Skip to main content
Iranian Journal of Microbiology logoLink to Iranian Journal of Microbiology
. 2014 Oct;6(5):335–340.

Development and evaluation of a Quadruplex Taq Man real-time PCR assay for simultaneous detection of clinical isolates of Enterococcus faecalis, Enterococcus faecium and their vanA and vanB genotypes

Taghi Naserpour Farivar 1, Reza Najafipour 1,*, Pouran Johari 1, Masoumeh Aslanimehr 1, Amir Peymani 1, Hoasan Jahani Hashemi 1, Baman Mirzaui 1
PMCID: PMC4385574  PMID: 25848524

Abstract

Background and Objectives

We developed and evaluated the utility of a quadruplex Taqman real-time PCR assay that allows simultaneous identification of vancomycin-resistant genotypes and clinically relevant enterococci.

Materials and Methods

The specificity of the assay was tested using reference strains of vancomycin-resistant and susceptible enterococci. In total, 193 clinical isolates were identified and subsequently genotyped using a Quadruplex Taqman real-time PCR assay and melting curve analysis. Representative Quadruplex Taqman real-time PCR amplification curve were obtained for Enterococcus faecium, Enterococcus faecalis, vanA-containing E. faecium, vanB-containing E. faecalis.

Results

Phenotypic and genotypic analysis of the isolates gave same results for 82 enterococcal isolates, while in 5 isolates, they were inconsistent. We had three mixed strains, which were detected by the TaqMan real-time PCR assay and could not be identified correctly using phenotypic methods.

Conclusion

Vancomycin resistant enterococci (VRE) genotyping and identification of clinically relevant enterococci were rapidly and correctly performed using TaqMan real-time multiplex real-time PCR assay.

Keywords: Enterococci, Vancomycin, Multiplex TaqMan real-time PCR

INTRODUCTION

Enterococci are one of the major causes of hospital-acquired infections although they can also cause human infections in the community (1). Hospital acquired infection is defined as an infection which develops 48 h after hospital admission not being the reason of the admission. Enterococci are individual, paired, or short-chain Gram-positive, catalase-negative cocci. This organism is mainly commensals in gastrointestinal tract of healthy individuals but may become opportunistic pathogens in immune-compromised hosts and in patients who have received broad-spectrum antimicrobial therapy or had a prolonged hospital stay (2).

Enterococci display both intrinsic and acquired resistance patterns to many antimicrobials, such as glycopeptides, β-lactams, fluoroquinolones and aminoglycosides which dramatically reduce the remaining therapeutic options among patients infected with these organisms (3). Along with E. faecalis, the genus Enterococcus includes E. faecium which found less frequently than Enterococcus faecalis in clinical isolates and are significantly more resistant to vancomycin than E. faecalis.

E. faecalis and E. faecium are the main causative agents for serious relevant nosocomial infection in humans, thereby it is necessary to discriminate between the low-level vancomycin resistant E. faecalis and E. faecium isolates with the other low-virulence motile enterococcal species (4, 5). Moreover, since vancomycin offers as last line of intravenous antibiotic therapy, so resistance to this antibiotic becomes an important clinical concern among Enterococci infections (6). The important role of E. faecalis and E. faecium isolates in hospital and community acquired infections makes detection and identification of this organism a priority for state and local health departments as well as laboratories that deal with pathogenic bacteria (7).

The culture techniques are routinely used for detecting of E. faecalis and E. faecium but PCR-based methods have given researchers the ability to detect small amounts of DNA to increase the sensitivity in diagnostics (8-10). A significant issue to replace conventional PCR for qPCR in diagnostics is the problem of contamination, which is almost zero in qPCR. Moreover, in diagnostics with conventional PCR, the nature of the PCR product on agarose gel was always confirmed by probe detection after Southern blotting (10-13). Real-time quantitative PCR (qPCR) using a combination of specific primers and fluorescent probes overcomes these deficiencies (14). In real-time PCR, no post amplification detection is needed. Besides, examining more genes in one reaction not only reduce experiment time but also decrease cost of the experiments. Several real-time and standard PCR assays have been developed in multiplex formats that allow the detection of multiple targets within a single reaction tube (15-18).

