRK003, a GSI as an anti-MM and anti-NHL agent in vitro. Our results clearly demonstrated induction of cytotoxcity and inhibition of proliferation in MM and NHL cell lines. Tumor microenvironment plays an essential role in MM disease progression (41). Both cellular and non-cellular components of the microenvironment play important roles in disease progression and resistance to chemotherapy (41). Jagged 1 is abundantly expressed in bone marrow stromal cells and interaction of MM cells with the bone marrow stromal cells could further stimulate the notch pathway.(42). Hence we co-cultured MM cells with MM patient derived BMSCs and incubated with MRK003. MRK003 was able to overcome protective effects of BMSCs and inhibit proliferation of MM cells.

Notch receptors expressed as heterodimers on cell membrane undergoes sequential cleavage and gets converted to shorter activated form of Notch comprising of notch intracellular domain (NICD). By western blots we were able to show that Dohh2 and RPMI8226 cells constitutively express NICD (Figure 4A and 4B). MRK003 was able to inhibit expression of NICD confirming that the drug was able to inhibit notch activation in both NHL and MM cells.

Notch pathway regulates the expression of various proteins, few being tumorigenic and few others being tumor suppressors. Some of the canonical down stream members regulated by notch are Hes1, c-Myc, cyclin D1 and the tumor suppressor p21. We examined expression levels of these proteins post MRK003 treatment. In RPMI8226 cells, c-Myc and p21 were significantly down regulated post MRK003 treatment (Figure 4A). The down regulation of p21 might explain why MRK003 is less potent in inhibiting proliferation in RPMI8226 and its drug resistant variant cell lines Dox40 and LR5 when compared to the apoptotic effects induced by MRK003 in these cell lines as shown in Figures 2A and C. In Dohh2 cells, Hes1, c-Myc and cyclin D1 were down regulated with no observable inhibition of p21 (Figure 4B). p21 expression is known to be regulated by notch proteins. In small cell lung cancers, notch proteins activated p21 and caused growth arrest (43). In MM, notch1 has been found to up regulate p21 expression and induce growth arrest and provide resistance to drug induced apoptosis (21). The ability of MRK003 to inhibit p21 might therefore make the MM cells sensitive to apoptosis induced by other drugs when used in combination. The lack of down regulation of p21 in Dohh2 cells might explain why NHL cells were found to be more sensitive to MRK003.

Examining other signaling pathways implicated in MM and NHL disease biology indicated up-regulation of pAkt levels post drug treatment (Figure 4C and 4D). Notch has been shown to positively regulate mTOR pathway with inhibition of notch leading to down regulation of proteins down stream of mTOR (44). mTORC1 down regulation leads to a mTORC2 mediated feedback up-regulation of pAkt (45). This might explain why pAkt is up-regulated post MRK003 treatment. We therefore examined the effects of using Akti in combination with MRK003 and observed marked synergy in killing both MM and NHL cells (Table 1A and B).

Notch 1 was found to induce expression of several NF-κB proteins, namely p65, p50, RelB and c-Rel (11). In another study, it was found that activated notch (NICD) activates the transcription of NF-κB2 (p100/p52) gene (46). Activation of the NFKB pathway was found to be important for cell adhesion mediated drug resistance in MM cells (47). However, cell bound Jagged 1 was unable to activate notch mediated activation of NF-κB in MM cell line H929 (21). In order to understand if some of the apoptotic effects induced by MRK003 are due to the inhibition of the NF-κB pathway, we examined changes in expression levels of NF-κB observed post MRK003 treatment. We observed that MRK003 did not inhibit p65, p50, p52 or c-Rel with a slight induction of RelB in the MM cell line RPMI8226 (Figure 4E). Induction of RelB might indicate activation of non-canonical NF-κB pathway. In Dohh2 cells, MRK003 caused down regulation of p65 with no observable differences seen in any of the other NF-κB proteins (Figure 4F). These results indicate that notch differentially regulates the NF-κB pathway in different tumor systems.

It is important to note that GSIs have multiple targets apart from notch and this could lead to non-specific effects in vivo. GI toxicity has been observed in mouse models treated with a GSI (48). Combination therapies with sub IC50 doses of GSI might therefore be useful in a clinical setting. Taken together, our studies present pre-clinical evidence for MRK003 as an anti-MM and anti-NHL agent. Clinical trials of Akt inhibitors with notch pathway inhibitors are warranted.

