Abstract
Background and Objectives
Carbapenem resistant A. baumannii is an emerging cause of nosocomial infections. The aims of this study were identification of the most prevalent of carbapenem resistant genes, molecular typing and antimicrobial evaluation of A.baumannii in intensive care units.
Materials and Methods
Two hundred and six A. baumannii were isolated from tracheal tube discharge of hospitalized patients at different intensive care units in Ahvaz, Iran. Antimicrobial susceptibility test was done on all isolates. Multiplex and singleplex PCR were performed for detection of blaOXA-23-like, blaOXA-24-like, blaOXA-51-like, blaOXA-58-like, blaVIM, blaIMP, blaSPM and blaNDM genes. Genetic relationship of all isolates was determined by REP-PCR method.
Results
Out of 206 examined isolates, 198 (96.1%) isolates were resistant to imipenem and meropenem. However 3.9% isolates were sensitive to these antibiotics. The blaOXA-23-like and blaOXA-24-like genes were detected in 85% and 8.7% of strains, respectively. No blaOXA-58- like, blaIMP, blaVIM, blaSPM and blaNDM were detected. REP-PCR results showed that isolates were belonged to five genotypes: Genotype A was the most prevalent (P- value < 0.001): it was observed in 75 of 206 strains (36.4%). Genotype B, and C were found in 28.6% and 27.7%, respectively. The rate of other genotypes was as follows: D (2.4%), E (1%).
Conclusion
Based on the obtained results, the rate of carbapenem resistance was high among of A. baumannii which was isolated from intensive care units patients and oxacillinase genes were the most prevalent carbapenem resistant genes. These results revealed that three clones, A, B and C of A.baumannii are common in our hospitals.
Keywords: Acinetobacter baumannii, Carbapenem resistant, Intensive Care Units
INTRODUCTION
Acinetobacter baumannii has been recognized over the last decades as a major pathogen that responsible for severe infections, especially in the Intensive Care Units (ICU) patients (1, 2). Ventilator-associated pneumonia (VAP) occurs in critically ill patients who admitted to ICU and A.baumannii frequently isolated in respiratory specimens of these patients (2, 3). VAP complications are increased mortality rate, prolonged hospitalization and high medical costs (4, 5). Although, previously, most of A.baumannii isolates were sensitive to carbapenems, and imipenem was the gold standard treatment for A.baumannii pneumonia (1, 5), widespread use of carbapenems has led to an emergence of resistant strains (6). Nowadays, carbapenem resistant A. baumannii (CRAB) has been reported worldwide, and it has became a global problem (7). In addition, an important concern is nosocomial infection causing by multidrug resistant A. baumannii (MDRAB) isolates (8). Due to increasing resistance, selection of an appropriate therapeutic option is difficult (9). The main mechanisms of carbapenem resistance in A. baumannii, is the production of carbapenem-hydrolyzing enzymes, mostly OXA types carbapenemases such as blaOXA-23-like, blaOXA-24-like, blaOXA-58-like and blaOXA-143-like and less common by metallo-β-lactamases (7, 10). In order to control and prevention of spread of resistant isolates, it is necessary to use a molecular method for typing of MDRAB A. Baumannii (8). Because no study has been performed independently solely on A. baumannii tracheal isolates in Ahvaz, this study was planned with the following objectives: (i) to study the antimicrobial susceptibility pattern (ii) to identify the most prevalent OXA types and metallo-β-lactamase genes and (iii) To characterize clonal relationship among A. baumannii isolates collected from the tracheal tube discharge in Ahvaz, south west of Iran using repetitive sequence-based polymerase chain reaction (REP-PCR).
MATERIALS AND METHODS
Bacterial isolates
This study was conducted at the 8 ICUs of 2 teaching hospitals, Imam Khomeyni and Golestan, associated to Ahvaz Jundishapur University of Medical Sciences from March 2010 to November 2012. A total of 206 A. baumannii isolates were collected from a tracheal tube discharge of ICUs patients which were colonized or infected by these bacteria. The patients were hospitalized in ICU sections such as: ICU internal, surgery, A & B, neurosurgical ICU (NSICU), general 1, general 2, cardiovascular ICU (CVICU). Initial identifications of A. baumannii were performed using standard laboratory tests(11).