The objective of this study was to develop a quadruplexed real-time PCR assay which can quickly and accurately identify E. faecalis and E. faecium and their vanA and vanB genotypes, simultaneously. In this assay, Taqman probes were used to detect ddl E. faecalis, ddl E. faecium, Tn1546 (vanA genotype) and Tn1549 (vanB genotype) genes in E. faecalis and E. faecium.

MATERIALSAND METHODS

Bacterial strains and culture conditions

The method was developed by using standard strains of E. faecium BM4147, E. faecalis 33186, E. faecalis ATCC 29122 and E. coli ATCC 25922. To ascertain the effectiveness of the assay, 235 clinical enterococcal isolates including urine, blood, sputum, cerebrospinal fluid (CSF), pleura, and wound were obtained in this study. The bacterial isolation from clinical samples was performed using sheep blood agar as previously described (19) and were identified as Enterococcus spp. based on Gram staining, the catalase test, the hydrolysis of esculin in the presence of bile, and growth in brain-heart infusion broth containing 6.5% NaCl (20). All isolates were stored in BHI broth with 15% glycerol at -70°C until further analysis.

Evaluation of susceptibility to vancomycin was done by standard disk diffusion method and E-test (AB Biodisk, Solna) according to CLSI guideline. For E-test, the turbidity of bacterial inoculums were adjusted at 0.5 McFarland and before plating on Mueller-Hinton (MH) agar. E-test strips were then placed on MH agar and incubated at 35°C for a full 24 hours. Isolates with MIC≥32 and 4< MIC<32 were selected for molecular analysis.

Preparation of DNA

Total genomic DNA was extracted from each isolate by DNA extraction Kit (DNA Technology, Denmark) and the DNA concentration was estimated using a Nano Drop spectrophotometer (ABI, USA).

Primer and probe design

Real-time PCR assays using 5′-hydrolysis Taqman probes were designed for ddl gene of E. faecalis, E. faecium, vanA and vanB genes (Table 1). The sequences of these genes were obtained from completed genomic sequences for E. faecalis, E. faecium (GenBank accession no. U00457, U39790, vanA M97297 and vanB U00456, respectively). The BLASTN program at the National Center for Biotechnology Information (NCBI) confirmed that all of the PCR target regions had 100% similarity to two sequenced isolates of ddl gene of E. faecalis, E. faecium, vanA and vanB genes as well. The primers and probes were designed by Beacon Designer version 7 software.

Table 1.

Sequence of primers and probes used in this study

Primer/probe Forward (5’-3’) Reverse (5’-3’) Amplicon size
van A primers ATCAACCATGTTGATGTAGC AAGGGATACCGGACAATTCA This study 136bp

van A probe: 5-JOE-TCCATCTTCACCTGACTTGCCA-BHQ1-3 This study

van B primers ACCCTGTCTTTGTGAAG GAAATCGCTTGCTCAAT This study 121bp

van B probe: Tex Red-TCCATCATATTGTCCTGCTGCTTCTAT-Tamra This study

E.faecium primers CGTAGCATTCTATGATTATGAAGCC CATCGTGTAAGCTAACTTCG This study 124bp

E.faecium probe: FAM- CAGATTCCAGCCGAAGTGCC- Tamra This study

E.faecalis primers GACAGGAAAGAAACTAGGAGGAC AAACAGACACATCGTGCT This study 84bp

E.faecalis probe: CY5-CACTTCTGCCGCCATACAACAA-Tamra This study

Optimization of qPCR

First, variable parameters such as cycle temperatures, the number of PCR cycles, and length of annealing and replicating steps were optimized. Designed primers were evaluated with SYBR Green to optimize cycle temperatures and times. Each 25 μl single reaction consisted of 12.5 μl master mix Takara (Takara, Japan), 500 nM forward primer, 500 nM reverse primer, 200 nM probe, 50 ng target DNA and HPLC-grade H2O to 25 μl. During the cycling phase, the extension temperatures were varied from 48 to 56 °C in single-degree increments to maximize the reaction. The optimized protocol identified and used for all singleplex assays was an initial denaturation at 95 °C for 5 min followed by 35 cycles of 95 °C for 15 s, 52 °C for 15 s and 72 °C for 60 s. Quadruplex reaction conditions were optimized as follows: 500 nM forward primer, 500 nM reverse primer, 400 nM probe (ddl E. faecalis, vanA and vanB genes), 200 nM probe (ddl E. faecium), 50 ng target DNA and HPLC-purified H2O to 25 μl. Thermal cycling conditions were 5 min at 95 °C, followed by 40 cycles of 15s at 95 °C, 15s at 52 °C and 60s at 72 °C. A positive signal was determined by the crossing of a fluorescence threshold of 25 before cycle 35.