Acknowledgments

We would like to acknowledge Kimberly Henderson, Roberta DeGoey and Steven Zincke for their assistance with processing of tumor cells and all of the patients who provided us with the tumor samples.

Financial Support: This study was supported in part by Hematological Malignancies Program (Mayo Clinic Cancer Center); and CA90628 (SK) from National Cancer Institute.

Footnotes

Conflict of interest: SK: research support from Celgene, Millennium, Novartis, Merck, Cephalon, Genzyme and Bayer. SK: advisory board- Merck.

References

  • 1.Fortini ME. Notch signaling: the core pathway and its posttranslational regulation. Dev Cell. 2009 May;16(5):633–647. doi: 10.1016/j.devcel.2009.03.010. [DOI] [PubMed] [Google Scholar]
  • 2.Blaumueller CM, Qi H, Zagouras P, Artavanis-Tsakonas S. Intracellular cleavage of Notch leads to a heterodimeric receptor on the plasma membrane. Cell. 1997 Jul 25;90(2):281–291. doi: 10.1016/s0092-8674(00)80336-0. [DOI] [PubMed] [Google Scholar]
  • 3.Mumm JS, Kopan R. Notch signaling: from the outside in. Dev Biol. 2000 Dec 15;228(2):151–165. doi: 10.1006/dbio.2000.9960. [DOI] [PubMed] [Google Scholar]
  • 4.Brou C, Logeat F, Gupta N, Bessia C, LeBail O, Doedens JR, et al. A novel proteolytic cleavage involved in Notch signaling: the role of the disintegrin-metalloprotease TACE. Mol Cell. 2000 Feb;5(2):207–216. doi: 10.1016/s1097-2765(00)80417-7. [DOI] [PubMed] [Google Scholar]
  • 5.Mumm JS, Schroeter EH, Saxena MT, Griesemer A, Tian X, Pan DJ, et al. A ligand-induced extracellular cleavage regulates gamma-secretase-like proteolytic activation of Notch1. Mol Cell. 2000 Feb;5(2):197–206. doi: 10.1016/s1097-2765(00)80416-5. [DOI] [PubMed] [Google Scholar]
  • 6.De Strooper B, Annaert W, Cupers P, Saftig P, Craessaerts K, Mumm JS, et al. A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain. Nature. 1999 Apr 8;398(6727):518–522. doi: 10.1038/19083. [DOI] [PubMed] [Google Scholar]
  • 7.Schroeter EH, Kisslinger JA, Kopan R. Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Nature. 1998 May 28;393(6683):382–386. doi: 10.1038/30756. [DOI] [PubMed] [Google Scholar]
  • 8.Iso T, Kedes L, Hamamori Y. HES and HERP families: multiple effectors of the Notch signaling pathway. J Cell Physiol. 2003 Mar;194(3):237–255. doi: 10.1002/jcp.10208. [DOI] [PubMed] [Google Scholar]
  • 9.Palomero T, Lim WK, Odom DT, Sulis ML, Real PJ, Margolin A, et al. NOTCH1 directly regulates c-MYC and activates a feed-forward-loop transcriptional network promoting leukemic cell growth. Proc Natl Acad Sci U S A. 2006 Nov 28;103(48):18261–18266. doi: 10.1073/pnas.0606108103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Rangarajan A, Talora C, Okuyama R, Nicolas M, Mammucari C, Oh H, et al. Notch signaling is a direct determinant of keratinocyte growth arrest and entry into differentiation. EMBO J. 2001 Jul 2;20(13):3427–3436. doi: 10.1093/emboj/20.13.3427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Cheng P, Zlobin A, Volgina V, Gottipati S, Osborne B, Simel EJ, et al. Notch-1 regulates NF-kappaB activity in hemopoietic progenitor cells. J Immunol. 2001 Oct 15;167(8):4458–4467. doi: 10.4049/jimmunol.167.8.4458. [DOI] [PubMed] [Google Scholar]