Antimicrobial susceptibility test
All isolates were subjected to antimicrobial susceptibility testing by standard disk diffusion method according to Clinical and Laboratory Standard Institute (CLSI) guidelines (12). The tested antimicrobial agents were as follows: imipenem 10 μg, meropenem 10 μg, polymyxin B 300 unit, gentamicin 10 μg, ceftriaxone 30 μg, colistin 10 μg, piperacillin 100 μg, piperacillin-tazobactam 100/10 μg, cefepime 30 μg tobramycin 10 μg, tigecyclin15 μg, amikacin 30 μg, tetracycline 30 μg, ciprofloxacin 5 μg, trimethoprim-sulfamethoxazole 1.25/23.75 μg, ceftazidime 30μg, rifampin 5 μg, aztreonam 30 μg and ampicillin-sulbactam (10/10 μg), (MAST, Group Ltd, Merseyside, UK). Reference strains include Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 were used for quality control testing (12). The results of disk diffusion were interpreted by CLSI. The US Food and Drug Administration-approved criteria for enterobacteriaceae used for tigecycline breakpoint (13).
Extraction of DNA
DNA was extracted by phenol–chloroform method with some modification. After growth of bacteria on Mueller-Hinton’s agar plates, 2 or 3 colonies were suspended in 180 μl of distilled water. Then, 20 μl of proteinase K (1 mg/ml) was added and after adding 200 μl of buffer solution (0.5% SDS, 0.005 M EDTA and 0.01 M Tric-Cl, pH 7.8) mixture was incubated at 55°C for 2 hours. Then 200 μl of phenol and 200 μl of chloroform was added and gently mixed. After centrifugation at 11000 rpm for 5 minutes at 4°C, the supernatant was collected and transferred to a new tube carefully. To precipitate of DNA, 50 μl of ammonium acetate 7.5 M and 200 μl of absolute ethanol were added. DNA was removed and transferred to a new tube. After washing three times with 70% ethanol, DNA was placed at 30°C overnight. Dried DNA was dissolved in 100 μl of TE buffer(14). The DNA purity of extracted was measured by photobiometer (Eppendorf, Germany) in 260/280 nm UV long waves.
Detection of blaOXA-51-like
To confirm the identity of A. baumannii, blaOXA-51-like gene was sought by PCR assay using specific primers listed in Table 1(15). To amplify this gene, each reaction was carried out in a final volume of 25 μl containing 1x PCR buffer, 1U Taq polymerase, 1.5 mM MgCl2, 200 μM of dNTP (CinnaGen, Iran), 10 pmol of each primer (Eurofins MWG Operon, Germany) and 1 μl of extracted DNA. Amplification conditions were programmed in Mastercycler Eppendorf (Eppendorf, Germany) as follows: Initial denaturation at 94°C for 3 min; 35 cycles of 94°C for 45 s, annealing 57°Cfor 45 s, extension 72°C for 1min and final extension 72°C for 5 min. PCR products were separated on 1.5% agarose gel (CinnaGen, Iran) by electrophoresis, stained with ethidium bromide (CinnaGen, Iran) and then visualized under UV gel documentation system. A. baumannii NCTC 12156 (ATCC 19606) was used as positive control. A negative control was included in each PCR reaction, containing all components except the DNA template which was replaced by distilled water (15, 16).
Table 1.
Primers sequences used in this study.
