Abstract
Virulence markers in Shiga toxin-producing Escherichia coli (STEC) and their association with diseases remain largely unknown. This study determines the importance of 44 genetic markers for STEC (O157 and non-O157) from human clinical cases and their correlation to disease outcome. STEC isolated from a cattle surveillance program were also included. The virulence genes tested were present in almost all O157:H7 isolates but highly variable in non-O157 STEC isolates. Patient age was a significant determinant of clinical outcome.
TEXT
Shiga toxin-producing Escherichia coli (STEC) O157 and non-O157 strains have been identified in outbreak settings associated with water (1), food (2, 3, 4, 5), and animals (6, 7). Shiga toxin (Stx) production, especially Stx2 and subtypes Stx2a, Stx2c, and Stx2d (8, 9, 10, 11), has been implicated in causing severe disease and hemolytic uremic syndrome (HUS) (8, 12, 13, 14, 15, 16, 17, 18). Since not all patients infected with Stx2-producing STEC develop HUS, additional virulence factors (8, 17, 19) are likely required for disease. This study establishes the molecular profiles for a panel of selected clinical O157:H7 and non-O157 STEC isolates from humans and cattle surveillance in Alberta, Canada. The clinical outcome was correlated to molecular profiles to find genetic determinants of virulence and HUS.
Pulsed-field gel electrophoresis (PFGE) data from 1,407 human clinical O157:H7 isolates from 2004 to 2012 were analyzed, and a subset of 89 strains was selected from outbreak and sporadic settings. They were chosen to maximize the time period and the diversity of PFGE fingerprint patterns represented. E. coli O157 isolates from all HUS cases and clinical non-O157 STEC (n = 39) from the Provincial Laboratory for Public Health (ProvLab) and Alberta Agriculture and Rural Development (AARD) cattle surveillance (n = 19) collections were included. DNA from these isolates was extracted using the MagaZorb DNA mini-prep kit (Promega Corporation, Madison, WI, USA). The 44 genetic markers selected (Table 1) were investigated by high-throughput microfluidic real-time PCR amplification (20). The genes stx1 and stx2 were detected using real-time PCR (21), followed by subtyping (22). The serotypes of non-O157 STEC isolates were determined using conventional methods. χ2 values, P values, and statistical comparison of means using unpaired two-tailed t tests were calculated using the GraphPad QuickCalcs website (GraphPad Software, La Jolla, CA). Relative risks (RR), 95% confidence intervals (CI), and corresponding P values were calculated using MedCalc (version 12.7.7; MedCalc Software, Ostend, Belgium). A P value of <0.05 was considered to be statistically significant. Patient demographic data and disease outcome were provided by Alberta Health.
TABLE 1.
Virulence gene targets and oligonucleotide sequences used in the quantitative PCR microarray
| Virulence gene targets | Forward primer/reverse primer |
|---|---|
| eae | CATTGATCAGGATTTTTCTGGTGATA/CTCATGCGGAAATAGCCGTTA |
| eae-gamma | GACTGTTAGTGCGACAGTCAGTGA/TTGTTGTCAATTTTCAGTTCATCAAA |
| ecs1763 | TACTCTTGACCTTAGTACCGC/TTTTGATTATCAGAACCATATAGCCC |
| ecs1822 | CCGTACAGCGTGATTCATCC/TAGCGAAACGGGCAAGGTC |
| efa1 | TTTTCACCAGTTCATCATACAGG/CCATTATAAACATTTGCCAGACC |
| efa2 | ACTAAGATCAATACAAGGATTCC/ATCCATCAGGCCATAGGTG |
| ehxA | CGTTAAGGAACAGGAGGTGTCAGTA/ATCATGTTTTCCGCCAATGAG |