  • 12.Ronchini C, Capobianco AJ. Induction of cyclin D1 transcription and CDK2 activity by Notch(ic): implication for cell cycle disruption in transformation by Notch(ic) Mol Cell Biol. 2001 Sep;21(17):5925–5934. doi: 10.1128/MCB.21.17.5925-5934.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Pinnix CC, Lee JT, Liu ZJ, McDaid R, Balint K, Beverly LJ, et al. Active Notch1 confers a transformed phenotype to primary human melanocytes. Cancer Res. 2009 Jul 1;69(13):5312–5320. doi: 10.1158/0008-5472.CAN-08-3767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Santagata S, Demichelis F, Riva A, Varambally S, Hofer MD, Kutok JL, et al. JAGGED1 expression is associated with prostate cancer metastasis and recurrence. Cancer Res. 2004 Oct 1;64(19):6854–6857. doi: 10.1158/0008-5472.CAN-04-2500. [DOI] [PubMed] [Google Scholar]
  • 15.Balint K, Xiao M, Pinnix CC, Soma A, Veres I, Juhasz I, et al. Activation of Notch1 signaling is required for beta-catenin-mediated human primary melanoma progression. J Clin Invest. 2005 Nov;115(11):3166–3176. doi: 10.1172/JCI25001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ellisen LW, Bird J, West DC, Soreng AL, Reynolds TC, Smith SD, et al. TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell. 1991 Aug 23;66(4):649–661. doi: 10.1016/0092-8674(91)90111-b. [DOI] [PubMed] [Google Scholar]
  • 17.Aster JC, Pear WS, Blacklow SC. Notch signaling in leukemia. Annu Rev Pathol. 2008;3:587–613. doi: 10.1146/annurev.pathmechdis.3.121806.154300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Breit S, Stanulla M, Flohr T, Schrappe M, Ludwig WD, Tolle G, et al. Activating NOTCH1 mutations predict favorable early treatment response and long-term outcome in childhood precursor T-cell lymphoblastic leukemia. Blood. 2006 Aug 15;108(4):1151–1157. doi: 10.1182/blood-2005-12-4956. [DOI] [PubMed] [Google Scholar]
  • 19.Weng AP, Ferrando AA, Lee W, Morris JPt, Silverman LB, Sanchez-Irizarry C, et al. Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science. 2004 Oct 8;306(5694):269–271. doi: 10.1126/science.1102160. [DOI] [PubMed] [Google Scholar]
  • 20.Lee SY, Kumano K, Nakazaki K, Sanada M, Matsumoto A, Yamamoto G, et al. Gain-of-function mutations and copy number increases of Notch2 in diffuse large B-cell lymphoma. Cancer Sci. 2009 May;100(5):920–926. doi: 10.1111/j.1349-7006.2009.01130.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Nefedova Y, Cheng P, Alsina M, Dalton WS, Gabrilovich DI. Involvement of Notch-1 signaling in bone marrow stroma-mediated de novo drug resistance of myeloma and other malignant lymphoid cell lines. Blood. 2004 May 1;103(9):3503–3510. doi: 10.1182/blood-2003-07-2340. [DOI] [PubMed] [Google Scholar]
  • 22.Zweidler-McKay PA, He Y, Xu L, Rodriguez CG, Karnell FG, Carpenter AC, et al. Notch signaling is a potent inducer of growth arrest and apoptosis in a wide range of B-cell malignancies. Blood. 2005 Dec 1;106(12):3898–3906. doi: 10.1182/blood-2005-01-0355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Jundt F, Probsting KS, Anagnostopoulos I, Muehlinghaus G, Chatterjee M, Mathas S, et al. Jagged1-induced Notch signaling drives proliferation of multiple myeloma cells. Blood. 2004 May 1;103(9):3511–3515. doi: 10.1182/blood-2003-07-2254. [DOI] [PubMed] [Google Scholar]
  • 24.Jundt F, Anagnostopoulos I, Forster R, Mathas S, Stein H, Dorken B. Activated Notch1 signaling promotes tumor cell proliferation and survival in Hodgkin and anaplastic large cell lymphoma. Blood. 2002 May 1;99(9):3398–3403. doi: 10.1182/blood.v99.9.3398. [DOI] [PubMed] [Google Scholar]
