Abstract
Background and Objectives
The therapeutic options for diseases caused by Escherichia coli are limited. In this study we investigated the presence of virulence factors among Enteropathogenic Escherichia coli (EPEC) strains and their antibiotic resistance patterns. The isolates were also checked for the presence of class1 integrons and gene cassettes.
Materials and Methods
This study included 70 EPEC strains isolated from children. Antimicrobial resistance patterns were determined using diffusion methods. The broth microdilution methods was used to determine the minimum inhibitory concentration. PCR was used to detect eaeA, bfpA genes. The 5’ and 3’ conserved sequences (CSs) of class 1 integrons and intI gene were amplified to investigate the presence of integrons and gene cassettes.
Results
Antimicrobial susceptibility testing showed that 4 (5.7%), 3 (4.2%), and 2 (2.8 %) isolates were resistant to ampicillin, trimethoprim-sulfamethoxazole, and ceftazidime, respectively. Resistance rates to ciprofloxacin and aztreonam were 1.4%. Thirteen (18.5%) isolates showed resistance to tetracycline, and 4 (5.7%) were kanamycin resistant. Class I integron detected in 22 (31.4%) isolates. All the gene cassettes found in class I integrons corresponded to different variants of dfr and aadA genes.
Conclusion
Prevalence of class I integrons in EPEC strains was high. Presence of aadA and dfr gene cassettes in integrons represents high distribution of resistance determinants in EPEC strains.
Keywords: Class I integrons, Enteropathogenic Escherichia coli, Children
INTRODUCTION
Diarrhea remains one of the major causes of morbidity and mortality among children worldwide (1). Enteropathogenic Escherichia coli (EPEC) is the predominant cause of diarrhea in infant worldwide and represents an important endemic health threat to children under 5 years of age in developing countries (2). Approximately 30-40% of infant diarrhea is caused by EPEC (3). In Iran, EPEC strains were isolated from 44.9% of the children with diarrhea (4). These strains posses a number of virulence factors and a virulence plasmid that are responsible for infections caused by EPEC, although they cannot produce classic toxins (5).
EPEC is classified into two groups: Typical EPEC (tEPEC), and atypical EPEC (aEPEC). The main virulence mechanism of EPEC is localized adherence to the host gut epithelium by inducing of a specific lesion on enterocytes, which called attaching-effacing (A/E) lesion. The locus of enterocyte effacement (LEE) encoded adhesion determine establishment of A/E lesions. LEE is a chromosomal pathogenicity island, which is present in both EPEC subgroups (6).
Recently, therapeutic options for diseases caused by E. coli are limited because of the emergence and spread of Extended Spectrum ß-lactamases (ESBL), and increasing of multiple drug resistant strains (7). The carbapenems are sometimes the only effective options against resistant strains. However, recent studies reported carbapenems resistance in clinical isolates of E. coli, which is a major cause for concern in treatment of both intestinal and urinary tract infections (8, 9). Integrons play a major role in the antimicrobial resistance of clinical isolates because they are genetic elements capable to capture, integrate and express antimicrobial resistance gene cassettes (10). The efficacy of integrons in distribution of antimicrobial resistance in clinical isolates of E. coli has been well documented (11, 12). In this study, we investigated the prevalence of EPEC among Iranian children and study their resistance patterns and presence of class1 integrons in EPEC strains.
MATERIAL & METHODS
Bacterial strains and identification methods
This study included 70 EPEC strains isolated from children less than 5 years of age with and without diarrhea in Tehran hospitals from May 2010 to July 2012. All isolates were identified using standard microbiological methods (4).
Identification of eaeA and bfpA gene
DNA of bacterial isolates was extracted as described previously (13). All isolates were tested by PCR to detect eaeA and bfpA gene in EPEC strains. Primers and PCR conditions used in this study are listed in Table 1.
Table 1.