| ent | TCCTGGATTATTTTCTGCATTTCA/ACTATTGCCAAGTACGCCACAA |
| espF1 | TCGYCCGGCMCCRCCG/TGCCTGWGCAATGGGCGG |
| espG | AGCTGAAGTTGTGGARTTTTTATGC/TGTGTCAACRTTAAGGCTGGCA |
| espJ | AAAGGAGCMAAAGTATATCCMGATA/AACATCSASYCTRACTGWTTCTGG |
| espK | GCAGRCATCAAAAGCGAAATCACACC/TCGTTTGGTAACTGTGGCAGATACTCG |
| espM1 | TCAGCTCTTTTGGTATCA/CGCTAAATTTGTTAACATTAAAG |
| espM2 | CAGCACAAAGTTCTATTAATCATGTRATAATGGGG/ACTTGTCCGCAAGCAAGTTTGCTATG |
| espN | GACATATTTGTTTATGTCATCAGGAGCGG/CCTCAGGATATGGATGGCCTACTGGC |
| espO1-1 | CATGTTGTTGATGTAAGTATGCAG/AAGTTCACAAGTACATTACCCGG |
| espP | ATGCCCCGTCAGCATCTG/TCGACCGTCAGCGTATGG |
| espR1 | GCTCATGTTATTTAATTTRTTTTCCC/AGTGAAACAATTCGTTATCCACATC |
| espV | TCAGGTTCCTCGTCTGATGCCGC/CTGGTTCAGGCCTGGAGCAGTCC |
| espW | CCAAACTTAGGAGAGCGAGACGTAAGAATG/CCTGAATAAAGATACTCACCTAACTCTG |
| espX1 | ACTCAACTTGTCAATAAGCACTTAGG/ACACATCATTATTTAGCTTTACATTGTC |
| espX2 | TGTTATCATCCGATAACTCTGGG/GTCTTTTTCTTAACCTCTGGCTC |
| espX6 | TCACAACCGTGATTCTATATGAAAC/TTAGTATTGCGCCAGTAAGAATTAC |
| espX7 | TGCTGAAGAATTGAATTACTCT/TGTATCATCAAGCACTGCTCC |
| espY1 | ACTTCTGTTCAATTTCGTGAATAAAA/ATTCCAGACTATGGATAAACTTTTCTT |
| espY3 | GAACTATCTCTATTGTTAACGAGG/CTAGATATAGACCGCTGAAATCG |
| espY4-2 | GCAATGTATAAGGAGAGGCTTAGTC/TTGACTTCTTTAATATGAGAGCCAGG |
| etpD | TTGGATGACGGCGAAACTG/AGATGATACGCTGTTGGGAG |
| iha | AGTGGTACGGGTAAAACCG/AGTATCAGCGTGTAACTGGC |
| katP | GAAGTCATATATCGCCGGTTGAA/GTCATTTCAGGAACGGTGAGATC |
| lpfA | TACTGTCCGTTGACTCTCAG/ACCAACCGCAGCAAATACAG |
| nleA | AGATAACYCTAATACTAAATATGCC/GCCCAACCATTGCRCCGATATGAGG |
| nleB | CATGTTGAAGGCTGGAASTTTGT/CCGCTACAGGGCGATATGTT |
| nleD-2 | GGACTGGTTCCGATTTTCACTG/AAAGTCCACCACGCTAATCCC |
| nleE | AGAAGCGTTTGAACCTATTTCCA/TTGGGCGTTTTCCGGATAT |
| nleF | TGAGGTGAGAAATGAAAATACTGATG/CTATCCCTGTCCTCTATCGTCATTC |
| nleG | CCAGATTTTCTGCGAGAAGGC/GGACAGTTTTAGCGTGGAACC |
| nleH1-1 | TACCGAGTGTGGACTATA/CAGGACTTTTGTTGCATC |
| nleH1-2 | ACAAGAGAAAGTCATAGTGGTTG/AATCTCYCCCTTAGGCCATCCCA |
| pagC | GGCTGATAATCATACGCTATCG/ATCGATATTGCAGATTCACTCC |
| stx, all variants | TTTGTYACTGTSACAGCWGAAGCYTTACG/CCCCAGTTCARWGTRAGRTCMACRTC |
| terE | GCCGTTACCATCTATGATGC/TGTAAACGCGCATGAAGCTG |
| toxB | AGTATCAGTCACATAAAGTAGAC/GCATTRGGATCAATCCAGAG |
| ureD | GCAATAATTGACTCTGATTGCC/GCTGCTGCGGTAAAATTTACT |
O26:H11 or O26:HNM (n = 8; 20.5%) was the most common serotype observed in human isolates in this study, followed by O111:HNM, O111:HNT, or O111:H8 (n = 6; 15.4%) and O121:H19 (n = 5; 12.8%). O109:H5 or HNM (n = 3; 15.8%) was most common in cattle isolates followed by O26:H11, O84:HNM, and O98:HNM (n = 2; 10.5% each). The virulence genes tested were present in 96.6% to 100.0% of the O157:H7 strains, with the exception of stx1, which was only positive in 75.3% (n = 67) of the isolates (Table 2). stx1 (79.5% to 84.2%) was more prevalent than stx2 (35.9% to 36.8%) in the non-O157 isolates. The following genes were present in >80% of the human clinical non-O157 strains: eae, ehxA, ent, nleB, nleE, efa1, nleF, nleH1-2, ureD, terE, espK, espM2, espW, espG, espF1, espX1, espR1, and espJ (Table 2), compared to only stx1 and espR1 in cattle strains. Also, genes eae, toxB, katP, ent, nleB, nleE, efa1, efa2, nleF, nleH1-2, nleA, ureD, terE, espV, espK, ecs1763, espM1, espN, espM2, espX7, espW, espG, espF1, espX1, nleH1-1, nleG, espJ, and ecs1822 were significantly more prevalent in non-O157 human strains (Table 2).