RESULTS

Detection of E. faecium and E. faecalis and vancomycin susceptibility rate

In this study, of 235 clinical specimens, 226 specimens were positive for E. faecium and E. faecalis in which, 193 isolates (82.2%) were E. faecalis and 33 isolates (14.04%) were E. faecium.

Antimicrobial susceptibility by phenotypic test showed 166 (73.45%) isolates were susceptible to vancomycin which 28 isolates had intermediate susceptibility to vancomycin and 32 isolates were fully resistant. The E-test and disk diffusion method were 100% concordant for the determination of the vancomycin susceptibility of the isolates (Table 2,3).

Table 2.

Prevalence of vanA and vanB genes regarding the minimum inhibitory concentration to vancomycin in E. faecalis isolates. N=193

Genes MIC≥32/N MIC<32) /(4<N MIC≤4/N
18/*(9/33%) 27/(13/98%) 148/(76/68%)
vanA (5) 5/(27/77%) 0 0
vanB (5) 5/(27/77%) 0 0
van A & van B (6) 6/(33/33%) 0 0
*

Three vancomycin resistant E. faecalis isolates without vanA or vanB genes

Table 3.

Prevalence of vanA and vanB genes regarding the minimum inhibitory concentration to vancomycin in E. faecium isolates. N=19

Genes MIC≥32/N MIC<32) /(4<N MIC≤4/N
14/*(42/42%) 1/(3/03%) 18/(54/55%)
van A (7) 7/(50%) 0 0
van B (1) 1/(7/14%) 0 0
van A & van B (3) 3/(21/43%) 0 0
*

Two vancomycin resistant E.faecium isolates without vanA or vanB genes

TaqMan real-time PCR

Singelplex TaqMan real-time PCR was first performed on DNAs extracted from four reference strains as positive controls for the four possible genes (Fig 1).

Fig. 1.

Fig. 1

a: Singleplex TaqMan Real time PCR amplification plot for detection of Enterococcus faecalis;

b: Singleplex TaqMan Real time PCR amplification plot for detection of Enterococcus faecium;

c: Singleplex TaqMan Real time PCR amplification plot for detection of van A gene;

d: Singleplex TaqMan Real time PCR amplification plot for detection of van B gene;

e: uadruplex TaqMan Real time PCR amplification plot for simultaneous detection of Enterococcus faecium, Enterococcus faecalis, vanA and van B genes.

TaqMan real time PCR on DNA extracts of Enteroccoci and E. coli control strains produced expected signals for E. faecium BM4147, E. faecalis 33186, E. faecalis ATCC 29122 and E. coli ATCC 25922 and cross-fluorescence was not observed during these experiments.

Using serial dilutions of DNA extracted from standardized inoculums adjusted at 107 CFU/ ml of these strains, we determined the lower limit of detection. The lowest pure Enterococci DNA concentration always delivering a positive result corresponded to 2.8, 1.2, 2.8, and 1.65 cells per μl of extracted DNA for E. faecium BM4147, E. faecalis 33186, E. faecalis ATCC29122 and E. coli ATCC 25922, respectively. At the detection limit, CT values varied between 19 and 25.

To confirm that the TaqMan real-time PCR could detect the simultaneous presence of different genotypes, the technique was carried out by using mixtures in various proportions of DNA from TaqMan real-time PCR strains (from 50 to 1%). For all three E. faecium BM4147, E. faecalis 33186 and E. faecalis ATCC 29122, the TaqMan real-time PCR was able to detect DNA until reaching concentration as low as 10%. All 226 extracted were further tested by TaqMan real-time PCR. Vancomycin susceptible isolates detected by the phenotypic methods were found susceptible by TaqMan real-time PCR in all cases. Moreover, all phenotypic resistant isolates were also found resistant by TaqMan real-time PCR. Mixed populations were detected by TaqMan real-time PCR, whereas they were not detected by culture and E-test in nine cases. In these nine cases, the resistance genotype was detected by TaqMan real-time PCR but was missed by phenotypic methods. In total, TaqMan real-time PCR test showed higher sensitivity (100%) and specificity (94.86%)