  • 25.Nefedova Y, Sullivan DM, Bolick SC, Dalton WS, Gabrilovich DI. Inhibition of Notch signaling induces apoptosis of myeloma cells and enhances sensitivity to chemotherapy. Blood. 2008 Feb 15;111(4):2220–2229. doi: 10.1182/blood-2007-07-102632. [DOI] [PubMed] [Google Scholar]
  • 26.Schwarzer R, Kaiser M, Acikgoez O, Heider U, Mathas S, Preissner R, et al. Notch inhibition blocks multiple myeloma cell-induced osteoclast activation. Leukemia. 2008 Dec;22(12):2273–2277. doi: 10.1038/leu.2008.138. [DOI] [PubMed] [Google Scholar]
  • 27.Rao SS, O'Neil J, Liberator CD, Hardwick JS, Dai X, Zhang T, et al. Inhibition of NOTCH signaling by gamma secretase inhibitor engages the RB pathway and elicits cell cycle exit in T-cell acute lymphoblastic leukemia cells. Cancer Res. 2009 Apr 1;69(7):3060–3068. doi: 10.1158/0008-5472.CAN-08-4295. [DOI] [PubMed] [Google Scholar]
  • 28.Watters JW, Cheng C, Majumder PK, Wang R, Yalavarthi S, Meeske C, et al. De novo discovery of a gamma-secretase inhibitor response signature using a novel in vivo breast tumor model. Cancer Res. 2009 Dec 1;69(23):8949–8957. doi: 10.1158/0008-5472.CAN-09-1544. [DOI] [PubMed] [Google Scholar]
  • 29.Plentz R, Park JS, Rhim AD, Abravanel D, Hezel AF, Sharma SV, et al. Inhibition of gamma-secretase activity inhibits tumor progression in a mouse model of pancreatic ductal adenocarcinoma. Gastroenterology. 2009 May;136(5):1741–1749 e1746. doi: 10.1053/j.gastro.2009.01.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Konishi J, Kawaguchi KS, Vo H, Haruki N, Gonzalez A, Carbone DP, et al. Gamma-secretase inhibitor prevents Notch3 activation and reduces proliferation in human lung cancers. Cancer Res. 2007 Sep 1;67(17):8051–8057. doi: 10.1158/0008-5472.CAN-07-1022. [DOI] [PubMed] [Google Scholar]
  • 31.Ramakrishnan V, Timm M, Haug JL, Kimlinger TK, Wellik LE, Witzig TE, et al. Sorafenib, a dual Raf kinase/vascular endothelial growth factor receptor inhibitor has significant anti-myeloma activity and synergizes with common anti-myeloma drugs. Oncogene. Feb 25;29(8):1190–1202. doi: 10.1038/onc.2009.403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ramakrishnan V, Kimlinger T, Haug J, Timm M, Wellik L, Halling T, et al. TG101209, a novel JAK2 inhibitor, has significant in vitro activity in multiple myeloma and displays preferential cytotoxicity for CD45+ myeloma cells. Am J Hematol. Jun 10; doi: 10.1002/ajh.21785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kumar S, Raje N, Hideshima T, Ishitsuka K, Roccaro A, Shiraishi N, et al. Antimyeloma activity of two novel N-substituted and tetraflourinated thalidomide analogs. Leukemia. 2005 Jul;19(7):1253–1261. doi: 10.1038/sj.leu.2403776. [DOI] [PubMed] [Google Scholar]
  • 34.Raje N, Kumar S, Hideshima T, Ishitsuka K, Chauhan D, Mitsiades C, et al. Combination of the mTOR inhibitor rapamycin and CC-5013 has synergistic activity in multiple myeloma. Blood. 2004 Dec 15;104(13):4188–4193. doi: 10.1182/blood-2004-06-2281. [DOI] [PubMed] [Google Scholar]
  • 35.Kumar S, Witzig TE, Timm M, Haug J, Wellik L, Kimlinger TK, et al. Bone marrow angiogenic ability and expression of angiogenic cytokines in myeloma: evidence favoring loss of marrow angiogenesis inhibitory activity with disease progression. Blood. 2004 Aug 15;104(4):1159–1165. doi: 10.1182/blood-2003-11-3811. [DOI] [PubMed] [Google Scholar]