TABLE 2.
Frequency and distribution of virulence genes in E. coli O157:H7 and non-O157 and seropathotypes
| Genetic locationa | Virulence gene | Gene presence (no. [%]) in: |
Seropathotype (no. [%]) |
χ2b | P value | |||
|---|---|---|---|---|---|---|---|---|
| O157:H7 (n = 89) | Non-O157 from human (n = 39) | Non-O157 from cattle (n = 19) | B (n = 29) | D/E (n = 22) | ||||
| Stx phage | stx1 | 67 (75.3) | 31 (79.5) | 16 (84.2) | 23 (79.3) | 19 (86.4) | 0.005 | 0.9411 |
| Stx phage | stx2 | 89 (100) | 14 (35.9) | 7 (36.8) | 10 (34.5) | 8 (36.4) | 0.005 | 0.9440 |
| C-I | espY1 | 89 (100) | 2 (5.1) | 0 (0) | 2 (6.9) | 0 (0.0) | 0.057 | 0.8119 |
| C-I | espY3 | 89 (100) | 5 (12.8) | 1 (5.3) | 5 (17.2) | 1 (4.5) | 0.183 | 0.6689 |
| CP-933N | espK | 89 (100) | 34 (87.2) | 7 (36.8) | 29 (100.0) | 7 (31.8) | 13.289 | 0.0003 |
| LEE | eae | 89 (100) | 34 (87.2) | 7 (36.8) | 29 (100.0) | 5 (22.7) | 13.289 | 0.0003 |
| LEE | eae-gamma | 89 (100) | 4 (10.3) | 1 (5.3) | 5 (17.2) | 0 (0.0) | 0.019 | 0.8906 |
| LEE | espF1 | 89 (100) | 39 (100) | 14 (73.7) | 29 (100.0) | 17 (77.3) | 8.139 | 0.0043 |
| LEE | espG | 89 (100) | 35 (89.7) | 7 (36.8) | 29 (100.0) | 6 (27.3) | 15.348 | <0.0001 |
| OI-1 | espX1 | 89 (100) | 39 (100) | 15 (78.9) | 29 (100.0) | 18 (81.8) | 5.845 | 0.0156 |
| OI-36 | nleD-2 | 89 (100) | 4 (10.3) | 0 (0) | 0 (0.0) | 1 (4.5) | 0.800 | 0.3709 |
| OI-36 | nleH1-1 | 89 (100) | 27 (69.2) | 3 (15.8) | 21 (72.4) | 2 (9.1) | 12.551 | 0.0004 |
| OI-37 | espX2 | 89 (100) | 4 (10.3) | 2 (10.5) | 5 (17.2) | 1 (4.5) | 0.001 | 0.9747 |
| OI-43 and OI-48 | iha | 89 (100) | 26 (66.7) | 12 (63.2) | 21 (72.4) | 13 (59.1) | 0.070 | 0.7919 |
| OI-43 and OI-48 | terE | 89 (100) | 36 (92.3) | 10 (52.6) | 29 (100.0) | 10 (45.5) | 9.958 | 0.0016 |
| OI-43 and OI-48 | ureD | 89 (100) | 36 (92.3) | 8 (42.1) | 29 (100.0) | 8 (36.4) | 14.949 | 0.0001 |
| OI-44 | espV | 89 (100) | 31 (79.5) | 6 (31.6) | 28 (96.6) | 5 (22.7) | 10.706 | 0.0011 |
| OI-50 | espN | 89 (100) | 31 (79.5) | 3 (15.8) | 27 (93.1) | 2 (9.1) | 18.825 | <0.0001 |
| OI-50 | espO1-1 | 89 (100) | 11 (28.2) | 5 (26.3) | 11 (37.9) | 4 (18.2) | 0.023 | 0.8799 |
| OI-50 | espX7 | 89 (100) | 31 (79.5) | 3 (15.8) | 27 (93.1) | 2 (9.1) | 18.825 | <0.0001 |
| OI-57 | ecs1763 | 89 (100) | 29 (74.4) | 6 (31.6) | 27 (93.1) | 6 (27.3) | 8.065 | 0.0045 |