DISCUSSION

Recently, real-time PCR assays have been widely used in different areas of medical microbiology including diagnosis and molecular epidemiology of bacterial (21-24) and viral infections (25, 26), evaluation of drug susceptibility as well as microbial involvement in other human diseases (27-28). In this study, we developed an easy-to-use real-time PCR technique based on the amplification of fragments of the ddl, vanA and vanB genes with TaqMan real-time PCR primers and probes. This specific method allows detecting four possible genes including E. faecium BM4147, E. faecalis ATCC 33186 and E. faecalis ATCC 29122. The four fluorescence results are readable on an ABI 7500 thermocycler.

The determination of the CT cut off to distinguish positive from negative TaqMan real-time PCR assays was based on several results. The sensitivity and specificity of the TaqMan Real-time PCR are equivalent to those reported for real-time PCR assays (29, 30). The use of a culture result as a gold standard to evaluate performances of the TaqMan real-time PCR has certainly shortened the specificity of the test (31, 32). A quantitative PCR assays targeting 16S rRNA gene has been developed by Ryu et al. for identification of Enterococcus spp. in environmental samples (33). The results we obtained for several specimens that require 4 days to be processed by the laboratory with a positive TaqMan real-time PCR and negative culture highlight the advantage of PCR techniques that do not require viable bacteria.

Conclusion

Our TaqMan real-time PCR technique is rapid and simple. It can be performed about two hours for 40 cycles. As DNA extraction of isolates takes one hour, the simultaneous detection of isolates and their vancomycin susceptibility could be performed in less than three hours. Two hundred twenty-six specimens have been tested with perfect concordance with culture and E-test, except for minor discrepancies concerning mixed populations. The control using detection of the human ACTB gene did not detect any PCR inhibition.

Acknowledgments

We express appreciation to the Qazvin University of Medical Sciences for supplying the majority of the Enterococci isolates in this study, Dr Mehdi Aslani and Dr Nader Shahrokhi from Pasteur Institute of Iran for supplying the Enterococci standard strains.