Oligonucleotide primers used in this study.
| Primer | Target gene/region | Sequence (5’-3’) | Product size (bp) | Annealing temp (°C) | Reference |
|---|---|---|---|---|---|
| BFP-F |
bfpA | AATGGTGCTTGCGCTTGCTGC |
326 | 56 | 36 |
| BFP-R | GCCGCTTTATCCAACCTGGTA | ||||
| EAE-F |
eaeA | CATTATGGAACGGCAGAGGT |
790 | 55 | 37 |
| EAE-R | ATCTTCTGCGTACTGCGTTCA | ||||
| CS-F |
5 CS | GGCATCCAAGCAGCAAG |
Variable | 54 | 38 |
| CS-R | 3 CS | AAGCAGACTTGACCTGA | |||
| Int-F |
intI | GCCTTGCTGTTCTTCTACGG |
558 | 56 | 39 |
| Int-R | GATGCCTGCTTGTTCTACGG | ||||
| SUL-F |
sul-1 | CTTCGATGAGAGCCGGCGGC |
437 | 68 | 38 |
| SUL-R | GCAAGGCGGAAACCCGCGCC | ||||
| qac-F |
qacEΔ1 | ATCGCAATAGTTGGCGAAG |
240 | 54 | 39 |
| qac-R | CAAGCTTTTGCCCATGAAGC | ||||
Serogrouping of EPEC Strains
Determination of EPEC serogroups was performed by slide agglutination method with O-specific antisera according to the instructions recommended by manufacturer (Bio-Rad, France).
Antimicrobial Susceptibility testing
Antimicrobial susceptibility pattern of strains was determined by disk diffusion method, according to the Clinical Laboratory Standard Institute (CLSI) criteria (14). The following antimicrobial discs were examined: ampicillin (30 μg/ml), aztreonam (30 μg/ml), cefotaxime (30 μg/ml), cefepime (30 μg/ml), ceftazidime (30 μg/ml), ciprofloxacin (5 μg/ml), gentamicin (10 μg/ml), amikacin (30 μg/ml), kanamycin (30 μg/ml), tetracycline (30 μg/ml), chloramphenicole (30 μg/ml), nalidixic acid (30 μg/ml), and trimethoprime-sulfamethoxazole (15 μg/ml) (MAST diagnostics, Bostle, Mersey side). In addition, Minimum Inhibitory Concentration (MIC) of kanamycin and tetracycline were determined using broth microdilution as methods recommended by CLSI guidelines (15). E. coli ATCC 25922 was used as a susceptible control strain in all antimicrobial tasting. Multidrug resistance was defined as resistance to three or more of different antimicrobial classes.
Detection and characterization of Integrons and associated gene cassette
Class 1 integrons and associated sulfonamide resistance gene (sul1), and int1 region of the integrase gene were identified by PCR using primers and PCR conditions listed in Table1. Gene cassette assortments in class 1 integrons were detected by PCR using 5’ and 3’ CS primers. The PCR products were sequenced in both directions. Sequences were analyzed via the BLAST and MEGA programmers.
Nucleotide sequence accession numbers
The nucleotide sequences of gene cassettes reported in this study have been submitted to GenBank under accession numbers JX442969-72.
RESULTS
All isolates were confirmed as E. coli using routine biochemical identification methods. Presence of eaeA gene was confirmed in all 70 strains isolated from diarrhea children. Two isolates (2.85%) had both virulence factors (eaeA, bfpA) and classified as typical EPEC. However, bfpA gene was not found in 68 (97.14%) isolates. These isolates (eaeA%, bfpA-) classified as atypical EPEC. H typing of EPEC strains showed 15 different H types. H21 was the most prevalent (8.5%) among EPEC strains isolated from children, followed by H2 (5.7%) and H48 (4.2%).
Resistance to tetracycline (18.5%), ampicillin (5.7%), kanamycin (5.7%), and trimethoprim-sulfamethoxazole (4.2%) was remarkable. However, all isolates were susceptible to gentamicin and cefepime (Table2). Determination of MICs to tetracycline and kanamycin showed that 13 (18.5%) isolates were tetracycline resistant (MIC≥16 μg/ml) and 4 (5.7%) isolates were kanamycin resistant (MIC≥ 64 μg/ml). Four (5.7%) strains were multidrug resistant (resistance to three or more antimicrobial classes). Class I integron containing int1, qacΔE, and sul1 were detected in 22 (31.4%) of strains (Fig.1, Table 3).
Table 2.