| OI-62 | espR1 | 89 (100) | 39 (100) | 16 (84.2) | 29 (100.0) | 19 (86.4) | 3.674 | 0.0553 |
| OI-71 | ecs1822 | 89 (100) | 29 (74.4) | 2 (10.5) | 25 (86.2) | 2 (9.1) | 18.435 | <0.0001 |
| OI-71 | espM1 | 89 (100) | 29 (74.4) | 2 (10.5) | 25 (86.2) | 2 (9.1) | 18.435 | <0.0001 |
| OI-71 | nleA | 88 (98.9) | 25 (64.1) | 6 (31.6) | 21 (72.4) | 6 (27.3) | 4.203 | 0.0404 |
| OI-71 | nleF | 88 (98.9) | 33 (84.6) | 5 (26.3) | 25 (86.2) | 6 (27.3) | 16.727 | <0.0001 |
| OI-71 | nleG | 89 (100) | 29 (74.4) | 2 (10.5) | 25 (86.2) | 2 (9.1) | 18.435 | <0.0001 |
| OI-71 | nleH1-2 | 89 (100) | 36 (92.3) | 7 (36.8) | 29 (100.0) | 7 (31.8) | 17.708 | <0.0001 |
| OI-79 | espJ | 89 (100) | 36 (92.3) | 5 (26.3) | 29 (100.0) | 5 (22.7) | 23.763 | <0.0001 |
| OI-108 | espM2 | 89 (100) | 32 (82.1) | 2 (10.5) | 25 (86.2) | 2 (9.1) | 24.077 | <0.0001 |
| OI-108 | espW | 89 (100) | 33 (84.6) | 2 (10.5) | 25 (86.2) | 3 (13.6) | 26.292 | <0.0001 |
| OI-122 | efa1 | 89 (100) | 32 (82.1) | 3 (15.8) | 29 (100.0) | 1 (4.5) | 20.754 | <0.0001 |
| OI-122 | efa2 | 89 (100) | 31 (79.5) | 3 (15.8) | 29 (100.0) | 0 (0.0) | 18.825 | <0.0001 |
| OI-122 | ent | 89 (100) | 32 (82.1) | 5 (26.3) | 27 (93.1) | 3 (13.6) | 14.854 | 0.0001 |
| OI-122 | nleB | 89 (100) | 34 (87.2) | 7 (36.8) | 29 (100.0) | 5 (22.7) | 13.289 | 0.0003 |
| OI-122 | nleE | 89 (100) | 34 (87.2) | 7 (36.8) | 29 (100.0) | 5 (22.7) | 13.289 | 0.0003 |
| OI-122 | pagC | 89 (100) | 19 (48.7) | 8 (42.1) | 14 (48.3) | 9 (40.9) | 0.037 | 0.8466 |
| OI-141 and OI-154 | lpfA | 89 (100) | 5 (12.8) | 2 (10.5) | 5 (17.2) | 2 (9.1) | 0.063 | 0.8013 |
| OI-153 | espY4-2 | 89 (100) | 1 (2.6) | 0 (0) | 0 (0.0) | 1 (4.5) | 0.496 | 0.4814 |
| OI-174 | espX6 | 89 (100) | 1 (2.6) | 0 (0) | 1 (3.4) | 0 (0.0) | 0.496 | 0.4814 |
| pO157 | ehxA | 89 (100) | 36 (92.3) | 15 (78.9) | 29 (100.0) | 15 (68.2) | 1.074 | 0.3000 |
| pO157 | espP | 86 (96.6) | 29 (74.4) | 14 (73.7) | 23 (79.3) | 14 (63.6) | 0.003 | 0.9561 |
| pO157 | etpD | 89 (100) | 4 (10.3) | 0 (0) | 3 (10.3) | 1 (4.5) | 0.800 | 0.3709 |
| pO157 | katP | 89 (100) | 23 (59) | 4 (21.1) | 19 (65.5) | 4 (18.2) | 5.939 | 0.0148 |
| pO157 | toxB | 89 (100) | 21 (53.8) | 3 (15.8) | 20 (69.0) | 3 (13.6) | 6.140 | 0.0132 |
C-I, E. coli island; LEE, locus for enterocyte effacement; OI, O island.
χ2 calculations are based on E. coli non-O157 from human and cattle data.