| Primer name | Sequence ( 5’-3’) | Amplicon size ( bp) | Reference |
|---|---|---|---|
| blaOXA-51- like - F | TAATGCTTTGATCGGCCTTG | 353 | (16) |
| blaOXA-51- like -R | TGGATTGCACTTCATCTTGG | ||
| blaOXA-23- like-F | GATCGGATTGGAGAACCAGA | 501 | |
| blaOXA-23- like-R | ATTTCTGACCGCATTTCCAT | ||
| blaOXA-24- like-F | GGTTAGTTGGCCCCCTTAAA | 249 | |
| blaOXA-24- like-R | AGTTGAGCGAAAAGGGGATT | ||
| blaOXA-58- likeF | AAGTATTGGGGCTTGTGCTG | 599 | |
| blaOXA-58- like-R | CCCCTCTGCGCTCTACATAC | ||
| blaIMP-F | TCGTTTGAAGAAGTTAACGG | 568 | (18) |
| blaIMP-R | ATGTAAGTTTCAAGAGTGATGC | ||
| blaVIM-F | GGTGTTTGGTCGCATATCGCAA | 502 | |
| blaVIM-R | ATTCAGCCAGATCGGCATCGGC | ||
| blaNDM- F | GGTTTGGCGATCTGGTTTTC | 624 | (17) |
| blaNDM-R | CGGAATGGCTCATCACGATC | ||
| blaSPM-F | AAAATCTGGGTACGCAAACG | 271 | |
| blaSPM-R | ACATTATCCGCTGGAACAGG | ||
| REP-1 | IIIGCGCCGICATCAGGC | (19) | |
| REP-2 | ACGTCTTATCAGGCCTAC |
Multiplex PCR for detection of oxacillinase genes
blaOXA-23-like, blaOXA-24-like and blaOXA-58-like were sought for all isolates by multiplex PCR according to protocol as described previously (15). Each PCR reaction was performed in a final volume of 25 μl with 1x PCR buffer, 1U Taq polymerase, 2 mM MgCl2, 200 μM of dNTP (CinnaGen, Iran), 0.2 μM of each primer (TAG, Copenhagen A/S Denmark) and 1 μl of template DNA. PCR conditions were programmed in Mastercycler Eppendorf (Eppendorf, Germany) as follows: Initial denaturation at 94°C for 5 min; followed by 30cycles at 94°C for 30 s, 53°C for 40 s and 72°C for 50s and final extension at 72°C for 6 min. PCR products were separated with electrophoresis on 1.5% agarose gel (Cinna Gen, Iran) and after staining with ethidium bromide, visualized under UV gel documentation system. A. baumannii reference strains including NCTC 13304, NCTC 13302, NCTC 13305 used as positive control for blaOXA-23-like, blaOXA-24-like and blaOXA-58-like, respectively (15).
Detection of metallo ß-lactamase genes
he presence of different metallo ß-lactamase encoding genes such as: blaIMP, blaVIM, blaSPM and blaNDM were investigated by PCR with specific primers that were listed in (Table 1) and protocol from two previous studies (16, 17).
REP-PCR
In order to determine genetic relationship of carbapenem resistant A.baumannii, REP-PCR was carried out on all isolates with specific primers previously described (18) and are listed in (Table 1). Amplification condition was performed based on the method of Bou et al. with some modifications (14). Each reaction mixture was done in volume of 25 μl with 1x PCR buffer, 3.5 mM of MgCl2, 300 μM of dNTP, 3% DMSO (Cinna Gen, Iran), 0.5 μM of each primer (TAG, Copenhagen A/S Denmark), and 1U of Taq polymerase and 1 μl of genomic DNA. PCR conditions were as follows: 94°C for 10 min; 30 cycles of 94°C for 1 min, annealing temperatures 45°C for 1 min and 72°C for 2 min and 72°C for 16 min. Products were separated with electrophoresis on 1.2% agarose gel (CinnaGen, Iran); after staining with ethidium bromide, they were visualized under UV gel documentation system; then they were photographed and compared together with visual inspection (14). All fingerprints were observed by one observer. Fingerprints were interpreted according to previous studies (18, 19).
Statistical analysis
The results were analyzed using the SPSS version 16 to obtain frequencies and comparison among clones. Non parametric Chi-square test was used (X2 = 156.6, df = 5). A P-value < 0.001 was considered statistically significant.
RESULTS
Bacterial isolates and antimicrobial susceptibility pattern
The rates of isolation from different wards were as follows: ICU Internal (41.3%), Surgery (14.1%), B (13.1%), Neurosurgical Intensive Care Unit NICU (9.2%), A (7.8%), General 1 (5.3%), General 2 (7.8%), Cardiovascular Intensive Care Unit (CVICU) (1.5%). All 206 studied isolates contained blaOxa-51-like gene and were known as A. baumannii. All isolates (100%) were susceptible to colistin and polymyxin B. Maximum resistance rate was observed for aztreonam and rifampin with 98.5% and 98.1%, respectively. The rate of resistance to antimicrobial agents is shown in Table 2.
Table 2.