Antimicrobial susceptibility patterns of EPEC strains.
| Antibiotics | Resistance | Intermediate | Susceptible |
|---|---|---|---|
| Gentamicin | 0(0%) | 2(2.18%) | 68(97.1%) |
| Kanamycin | 4(5.7%) | 19(27.1%) | 47(67.1%) |
| Tetracycline | 13(18.5%) | 16(22.8%) | 41(58.5%) |
| Ciprofloxacin | 1(1.4%) | 0(0%) | 69(98.5%) |
| Nalidixic Acid | 1(1.4%) | 3(4.2%) | 66(94.2%) |
| Chloramphenicole | 2(2.8%) | 3(4.2%) | 65(92.8%) |
| Trimethoprime-sulfamethoxazole | 3(4.2%) | 1(1.4%) | 66(94.2%) |
| Ceftazidime | 2(2.8%) | 2(2.8%) | 66(94.2%) |
| Cefotaxime | 0(0%) | 1(1.4%) | 69(98.5%) |
| Aztreonam | 1(1.4%) | 0(0%) | 69(98.5%) |
| Amikacin | 2(2.8%) | 0(0%) | 68(97.1%) |
| Ampicillin | 4(5.7%) | 0(0%) | 66(94.2%) |
| Cefepime | 0(0%) | 0(0%) | 70(100%) |
Fig 1.
Detection of intI gene among nine EPEC strains. Lane M, 100 bp ladder; Lane 1, Positive control strain; Lanes 2 to 10, EPEC strains isolated in this study; Lane N, negative control (E.coli ATCC 25922).
Table 3.
Characterization of Class1 integrons and gene cassttes in 22 Enteropathogenic Escherichia coli (EPEC).
| STRAINS | Serogroup | H Type | EPEC Type | intI1 | qac% sul1 | Size of gene cassettes (bp) | Identified gene Cassettes |
|---|---|---|---|---|---|---|---|
| 16 | O111 | H4 | atypic | + | + | 1800 | aadA1, dfrA1 |
| 17b | O111 | NTa | atypic | + | + | 2000 | aadA2, dfrA12, orfF |
| 18b | O111 | H21 | atypic | + | + | 2000 | aadA2, dfrA12, orfF |
| 19b | O111 | NT | atypic | + | + | 1800 | aadA1, dfrA1 |
| 20 | O111 | H36 | atypic | + | + | 1800 | aadA1, dfrA1 |
| 27 | O111 | H15 | atypic | + | + | 1800 | aadA1, dfrA1 |
| 28 | O111 | H27 | typic | + | + | 1800 | aadA1, dfrA1 |
| 29 | O111 | H31 | atypic | + | + | 1800 | aadA1, dfrA1 |
| 30 | O111 | H27 | atypic | + | + | 1800 | aadA1, dfrA1 |
| 34 | O111 | H21 | atypic | + | + | 1800 | aadA1, dfrA1 |
| 35 | O111 | H2 | atypic | + | + | 1800 | aadA1, dfrA1 |
| 39 | O111 | H3 | atypic | + | + | 800 | dfrVII |
| 40 | O111 | H20 | atypic | + | + | 800 | dfrVII |
| 48 | O111 | H14 | atypic | + | + | 800 | dfrVII |
| 78 | O111 | NT | atypic | + | + | 1800 | aadA1, dfrA1 |
| 80 | O127 | NT | atypic | + | + | 1800 | aadA1, dfrA1 |
| 82 | O127 | NT | atypic | + | + | 1800 | aadA1, dfrA1 |
| 91 | O55 | H48 | atypic | + | + | 800 | dfrVII |
| 187 | O142 | H21 | atypic | + | + | 1500 | drfA1, orfC |
| 190 | O142 | H2 | atypic | + | + | 800 | dfrVII |
| 386 | NT | NT | atypic | + | + | 1500 | drfA1, orfC |
| 1719b | NT | H48 | atypic | + | + | 1500 | drfA1, orfC |
NT, Non Typable
Multidrug resistance strains (resistance to three or more of different antimicrobial classes).
Following PCR amplification of variable region of class 1 integrons, 4 different groups of gene cassette were detected. Groups 1, 2, 3, and 4 included fragments with 2000, 1800, 1500, and 800 bp size, respectively. Characterization of these gene cassettes by sequencing demonstrated different variants of aadA (aadA1, aadA2) and dfr genes (dfrA1, dfr7, dfrA12).
Group 1 consisted from two isolates. Three gene cassettes (dfrA12, orfF, and aadA2) were shown in these isolates following sequencing. Twelve isolates with dfrA1 and aadA1, classified in group 2. Group 3 included dfrA1 and orfC gene cassettes that three isolates belonged to this group. Finally five isolates classified in group 4 and were contained dfr7.