The O157 and non-O157 isolates were categorized into seropathotypes A, B, and D/E (Table 2). Seropathotype C was excluded from the analysis because it contained only two isolates. Additionally, five isolates could not be grouped into a seropathotype. The gene distributions of isolates in seropathotype A and O157:H7 categories were identical. The virulence genes tested were most prevalent in seropathotype A, followed by seropathotypes B and then D and E. Several genes from CP-933N (espK), LEE (eae, espG), OI-44 (espV), OI-50 (espN and espX7), OI-57 (ecs1763), OI-71 (ecs1822, espM1, nleF, and nleG), OI-79 (espJ), OI-108 (espM2 and espW), and OI-122 (efa1, efa2, ent, nleB, and nleE) were significantly more prevalent in seropathotypes A and B than in D and E.
A total of 67 (75.3%) O157:H7 isolates were positive for both stx1a and stx2a, 19 (21.3%) were positive for stx2a only, and 3 (3.4%) were positive for both stx2a and stx2c (Table 3). The stx1 and stx2 genes were present in 31 (79.5%) and 14 (35.9%) of the non-O157 strains isolated from humans, respectively (Table 3). Subtypes stx1c and stx2c were detected in this category, but the majority of them were stx1a only (n = 22; 56.4%) (Table 3). In the cattle isolates, similar results were obtained (n = 12; 63.2%) (Table 3).
TABLE 3.
Shiga toxin subtyping of E. coli O157:H7 and non-O157 isolates
| Shiga toxin | Prevalence (no. [%]) of: |
||
|---|---|---|---|
| O157:H7 (n = 89) | Clinical non-O157 (n = 39) | Cattle non-O157 (n = 19) | |
| Shiga toxin gene | |||
| stx1 | 67 (72.8) | 31 (79.5) | 16 (80.0) |
| stx2 | 89 (100.0) | 14 (35.9) | 7 (36.8) |
| Shiga toxin gene subtype | |||
| stx1a | 0 (0) | 22 (56.4) | 12 (63.2) |
| stx1a, stx2a | 67 (75.3) | 5 (12.8) | 1 (5.3) |
| stx1a, stx2a, stx2d | 0 (0) | 0 (0) | 1 (5.3) |
| stx1a, stx2d | 0 (0) | 0 (0) | 2 (10.5) |
| stx1c | 0 (0) | 1 (2.6) | 0 (0) |
| stx1 NT | 0 (0) | 2 (5.1) | 0 (0) |
| stx1 NT, stx2a | 0 (0) | 1 (2.6) | 0 (0) |
| stx2a | 19 (21.3) | 5 (12.8) | 1 (5.3) |
| stx2a, stx2c | 3 (3.4) | 0 (0) | 0 (0) |
| stx2c | 0 (0) | 2 (5.1) | 0 (0) |
| stx2d | 0 (0) | 1 (2.6) | 0 (0) |
| stx2 NT | 0 (0) | 0 (0) | 2 (10.5) |
None of the non-O157-infected patients reported HUS; of the 1,407 O157:H7-infected patients, 29 developed HUS and required hemodialysis, but no deaths or kidney transplants were reported. The mean age of HUS patients was 8.7 years and was significantly lower than that of non-HUS patients infected with O157:H7 (mean age, 30.3 years; P < 0.0001) and non-O157-infected patients (mean age, 22.0 years; P = 0.0057) (Table 4). Of the HUS patients, 23 (79.3%) were <10 years of age, 14 of which were <5 years of age (Table 4). In comparison, only 440 of the 1,407 (31.3%) total O157:H7-infected cases during the study period were <10 years of age. Non-O157-infected patients of all age categories were observed, with the most common age category being <5 years (n = 12; 30.8%). No significant gender differences were observed for the O157:H7-infected patients (relative risk [RR], 1.05; 95% confidence interval [CI], 0.97 to 1.13; P = 0.21), O157:H7-infected patients with HUS (RR, 1.41, 95% CI, 0.83 to 2.41, P = 0.20), or non-O157-infected patients (RR, 0.77; 95% CI, 0.49 to 1.21; P = 0.26). While all HUS patients were hospitalized, only 345 (24.5%) of the 1,407 O157:H7-infected and 3 (7.7%) non-O157-infected patients required hospitalization (Table 4).
TABLE 4.