The results of antibiogram test for A.baumannii isolates.
| Antibiotic | |||
|---|---|---|---|
| Sensitive (%) | Intermediate (%) | Resistant (%) | |
| Imipenem 10 μg | 8 (3.9) | - | 198(96.1) |
| Meropenem 10 μg | 8 (3.9) | - | 198 (96.1) |
| Ceftazidime 30 μg | 7 (3.4) | 1 (0.5) | 198 (96.1) |
| Cefepime 30 μg | 8 (3.9) | - | 198 (96.1) |
| Ceftriaxone 30 μg | 1 (0.5) | 7 (3.4) | 198 (96.1) |
| Colistin 10 μg | 206 (100) | 0 | 0 |
| Piperacillin 100 μg | 6 (2.9) | 1 (0.5) | 199 (96.6) |
| Piperacillin-tazobactam 100/10 μg | 8 (3.9) | 0 | 198 (96.1) |
| Polymyxin B 300 unit | 206 (100) | 0 | 0 |
| Gentamicin 10 μg | 33 (16) | 2 (1) | 171 (83) |
| Tobramycin 10 μg | 44( 21.4) | 0 | 162 (78.6) |
| Amikacin 30 μg | 13 (6.3) | 10 (4.9) | 183 (88.8) |
| Tetracycline 30 μg | 15 (7.3) | 16 (7.8) | 175 (85) |
| Ampicillin-sulbactam 10/10 μg | 34 (16.5) | 29 (14.1) | 143 (69.4) |
| Ciprofloxacin 5 μg | 7 (3.4) | 0 | 199 (96.6) |
| Trimethoprim-sulfamethoxazole 1.25/23.75 μg | 16 (7.8) | 5 (2.4) | 185 (89.8) |
| Rifampin 5 μg | 0 | 4 (1.9) | 202 (98.1) |
| Aztreonam 30 μg | 0 | 3 (1.5) | 203 (98.5) |
| Tigecycline 15 μg | 13 (6.3) | 66 (32) | 127 (61.7) |
Detection of Oxacillinase and Metallo-β-lactamase
Results of multiplex PCR showed the blaOXA-23-likeand blaOXA-24-like genes were detected in 85% and 8.7%, respectively (Fig. 1). Six isolates were carbapenem resistant but these isolates were negative for blaOXA-23-like, blaOXA-24-like, blaOXA-58-like and studied metallo-β-lactamase genes. No blaOXA-58-like, blaIMP, blaVIM, blaSPM and blaNDM were detected. blaOXA-23-like, blaOXA-24-likeand blaOXA-58-likeblaIMP, blaVIM, blaSPM and blaNDM were not detected in carbapenem susceptible A. baumannii (CSAB) isolates.
Fig. 1.
Electrophoresis results of multiplex PCR. Lanes 1 and 14: 100bp DNA ladder. Lanes 2, 7, 8: isolates with blaOXA-24-like in 249 bp. Lanes 3, 4, 5, 9 & 10: isolates with blaOXA-23-like in 501 bp. Lanes 6 & 11 isolates that are negative for blaOXA-23-like, blaOXA-24-like and blaOXA-58-like. Lane 12 negative control (distilled water ) and lane 13 Positive control (A. baumannii NCTC 13304, NCTC 13302, NCTC 13305 used as positive control for blaOXA-23-like, blaOXA-24-like and blaOXA-58-like respectively.
REP-PCR
To determine the genetic relationship, all isolates were analyzed by REP-PCR. According to the REP-PCR results, carbapenem resistant isolates were grouped into five clones. The first prevalent genotype was named genotype A and was observed in 75 (36.4%) of 206 isolates (P- value < 0.001), thereafter 59 isolates (28.6%) and 57 isolates (27.7%) belonged to genotypes B and C, respectively, (Fig. 2). The rates of other genotypes were as follows: D: 5 (2.4%), E: 2 (1%). All clones were distributed throughout the study period. Albeit blaOXA-23-like was found in all clones, blaOXA-24-like was seen only in clones A, B, C and D, but clones E was negative for this gene. Eight isolates (3.9%) were carbapenem susceptible and showed different REP pattern from each other. Frequency of each clone in different ICUs was presented in Table 3.
Fig. 2.
Electrophoresis of REP-PCR products for three major clone of CRAB. Double fingerprints have been shown for each isolate. Lanes 1, 6 , 11, 1 kb DNA ladder. Lanes 2, 3 (clone A), lanes 4, 5 (clone B), lanes 7, 8 (clone C), Lane 9, negative control and lane 10, A. baumanniiNCTC 12156 (ATCC 19606).
Table 3.