References

  • 1.Teixeira L, Carvalho M, Facklan R. Enterococcus. In: Murray P, Baron E, Landry M, Jorgensen, editors. Manual of Clinical Microbiology. 9. Washington, DC: ASM Press; 2007. pp. 430–442. [Google Scholar]
  • 2.Castillo-Rojas G, Mazari-Hiríart M, Ponce de León S, Amieva-Fernández RI, Agis-Juárez RA, Huebner J, et al. Comparison of Enterococcus faecium and Enterococcus faecalis strains isolated from water and clinical samples: antimicrobial susceptibility and genetic relationships. PLoS One. 2013;8:e59491. doi: 10.1371/journal.pone.0059491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Arias CA, Contreras GA, Murray BE. Management of multidrug-resistant enterococcal infections. Clin Microbiol Infect. 2010;16:555–562. doi: 10.1111/j.1469-0691.2010.03214.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Werner G, Coque TM, Hammerum AM, Hope R, Hryniewicz W, Johnson A, et al. Emergence and spread of vancomycin resistance among enterococci in Europe. Euro Surveill. 2008;13(47) [PubMed] [Google Scholar]
  • 5.Freitas AR, Novais C, Tedim AP, Francia MV, Baquero F, Peixe L, Coque TM. Microevolutionary events involving narrow host plasmids influences local fixation of vancomycin-resistance in Enterococcus populations. PLoS One. 2013;8:e60589. doi: 10.1371/journal.pone.0060589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Reagan R, Converse JF, Noble RT, Haugland RA, Schiff KC, Weisberg SB. Correlation between Quantitative PCR and culture-based methods for measuring Enterococcus spp. over various temporal scales at three california marine beaches. Appl Environ Microbiol. 2012;78:1237–1242. doi: 10.1128/AEM.07136-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Santo Domingo JW, Siefring SC, Haugland RA. Real-time PCR method to detect Enterococcus faecalis in water. Biotechnol Lett. 2003;25:261–265. doi: 10.1023/a:1022303118122. [DOI] [PubMed] [Google Scholar]
  • 8.Barken KB, Haagensen JA, Tolker-Nielsen T. Advances in nucleic acid-based diagnostics of bacterial infections. Clin Chim Acta. 2007;384:1–11. doi: 10.1016/j.cca.2007.07.004. [DOI] [PubMed] [Google Scholar]
  • 9.Danbin K, Picard FJF, Martineau F, Menard C, Roy RH, Ouellette M, et al. Development of a PCR assay for rapid detection of enterococci. J Clin Microbiol. 1999;37:3497–3503. doi: 10.1128/jcm.37.11.3497-3503.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Fang H, Ohlsson AK, Jiang GX, Ullberg M. Screening for vancomycin-resistant enterococci: an efficient and economical laboratory-developed test. Eur J Clin Microbiol Infect Dis. 2012;31:261–265. doi: 10.1007/s10096-011-1304-0. [DOI] [PubMed] [Google Scholar]
  • 11.Satterfield BA, Stewart AF, Lew CS, Pickett DO, Cohen MN, Moore EA, et al. A quadruplex real-time PCR assay for rapid detection and differentiation of the Clostridium botulinum toxin genes A, B, E and F. J Med Microbiol. 2010;59:55–64. doi: 10.1099/jmm.0.012567-0. [DOI] [PubMed] [Google Scholar]
  • 12.Tonooka Y, Fujishima M. Comparison and critical evaluation of PCR-mediated methods to walk along the sequence of genomic DNA. Appl Microbiol Biotechnol. 2009;85:37–43. doi: 10.1007/s00253-009-2211-5. [DOI] [PubMed] [Google Scholar]
  • 13.Leal NC, Almeida AM. Diagnosis of plague and identification of virulence markers in Yersinia pestis by multiplex-PCR. Rev Inst Med Trop Sao Paulo. 1999;41:339–342. doi: 10.1590/s0036-46651999000600002. [DOI] [PubMed] [Google Scholar]
  • 14.Tomaso H, Reisinger EC, Al Dahouk S, Frangoulidis D, Rakin A, Landt O, et al. Rapid detection of Yersinia pestis with multiplex real-time PCR assays using fluorescent hybridisation probes. FEMS Immunol Med Microbiol. 2003;38:117–126. doi: 10.1016/S0928-8244(03)00184-6. [DOI] [PubMed] [Google Scholar]
  • 15.Tsukano H, Itoh K, Suzuki S, Watanabe H. Detection and identification of Yersinia pestis by polymerase chain reaction (PCR) using multiplex primers. Microbiol Immunol. 1996;40:773–775. doi: 10.1111/j.1348-0421.1996.tb01140.x. [DOI] [PubMed] [Google Scholar]
  • 16.Van den Braak N, Ott A, van Belkum A, Kluytmans JA, Koeleman JG, Spanjaard L, et al. Prevalence and determinants of fecal colonization with vancomycin-resistant Enterococcus in hospitalized patients in the Netherlands. Infect Control Hosp Epidemiol. 2000;21:520–524. doi: 10.1086/501797. [DOI] [PubMed] [Google Scholar]
  • 17.Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty – First Informational Supplement, M100-S21. Wayne; PA: 2011. [Google Scholar]
  • 18.Honarmand H, Falah Ghavidel M, Nikokar I, Rahbar Taromsari M. Evaluation of a PCR assay to detect Enterococcus faecalis in blood and determine glycopeptides resistance genes: van and van B. Iran J Med Sci. 2012;37:194–199. [PMC free article] [PubMed] [Google Scholar]