Patient demographics for E. coli O157:H7 and non-O157 cases
| Characteristic | No. (%) of cases with: |
|||
|---|---|---|---|---|
| O157:H7 from 2004–2012 (n = 1,407) | O157:H7 non-HUS subset (n = 60) | O157:H7 HUS subset (n = 29) | Clinical non-O157 (n = 39)a | |
| Age (yr) | ||||
| <5 | 270 (19.2) | 8 (13.3) | 14 (48.3) | 12 (30.8) |
| 5–9 | 170 (12.1) | 6 (10.0) | 9 (31.0) | 1 (2.6) |
| 10–19 | 253 (18.0) | 7 (11.7) | 4 (13.8) | 7 (17.9) |
| 20–29 | 251 (17.8) | 15 (25.0) | 2 (6.9) | 8 (20.5) |
| 30–39 | 94 (6.7) | 6 (10.0) | 0 (0.0) | 2 (5.1) |
| 40–49 | 97 (6.9) | 5 (8.3) | 0 (0.0) | 3 (7.7) |
| 50–59 | 102 (7.2) | 4 (6.7) | 0 (0.0) | 4 (10.3) |
| 60–69 | 71 (5.0) | 6 (10.0) | 0 (0.0) | 0 (0.0) |
| ≥70 | 99 (7.0) | 3 (5.0) | 0 (0.0) | 2 (5.1) |
| Mean | 26.0 | 30.3 | 8.7 | 22.0 |
| Gender | ||||
| Male | 720 (51.2) | 36 (60.0) | 17 (58.6) | 17 (43.6) |
| Female | 687 (48.8) | 24 (40.0) | 12 (41.4) | 22 (56.4) |
| Hospitalization | ||||
| Yes | 345 (24.5) | 23 (38.3) | 29 (100) | 3 (7.7) |
| No | 925 (65.7) | 33 (55.0) | 0 (0.0) | 36 (92.3) |
| Unknown | 137 (9.7) | 4 (6.7) | 0 (0.0) | 0 (0.0) |
HUS was not associated with any of the non-O157 isolates.
No significant differences were observed in the molecular profiles of O157:H7 strains linked to HUS and non-HUS cases, and the inclusion of additional genetic markers is needed for discrimination. Greater variations were seen in the molecular profiles of the non-O157 isolates, most likely due to the diversity of their serotypes. Many of the genetic markers tested were absent in the non-O157 strains, particularly those isolated from cattle. Almost all of the nle genes tested were present in the clinical O157:H7 and non-O157 strains, suggesting that they play an important role in virulence. The products of nleB, nleD, nleE, and nleH have been shown to inhibit host inflammatory responses (23), leading to more severe disease outcomes, and these are largely absent in our cattle strains. A similar distribution pattern was seen for most esp genes. As expected, isolates belonging to the most virulent seropathotypes had the highest proportion of virulence genes. Strains belonging to seropathotype A contained almost all of the virulence genes tested (stx2, espY1, espY3, eae-gamma, nleD-2, espX2, espO1-1, lpfA, espY4-2, espX6, and etpD). The presence of genes espK, eae, espG, terE, ureD, espV, espN, espX7, ecs1763, ecs1822, espM1, nleF, nleG, nleH1-2, espJ, espM2, espW, efa1, efa2, ent, nleB, and nleE can be used to differentiate strains belonging to seropathotypes B from those belonging to seropathotypes D and E. These data corroborate a recent study showing that these potential virulence genes were significantly more frequent among HUS-associated than non-HUS-associated strains (24).
Interestingly, five clinical non-O157 isolates lacking the eae gene were associated with human disease; four isolates also lacked stx2 and three lacked most of the virulence genes tested. Genes espF1, espR1, and espX1 were the only genes present in all of the O157 and non-O157 clinical strains tested. Further studies are required to address the role of these genes as related to human disease.
Our data support that HUS development is dependent on age-associated factors as shown in previous studies (25). Our findings correlate with those of a recent study showing that the age of the patient (<5 years) and the presence of eae and stx2a genes in STEC showed significant associations with the development of HUS (P < 0.05 for each parameter), while stx1-positive STEC was associated with non-HUS cases (P < 0.05) (24). Nonetheless, age is not the sole determining factor for disease progression, and additional investigation is needed to identify the genetic determinants of HUS. In conclusion, the panel of genes examined was present in almost all O157 STEC, but in non-O157 STEC, the presence/absence of these genes varies, even within a given serotype. Lastly, based on the gene profile results in this study we were not able to identify one or a combination of genetic markers that can reliably predict disease outcomes. Further studies using whole-genome sequencing might identify additional virulence markers and increase our understanding of their contribution to human disease.
ACKNOWLEDGMENTS
We thank the Provincial Laboratory for Public Health in Alberta, Alberta Health Services, and Alberta Health for their support for this research. We also thank the National Microbiology Laboratory in Winnipeg, Manitoba, and the Centre for Public Health and Zoonoses in Guelph, Ontario, for serotyping the isolates.