Frequency of each clone of carbapenem resistant and carbapenems susceptible isolates in different ICUs.
| ICU | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Clone | Internal | Surgery | A | B | NICUa | General 1 | General 2 | CVICUb | Total |
| A | 36 | 7 | 5 | 9 | 6 | 1 | 9 | 2 | 75 |
| B | 31 | 10 | 1 | 3 | 4 | 6 | 3 | 1 | 59 |
| C | 11 | 8 | 9 | 14 | 8 | 4 | 3 | 0 | 57 |
| D | 2 | 2 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
| E | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
| Sensitive | 4 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 8 |
| Total | 85 | 29 | 16 | 27 | 19 | 11 | 16 | 3 | 206 |
Neurosurgical ICU
Cardiovascular ICU
DISCUSSION
A. baumannii is the third causative agent of infection at ICUs patients with mortality rates of 26-68% (20). Increasing rate of carbapenems resistant A. baumannii is an important concern (7). Production of Class D oxacillinase which is distributed worldwide is the main mechanism of resistance to carbapenems in this organism. The major carbapenemase genes involved in carbapenem resistance are blaOXA-23-like, blaOXA-24-like, blaOXA-58-likeand blaOXA-143-like. The blaOXA-51-likegenes are located in chromosome of all A. baumannii strains and are intrinsic to this species (1, 21, 22). In sporadic case or hospital outbreaks of imipenem-resistant, OXA producing A. baumannii has been described worldwide (1). Distribution of OXA genes is variable. The rate of blaOXA-23-likehas been reported from 31% to 94% in different parts of the world (8,10,23-25). Our result for blaOxa-23-like(85%) is in the reported ranges. We found 8.7% of isolates were positive for blaOxa-24-like. However, the prevalence rate of this gene has been shown previously from 0 to 85.43% (6,10,16-24). Despite some authors reported blaOXA-58-likefrom 2% to 84.92% in A. Baumannii (8, 23, 25, 26) but we did not find any blaOXA-58-likegene in accordance with previous studies (6, 10, 24). Interestingly, we identified 6 isolates that were resistant to imipenem and meropenem that possessed only the intrinsic blaOXA-51-like, but other investigated genes were negative. Resistance to carbapenems in these isolates may be in related to other mechanisms including decreased permeability, alteration of penicillin-binding proteins, AmpC stable derepression and overexpression of efflux pump (27). In A. baumannii, metallo-β-lactamase genes such as: blaIMP, blaVIM, blaSPM and blaNDM, have been reported sporadically (28-32) but we did not find any of these genes in our isolates. Similar to our results, negative finding for blaIMP, blaVIM blaSPM and blaNDM has been reported by some authors (6, 8, 24, 33). REP-PCR revealed three main genotypes are present in our hospitals and 92.7% of isolates belonged to three genotypes A, B and C. Nosocomial outbreaks of carbapenem resistant A. baumannii were reported worldwide and in most cases one or two epidemic isolates were involved (34) and certain clones are disseminated in the hospitals (8, 24, 35). Since, the majority of our isolates belonged to three main genotypes, it is possible that cross-transmission with similar organisms has been occurred between patients. Therefore, it seems that these clones are circulating in our hospitals. Yan et al. reported that multidrug resistant A. baumannii from same genotype can be transferred between hospitals and even cities (8). Albeit blaOxa-23-like was found among all resistant clones, interestingly only genotypes A, B, C and D were positive for blaOxa-24-like and this gene was negative in genotypes E. Of note, each sensitive isolates had unique REP-PCR patterns that were different from carbapenem resistant isolates and it is assumed that probable source of this isolates were outside of the studied hospitals. However, it has been reported that carbapenem susceptible isolates may have highly similar or different REP pattern from the carbapenem resistant isolates (35). Our finding revealed that in addition to carbapenems, the rates of resistance to other antimicrobial agents were high. Dizbay et al. 2008 in Turkey studied on susceptibility pattern of 66 isolates of A. baumannii collected from endotracheal aspirate and found resistance rate to imipenem, and meropenem was 80.3% and 71.2%, respectively. Different rate of resistance to other tested antibiotics were reported by Dizbay et al. (9). The rates of resistance to all antimicrobial agents in our study are higher than reported by Dizbay et al.