  • 36.Chou TC, Talalay P. Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul. 1984;22:27–55. doi: 10.1016/0065-2571(84)90007-4. [DOI] [PubMed] [Google Scholar]
  • 37.Patel NS, Li JL, Generali D, Poulsom R, Cranston DW, Harris AL. Up-regulation of delta-like 4 ligand in human tumor vasculature and the role of basal expression in endothelial cell function. Cancer Res. 2005 Oct 1;65(19):8690–8697. doi: 10.1158/0008-5472.CAN-05-1208. [DOI] [PubMed] [Google Scholar]
  • 38.Noguera-Troise I, Daly C, Papadopoulos NJ, Coetzee S, Boland P, Gale NW, et al. Blockade of Dll4 inhibits tumour growth by promoting non-productive angiogenesis. Nature. 2006 Dec 21;444(7122):1032–1037. doi: 10.1038/nature05355. [DOI] [PubMed] [Google Scholar]
  • 39.Kimlinger T, Kline M, Kumar S, Lust J, Witzig T, Rajkumar SV. Differential expression of vascular endothelial growth factors and their receptors in multiple myeloma. Haematologica. 2006 Aug;91(8):1033–1040. [PubMed] [Google Scholar]
  • 40.Kumar S, Witzig TE, Timm M, Haug J, Wellik L, Fonseca R, et al. Expression of VEGF and its receptors by myeloma cells. Leukemia. 2003 Oct;17(10):2025–2031. doi: 10.1038/sj.leu.2403084. [DOI] [PubMed] [Google Scholar]
  • 41.Podar K, Chauhan D, Anderson KC. Bone marrow microenvironment and the identification of new targets for myeloma therapy. Leukemia. 2009 Jan;23(1):10–24. doi: 10.1038/leu.2008.259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Li L, Milner LA, Deng Y, Iwata M, Banta A, Graf L, et al. The human homolog of rat Jagged1 expressed by marrow stroma inhibits differentiation of 32D cells through interaction with Notch1. Immunity. 1998 Jan;8(1):43–55. doi: 10.1016/s1074-7613(00)80457-4. [DOI] [PubMed] [Google Scholar]
  • 43.Sriuranpong V, Borges MW, Ravi RK, Arnold DR, Nelkin BD, Baylin SB, et al. Notch signaling induces cell cycle arrest in small cell lung cancer cells. Cancer Res. 2001 Apr 1;61(7):3200–3205. [PubMed] [Google Scholar]
  • 44.Chan SM, Weng AP, Tibshirani R, Aster JC, Utz PJ. Notch signals positively regulate activity of the mTOR pathway in T-cell acute lymphoblastic leukemia. Blood. 2007 Jul 1;110(1):278–286. doi: 10.1182/blood-2006-08-039883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.O'Reilly KE, Rojo F, She QB, Solit D, Mills GB, Smith D, et al. mTOR inhibition induces upstream receptor tyrosine kinase signaling and activates Akt. Cancer Res. 2006 Feb 1;66(3):1500–1508. doi: 10.1158/0008-5472.CAN-05-2925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Oswald F, Liptay S, Adler G, Schmid RM. NF-kappaB2 is a putative target gene of activated Notch-1 via RBP-Jkappa. Mol Cell Biol. 1998 Apr;18(4):2077–2088. doi: 10.1128/mcb.18.4.2077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Landowski TH, Olashaw NE, Agrawal D, Dalton WS. Cell adhesion-mediated drug resistance (CAM-DR) is associated with activation of NF-kappa B (RelB/p50) in myeloma cells. Oncogene. 2003 Apr 24;22(16):2417–2421. doi: 10.1038/sj.onc.1206315. [DOI] [PubMed] [Google Scholar]
  • 48.Wong GT, Manfra D, Poulet FM, Zhang Q, Josien H, Bara T, et al. Chronic treatment with the gamma-secretase inhibitor LY-411,575 inhibits beta-amyloid peptide production and alters lymphopoiesis and intestinal cell differentiation. J Biol Chem. 2004 Mar 26;279(13):12876–12882. doi: 10.1074/jbc.M311652200. [DOI] [PubMed] [Google Scholar]

RESOURCES