The quantitative PCR microarray was developed with funding from the French Joint Ministerial Program of R&D against CBRNE risks (grant C17609-2).
REFERENCES
- 1.Hrudey SE, Payment P, Huck PM, Gillham RW, Hrudey EJ. 2003. A fatal waterborne disease epidemic in Walkerton, Ontario: comparison with other waterborne outbreaks in the developed world. Water Sci Technol 47:7–14. [PubMed] [Google Scholar]
- 2.Buchholz U, Bernard H, Werber D, Böhmer MM, Remschmidt C, Wilking H, Deleré Y, an der Heiden M, Adlhoch C, Dreesman J, Ehlers J, Ethelberg S, Faber M, Frank C, Fricke G, Greiner M, Höhle M, Ivarsson S, Jark U, Kirchner M, Koch J, Krause G, Luber P, Rosner B, Stark K, Kühne M. 2011. German outbreak of Escherichia coli O104:H4 associated with sprouts. N Engl J Med 365:1763–1770. doi: 10.1056/NEJMoa1106482. [DOI] [PubMed] [Google Scholar]
- 3.Taylor EV, Nguyen TA, Machesky KD, Koch E, Sotir MJ, Bohm SR, Folster JP, Bokanyi R, Kupper A, Bidol SA, Emanuel A, Arends KD, Johnson SA, Dunn J, Stroika S, Patel MK, Williams I. 2013. Multistate outbreak of Escherichia coli O145 infections associated with romaine lettuce consumption, 2010. J Food Prot 76:939–944. doi: 10.4315/0362-028X.JFP-12-503. [DOI] [PubMed] [Google Scholar]
- 4.Brooks JT, Sowers EG, Wells JG, Greene KD, Griffin PM, Hoekstra RM, Strockbine NA. 2005. Non-O157 Shiga toxin-producing Escherichia coli infections in the United States, 1983-2000. J Infect Dis 192:1422–1429. doi: 10.1086/466536. [DOI] [PubMed] [Google Scholar]
- 5.Rangel JM, Sparling PH, Crowe C, Griffin PM, Swerdlow DL. 2005. Epidemiology of Escherichia coli O157:H7 outbreaks, United States, 1982-2002. Emerg Infect Dis 11:603–609. doi: 10.3201/eid1104.040739. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Ihekweazu C, Carroll K, Adak B, Smith G, Pritchard GC, Gillespie IA, Verlander NQ, Harvey-Vince L, Reacher M, Edeghere O, Sultan B, Cooper R, Morgan G, Kinross PT, Boxall NS, Iversen A, Bickler G. 2012. Large outbreak of verocytotoxin-producing Escherichia coli O157 infection in visitors to a petting farm in South East England, 2009. Epidemiol Infect 140:1400–1413. doi: 10.1017/S0950268811002111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Centers for Disease Control and Prevention. 2009. Outbreak of Shiga toxin-producing Escherichia coli O157 infection associated with a day camp petting zoo—Pinellas County, Florida, May-June 2007. MMWR Morb Mortal Wkly Rep 58:426–428. [PubMed] [Google Scholar]
- 8.Boerlin P, McEwen SA, Boerlin-Petzold F, Wilson JB, Johnson RP, Gyles CL. 1999. Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans. J Clin Microbiol 37:497–503. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Schmitt CK, McKee ML, O'Brien AD. 1991. Two copies of Shiga-like toxin II-related genes common in enterohemorrhagic Escherichia coli strains are responsible for the antigenic heterogeneity of the O157:H-strain E32511. Infect Immun 59:1065–1073. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Friedrich AW, Bielaszewska M, Zhang WL, Pulz M, Kuczius T, Ammon A, Karch H. 2002. Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms. J Infect Dis 185:74–84. doi: 10.1086/338115. [DOI] [PubMed] [Google Scholar]
- 11.Bielaszewska M, Friedrich AW, Aldick T, Schürk-Bulgrin R, Karch H. 2006. Shiga toxin activatable by intestinal mucus in Escherichia coli isolated from humans: predictor for a severe clinical outcome. Clin Infect Dis 43:1160–1167. doi: 10.1086/508195. [DOI] [PubMed] [Google Scholar]
- 12.Black ER. 2009. Hemolytic uremic syndrome: a case review. J Neurosci Nurs 41:188–190. doi: 10.1097/JNN.0b013e3181aaaa5f. [DOI] [PubMed] [Google Scholar]