In conclusion, REP-PCR revealed that three main genotypes involved in the two studied hospitals. In order to prevent the spread of resistant isolates between different wards and patients, we suggest it is necessary to monitor and improve infection-control procedures. Although the research was carefully performed and was reached its aims, but there was one limitation. In our study, difference between colonization and infection was not clear and it suggested that in future studies this subject be surveyed.
Acknowledgments
This study was granted an approved research plan (NO.90126) and was financially supported by deputy vice-chancellor for research affairs of Ahvaz Jundishapur University of Medical Sciences, and Infectious & Tropical Disease Research Center, and we thank all of them. We acknowledge especially Research Consultation Center (RCC) for technical support.
References
- 1.Kempf M, Rolain JM. Emergence of resistance to carbapenems in Acinetobacter baumannii in Europe: clinical impact and therapeutic options. Int J Antimicrob Agents. 2012;39:105–114. doi: 10.1016/j.ijantimicag.2011.10.004. [DOI] [PubMed] [Google Scholar]
- 2.Peymani A, Higgins PG, Nahaei MR, Farajnia S, Seifert H. Characterisation and clonal dissemination of OXA-23-producing Acinetobacter baumannii in Tabriz, northwest Iran. Int J Antimicrob Agents. 2012;39:526–528. doi: 10.1016/j.ijantimicag.2012.02.014. [DOI] [PubMed] [Google Scholar]
- 3.Garnacho-Montero J, Ortiz-Leyba C, Fernandez-Hinojosa E, Aldabo-Pallas T, Cayuela A, Marquez-Vacaro JA, et al. Acinetobacter baumannii ventilator-associated pneumonia: epidemiological and clinical findings. Intensive Care Med. 2005;31:649–655. doi: 10.1007/s00134-005-2598-0. [DOI] [PubMed] [Google Scholar]
- 4.Joseph NM, Sistla S, Dutta TK, Badhe AS, Parija SC. Ventilator-associated pneumonia: role of colonizers and value of routine endotracheal aspirate cultures. Int J Infect Dis. 2010;14:723–729. doi: 10.1016/j.ijid.2010.02.2248. [DOI] [PubMed] [Google Scholar]
- 5.Shete VB, Ghadage DP, Muley VA, Bhore AV. Multi-drug resistant Acinetobacter ventilator-associated pneumonia. Lung India. 2010;27:217–220. doi: 10.4103/0970-2113.71952. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Manageiro V, Jones-Dias D, Ferreira E, Louro D, Canica M. Genetic diversity and clonal evolution of carbapenem-resistant Acinetobacter baumannii isolates from Portugal and the dissemination of ST118. Int J Antimicrob Agents. 2012;40:398–403. doi: 10.1016/j.ijantimicag.2012.06.013. [DOI] [PubMed] [Google Scholar]
- 7.Lee HY, Chen CL, Wang SB, Su LH, Chen SH, Liu SY, et al. Imipenem heteroresistance induced by imipenem in multidrug-resistant Acinetobacter baumannii: mechanism and clinical implications. Int J Antimicrob Agents. 2011;37:302–308. doi: 10.1016/j.ijantimicag.2010.12.015. [DOI] [PubMed] [Google Scholar]
- 8.Yan ZQ, Shen DX, Cao JR, Chen R, Wei X, Liu LP, et al. Susceptibility patterns and molecular epidemiology of multidrug-resistant Acinetobacter baumannii strains from three military hospitals in China. Int J Antimicrob Agents. 2010;35:269–73. doi: 10.1016/j.ijantimicag.2009.10.016. [DOI] [PubMed] [Google Scholar]
- 9.Dizbay M, Altuncekic A, Sezer BE, Ozdemir K, Arman D. Colistin and tigecycline susceptibility among multidrug-resistant Acinetobacter baumannii isolated from ventilator-associated pneumonia. Int J Antimicrob Agents. 2008;32:29–32. doi: 10.1016/j.ijantimicag.2008.02.016. [DOI] [PubMed] [Google Scholar]