  • 19.Palladino S, Kay ID, Costa AM, Lambert EJ, Flexman JP. Real-time PCR for the rapid detection of vanA and vanB genes. Diagn Microbiol Infect Dis. 2003;45:81–84. doi: 10.1016/s0732-8893(02)00505-9. [DOI] [PubMed] [Google Scholar]
  • 20.El-Sharif A, Afifi S, El-Dahshan R, Rafeh N, Eissa S. Characterization of Mycobacterium tuberculosis isolated from cancer patients with suspected tuberculosis infection in Egypt: identification, prevalence, risk factors and resistance pattern. Clin Microbiol Infect. 2012;18:E438–45. doi: 10.1111/j.1469-0691.2012.03974.x. [DOI] [PubMed] [Google Scholar]
  • 21.Farivar TN, Johari P, Moien AA, Shahri MH, Naderi M, Oskouie H. Assessment of prevalence of non-tuberculous mycobacteria in archival acid-fast bacilli positive smear slides by TaqMan real-time PCR assay. N Am J Med Sci. 2012;4:231–234. doi: 10.4103/1947-2714.95907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Farivar TN, Pahlevan A, Johari P, Safdarian F, Mehr MA, Najafipour R, et al. Assessment of Helicobacter pylori prevalence by scorpion real-time PCR in chronic tonsillitis patients. J Glob Infect Dis. 2012;4:38–42. doi: 10.4103/0974-777X.93760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Najafipour R, Farivar TN, Pahlevan AA, Johari P, Safdarian F, Asefzadeh M. Agreement rate of rapid urease test, conventional PCR, and scorpion real-time PCR in detecting Helicobacter pylori from tonsillar samples of patients with chronic tonsillitis. J Glob Infect Dis. 2012;4:106–109. doi: 10.4103/0974-777X.96773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Xuan L, Huang F, Fan Z, Zhou H, Zhang X, Yu G, et al. Effects of intensified conditioning on Epstein-Barr virus and cytomegalovirus infections in allogeneic hematopoietic stem cell transplantation for hematological malignancies. J Hematol Oncol. 2012;2(5):46. doi: 10.1186/1756-8722-5-46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Farivar TN, Nezam MK, Johari P. Genotyping of hepatitis C virus isolated from hepatitis patients in Southeast of Iran by Taqman Realtime PCR. J Pak Med Assoc. 2011;61:586–588. [PubMed] [Google Scholar]
  • 26.Sakitani K, Hirata Y, Hayakawa Y, Serizawa T, Nakata W, Takahashi R, Kinoshita H. Role of interleukin-32 in Helicobacter pylori-induced gastric inflammation. Infect Immun. 2012;80:3795–3803. doi: 10.1128/IAI.00637-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Farivar TN, Johari P. Lack of association between Chlamydia trachomatis infection and cervical cancer-Taq Man realtime PCR assay findings. Asian Pac J Cancer Prev. 2012;13:3701–3704. doi: 10.7314/apjcp.2012.13.8.3701. [DOI] [PubMed] [Google Scholar]
  • 28.Elvitigala DA, Whang I, Premachandra HK, Umasuthan N, Oh MJ, Jung SJ, et al. Caspase 3 from rock bream (Oplegnathus fasciatus): genomic characterization and transcriptional profiling upon bacterial and viral inductions. Fish Shellfish Immunol. 2012;33:99–110. doi: 10.1016/j.fsi.2012.04.008. [DOI] [PubMed] [Google Scholar]
  • 29.Tripathi A, Shukla SK, Singh A, Prasad KN. A new approach of real time polymerase chain reaction in detection of vancomycin-resistant enterococci and its comparison with other methods. Indian J Med Microbiol. 2013;31:47–52. doi: 10.4103/0255-0857.108721. [DOI] [PubMed] [Google Scholar]
  • 30.Kim TS, Kwon HL, Song SH, Song KH, Kim HB, Park KU, et al. Real-time PCR surveillance of vanA for vancomycin-resistant Enterococcus faecium. Mol Med Rep. 2012;6:488–492. doi: 10.3892/mmr.2012.952. [DOI] [PubMed] [Google Scholar]
  • 31.Cantarelli V, Cavalcante B, Pilger DA, Souza F, Dias CG, Brodt T, et al. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil. Rev Soc Bras Med Trop. 2011;44:631–632. doi: 10.1590/s0037-86822011000500021. [DOI] [PubMed] [Google Scholar]
  • 32.Lata P, Ram S, Agrawal M, Shanker R. Real time PCR for the rapid detection of vanA gene in surface waters and aquatic macrophyte by molecular beacon probe. Environ Sci Technol. 2009;43:3343–3348. doi: 10.1021/es803635y. [DOI] [PubMed] [Google Scholar]
  • 33.Ryu H, Henson M, Elk M, Toledo-Hernandez C, Griffith J, Blackwood D, et al. Development of quantitative PCR assays targeting the 16S rRNA genes of Enterococcus spp. and their application to the identification of enterococcus species in environmental samples. Appl Environ Microbiol. 79:196–204. doi: 10.1128/AEM.02802-12. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Iranian Journal of Microbiology are provided here courtesy of Tehran University of Medical Sciences

RESOURCES