- 13.Matsell DG, White CT. 2009. An outbreak of diarrhea-associated childhood hemolytic uremic syndrome: the Walkerton epidemic. Kidney Int Suppl 112:S35–S37. doi: 10.1038/ki.2008.628. [DOI] [PubMed] [Google Scholar]
- 14.Ray PE, Liu XH. 2001. Pathogenesis of Shiga toxin-induced hemolytic uremic syndrome. Pediatr Nephrol 16:823–839. doi: 10.1007/s004670100660. [DOI] [PubMed] [Google Scholar]
- 15.Tozzi AE, Caprioli A, Minelli F, Gianviti A, De Petris L, Edefonti A, Montini G, Ferretti A, De Palo T, Gaido M, Rizzoni G, Hemolytic Uremic Syndrome Study Group . 2003. Shiga-toxin producing Escherichia coli infections associated with hemolytic uremic syndrome, Italy, 1988-2000. Emerg Infect Dis 9:106–108. doi: 10.3201/eid0901.020266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Trachtman H, Austin C, Lewinski M, Stahl RA. 2012. Renal and neurological involvement in typical Shiga toxin-associated HUS. Nat Rev Nephrol 8:658–669. doi: 10.1038/nrneph.2012.196. [DOI] [PubMed] [Google Scholar]
- 17.Ethelberg S, Olsen KE, Scheutz F, Jensen C, Schiellerup P, Enberg J, Petersen AM, Olesen B, Gerner-Smidt P, Mølbak K. 2004. Virulence factors for hemolytic uremic syndrome, Denmark. Emerg Infect Dis 10:842–847. doi: 10.3201/eid1005.030576. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Kawano K, Okada M, Haga T, Maeda K, Goto Y. 2008. Relationship between pathogenicity for humans and stx genotype in Shiga toxin-producing Escherichia coli serotype O157. Eur J Clin Microbiol Infect Dis 27:227–232. doi: 10.1007/s10096-007-0420-3. [DOI] [PubMed] [Google Scholar]
- 19.Nataro JP, Kaper JB. 1998. Diarrheagenic Escherichia coli. Clin Microbiol Rev 11:142–201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Tseng M, Fratamico PM, Bagi L, Delannoy S, Fach P, Manning SD, Funk JA. 2014. Molecular characterization of Shiga toxin-producing E. coli (STEC) from finishing swine in a longitudinal study. Appl Environ Microbiol 80:6395–6402. doi: 10.1128/AEM.01761-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Chui L, Lee MC, Allen R, Bryks A, Haines L, Boras V. 2013. Comparison between ImmunoCard STAT! and real-time PCR as screening tools for both O157:H7 and non-O157 Shiga toxin-producing Escherichia coli in Southern Alberta, Canada. Diagn Microbiol Infect Dis 77:8–13. doi: 10.1016/j.diagmicrobio.2013.05.015. [DOI] [PubMed] [Google Scholar]
- 22.Scheutz F, Teel LD, Beutin L, Piérard D, Buvens G, Karch H, Mellmann A, Caprioli A, Tozzoli R, Morabito S, Strockbine NA, Melton-Celsa AR, Sanchez M, Persson S, O'Brien AD. 2012. Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. J Clin Microbiol 50:2951–2963. doi: 10.1128/JCM.00860-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Newton HJ, Pearson JS, Badea L, Kelly M, Lucas M, Holloway G, Wagstaff KM, Dunstone MA, Sloan J, Whisstock JC, Kaper JB, Robins-Browne RM, Jans DA, Frankel G, Phillips AD, Coulson BS, Hartland EL. 2010. The type III effectors NleE and NleB from enteropathogenic E. coli and OspZ from Shigella block nuclear translocation of NF-kappaB p65. PLoS Pathog 6:e1000898. doi: 10.1371/journal.ppat.1000898. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Haugum K, Brandal LT, Lindstedt BA, Wester AL, Bergh K, Afset JE. 2014. PCR-based detection and molecular characterization of shiga toxin-producing Escherichia coli strains in a routine microbiology laboratory over 16 years. J Clin Microbiol 52:3156–3163. doi: 10.1128/JCM.00453-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gould LH, Demma L, Jones TF, Hurd S, Vugia DJ, Smith K, Shiferaw B, Segler S, Palmer A, Zansky S, Griffin PM. 2009. Hemolytic uremic syndrome and death in persons with Escherichia coli O157:H7 infection, foodborne diseases active surveillance network sites, 2000-2006. Clin Infect Dis 49:1480–1485. doi: 10.1086/644621. [DOI] [PubMed] [Google Scholar]