- 10.Irfan S, Turton JF, Mehraj J, Siddiqui SZ, Haider S, Zafar A, et al. Molecular and epidemiological characterisation of clinical isolates of carbapenem-resistant Acinetobacter baumannii from public and private sector intensive care units in Karachi, Pakistan. J Hosp Infect. 2011;78:143–148. doi: 10.1016/j.jhin.2011.01.029. [DOI] [PubMed] [Google Scholar]
- 11.Winn W, Allen S, Janda W, Koneman E, Procop G, Schreckenberger P, Woods G. Koneman‘s Color Atlas and Textbook of Diagnostic microbiology. 6. Lippincott Williams & Wilkins; Philadelphia: 2006. [Google Scholar]
- 12.Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing: 21th informational supplement. CLSI document M100-S21. CLSI; Wayne, Pa: 2011. [Google Scholar]
- 13.Wyeth Pharmaceuticals. Tygacil (tigecycline) for injection [Package insert] Wyeth Pharmaceuticals Inc; Philadelphia, PA: 2005. [Google Scholar]
- 14.Bou G, Cervero G, Dominguez MA, Quereda C, Martinez-Beltran J. PCR-based DNA fingerprinting (REP-PCR, AP-PCR) and pulsed-field gel electrophoresis characterization of a nosocomial outbreak caused by imipenem- and meropenem-resistant Acinetobacter baumannii. Clin Microbiol Infect. 2000;6:635–643. doi: 10.1046/j.1469-0691.2000.00181.x. [DOI] [PubMed] [Google Scholar]
- 15.Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents. 2006;27:351–3. doi: 10.1016/j.ijantimicag.2006.01.004. [DOI] [PubMed] [Google Scholar]
- 16.Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis. 2011;70:119–123. doi: 10.1016/j.diagmicrobio.2010.12.002. [DOI] [PubMed] [Google Scholar]
- 17.Zong Z, Lu X, Valenzuela JK, Partridge SR, Iredell J. An outbreak of carbapenem-resistant Acinetobacter baumannii producing OXA-23 carbapenemase in western China. Int J Antimicrob Agents. 2008;31:50–4. doi: 10.1016/j.ijantimicag.2007.08.019. [DOI] [PubMed] [Google Scholar]
- 18.Martin-Lozano D, Cisneros JM, Becerril B, Cuberos L, Prados T, Ortiz-Leyba C, et al. Comparison of a repetitive extragenic palindromic sequence-based PCR method and clinical and microbiological methods for determining strain sources in cases of nosocomial Acinetobacter baumannii bacteremia. J Clin Microbiol. 2002;40:4571–4575. doi: 10.1128/JCM.40.12.4571-4575.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Snelling AM, Gerner-Smidt P, Hawkey PM, Heritage J, Parnell P, Porter C, et al. Validation of use of whole-cell repetitive extragenic palindromic sequence-based PCR (REP-PCR) for typing strains belonging to the Acinetobacter calcoaceticus-Acinetobacter baumannii complex and application of the method to the investigation of a hospital outbreak. J Clin Microbiol. 1996;34:1193–1202. doi: 10.1128/jcm.34.5.1193-1202.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Nomanpour B, Ghodousi A, Babaei A, Abtahi H, Tabrizi M, Feizabadi M. Rapid, cost-effective, sensitive and quantitative detection of Acinetobacter baumanniifrom pneumonia patients. IranJ microbiol. 2011;3:162–9. [PMC free article] [PubMed] [Google Scholar]
- 21.D’Arezzo S, Principe L, Capone A, Petrosillo N, Petrucca A, Visca P. Changing carbapenemase gene pattern in an epidemic multidrug-resistant Acinetobacter baumannii lineage causing multiple outbreaks in central Italy. J Antimicrob Chemother. 2011;66:54–-61. doi: 10.1093/jac/dkq407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Feizabadi MM, Fathollahzadeh B, Taherikalani M, Rasoolinejad M, Sadeghifard N, Aligholi M, et al. Antimicrobial susceptibility patterns and distribution of blaOXA genes among Acinetobacter spp. Isolated from patients at Tehran hospitals. Jpn J Infect Dis. 2008;61:274–278. [PubMed] [Google Scholar]
- 23.Touati M, Diene SM, Racherache A, Dekhil M, Djahoudi A, Rolain JM. Emergence of blaOXA-23 and blaOXA-58 carbapenemase-encoding genes in multidrug-resistant Acinetobacter baumannii isolates from University Hospital of Annaba, Algeria. Int J Antimicrob Agents. 2012;40:89–91. doi: 10.1016/j.ijantimicag.2012.03.017. [DOI] [PubMed] [Google Scholar]
- 24.Carvalho KR, Carvalho-Assef AP, Peirano G, Santos LC, Pereira MJ, Asensi MD. Dissemination of multidrug-resistant Acinetobacter baumannii genotypes carrying bla(OXA-23) collected from hospitals in Rio de Janeiro, Brazil. Int J Antimicrob Agents. 2009;34:25–8. doi: 10.1016/j.ijantimicag.2008.12.009. [DOI] [PubMed] [Google Scholar]
- 25.Ergin A, Hascelik G, Eser OK. Molecular characterization of oxacillinases and genotyping of invasive Acinetobacter baumannii isolates using repetitive extragenic palindromic sequence-based polymerase chain reaction in Ankara between 2004 and 2010. Scand J Infect Dis. 2013;45:26–31. doi: 10.3109/00365548.2012.708782. [DOI] [PubMed] [Google Scholar]
- 26.Ben RJ, Yang MC, Hsueh JC, Shiang JC, Chien ST. Molecular characterisation of multiple drug-resistant Acinetobacter baumannii isolates in southern Taiwan. Int J Antimicrob Agents. 2011;38:403–408. doi: 10.1016/j.ijantimicag.2011.05.014. [DOI] [PubMed] [Google Scholar]
- 27.Kulah C, Mooij MJ, Comert F, Aktas E, Celebi G, Ozlu N, et al. Characterisation of carbapenem-resistant Acinetobacter baumannii outbreak strains producing OXA-58 in Turkey. Int J Antimicrob Agents. 2010;36:114–118. doi: 10.1016/j.ijantimicag.2010.03.017. [DOI] [PubMed] [Google Scholar]
- 28.Hrabak J, Stolbova M, Studentova V, Fridrichova M, Chudackova E, Zemlickova H. NDM-1 producing Acinetobacter baumannii isolated from a patient repatriated to the Czech Republic from Egypt, July 2011. Euro Surveill. 2012;17:1–3. [PubMed] [Google Scholar]
- 29.Peymani A, Nahaei MR, Farajnia S, Hasani A, Mirsalehian A, Sohrabi N, et al. High prevalence of metallo-beta-lactamase-producing Acinetobacter baumannii in a teaching hospital in Tabriz, Iran. Jpn J Infect Dis. 2011;64:69–71. [PubMed] [Google Scholar]
- 30.Karthikeyan K, Thirunarayan MA, Krishnan P. Coexistence of blaOXA-23 with blaNDM-1 and armA in clinical isolates of Acinetobacter baumannii from India. J Antimicrob Chemother. 2010;65:2253–2254. doi: 10.1093/jac/dkq273. [DOI] [PubMed] [Google Scholar]
- 31.Mohamed NM, Raafat D. Phenotypic and Genotypic Detection of Metallo-beta-lactainases in Imipenem-resistant Acinetobacter baumannii Isolated from a Tertiary Hospital in Alexandria, Egypt. Res J Microbiol. 2011;6:750–760. [Google Scholar]
- 32.Shahcheraghi F, Abbasalipour M, Feizabadi M, Ebrahimipour G, Akbari N. Isolation and genetic characterization of metallo-β-lactamase and carbapenamase producing strains of Acinetobacter baumannii from patients at Tehran Hospitals. Iran J Microbiol. 2011;3:68–74. [PMC free article] [PubMed] [Google Scholar]
- 33.Netsvyetayeva I, Sikora M, Golas M, SwobodaKopec E, de Walthoffen SW, Dembicka O, et al. Acinetobacter baumannii multidrug-resistant strain occurrence in liver recipients with reference to other high-risk groups. Transplant Proc. 2011;43:3116–3120. doi: 10.1016/j.transproceed.2011.07.008. [DOI] [PubMed] [Google Scholar]
- 34.Zarrilli R, Giannouli M, Tomasone F, Triassi M, Tsakris A. Carbapenem resistance in Acinetobacter baumannii: the molecular epidemic features of an emerging problem in health care facilities. J Infect Dev Countries. 2009;3:335–341. doi: 10.3855/jidc.240. [DOI] [PubMed] [Google Scholar]
- 35.Huang L, Sun L, Xu G, Xia T. Differential susceptibility to carbapenems due to the AdeABC efflux pump among nosocomial outbreak isolates of Acinetobacter baumannii in a Chinese hospital. Diagn Microbiol Infect Dis 2008. 2008;62:326–332. doi: 10.1016/j.diagmicrobio.2008.06.008. [DOI] [PubMed] [Google Scholar]