DISCUSSION
Enteropathogenic Escherichia coli (EPEC) is a subgroup of diarrheagenic E. coli that is responsible for infantile diarrhea worldwide, mostly in developing countries (5). In this study, among 70 EPEC strains, just 2 strains (2.8%) belonged to tEPEC. However, 68 strains (97.1%) classified as aEPEC. These result show high frequency of aEPEC strains among children in Iran. This finding agrees with previous studies which have been demonstrated prevalence of aEPEC in children with or without diarrhea worldwide (16-19). Some aEPEC strains could be tEPEC or EHEC strains that lost BFP-encoding plasmid or stx genes (20). Furthermore, some adhesion encoding genes (lpfA, paa, iha, and toxB) from EHEC have detected in EPEC strains and these genes have been more prevalent in aEPEC than tEPEC (20). Some studies have shown that there are not any relationships between aEPEC and other pathogen types of E. coli (21). On the other hand, a closer relationship was found between aEPEC and EHEC (22).
To our knowledge, studies of frequency of antimicrobial resistance in EPEC strains are very rare. High level of antimicrobial resistance have reported in E. coli and other Enterobacteriaceae strains worldwide (7, 9, 23), but in this study the highest rate of antibiotic resistance were shown in 4 strains (5.7%) that were multiple drug resistance.
Cefepime showed excellent antimicrobial activity against EPEC strains with 100% of all isolates susceptible. Of other Cephalosporins, ceftazidime and cefotaxime demonstrated good activity (susceptibility rates of 94.2% and 100%, respectively). These trends are in agreement with previous studies that majority of EPEC isolates have been susceptible to third generation cephalosporins (17, 24, 25)
World Health organization has recommended ampicillin and co-trimoxazole as therapeutic options for treatment of severe cases of diarrhea. In this study, 4 (5.7%), and 4 (5.7%) isolates were identified which were unsusceptible to ampicillin and co-trimoxazole, respectively. In a study in Mexico, 38% of aEPEC isolates were resistant to ampicillin and co-trimoxazole but 100%, and 67% of tEPEC were resistant to ampicillin and co-trimoxazole, respectively, (17). In contrast, Aslani et al (26) have reported resistant rates of 59%, and 35% for ampicillin and co-trimoxazole, respectively. Similar to earlier published data (24-26), in current study, the majority of isolates (98.5%) were susceptible to ciprofloxacin. However, one isolates was resistant to ciprofloxacin. Furthermore, this isolate was a multiple drug resistant that was resistant to aztreonam, kanamycin, tetracycline, ampicillin, co-trimoxazole, and ceftazidime. Therefore, it seems that aEPEC are more susceptible to ampicillin, co-trimoxazole and other antimicrobial agents than tEPEC.
As EPEC is an important cause of diarrhea in children in developing countries, spread of integrons among these strains could threaten the usefulness of antibiotic therapy in persistent or sever cases of diarrhea. Our results showed the prevalence of class 1 integrons is 31.4% among EPEC strains isolated from children with or without diarrhea. In all of EPEC isolates carrying class 1 integron, the qacEρ1 and sul1 genes were identified. These genes determine resistance to antiseptics, disinfectants and sulfonamides, respectively, (27).
The aadA genes were first described in 1985 (28). Some studies have shown the presence of aadA cassettes within class1 integrons that encode aminoglycoside 3’-9-adenylyltransferases that are responsible for streptomycin and spectinomycin resistance. Moreover, earlier study has shown that the aadA gene is highly conserved among STEC (29, 30).
Although streptomycin and spectinomycin have not been widely prescribed, aadA gene cassettes within integrons have been reported worldwide recently (12, 29). This confirms the fact that gene cassettes from the insert region of integrons are excised as covalently closed circles (31).
The cassettes with dfrA gene represented 100% of all EPEC strains that class 1 integrons found in them. dfr gene, which codes for dihydrofolate reductase, confer resistance to trimethoprim that it used largely to treat several infections caused by E. coli in Iran and other developing countries. Therefore, these cassettes are able to become more prevalent. Previously, the role of these gene cassettes in resistance to trimethoprim have been mentioned clearly (12). dfrA12, orfF, and aadA2 cassettes have become globally disseminated (30,32). This cassette confers resistance to trimethoprim, streptomycin, and spectinomycin. Interestingly, these cassettes have detected in variety of gram negative bacteria such as E. coli, Salmonella and Seratia marcesens (29, 32). Our present study showed high frequency of gene cassettes carrying dfrA gene among EPEC strains. In previous studies in Iran, the most prevalent gene cassettes among Salmonella enteritidis and Pseudomonas aeruginosa isolates were aadA6-orfD (33, 34).
It is important to focus on these findings that all of multiple drug resistance of EPEC strains in this study demonstrated the presence of integrons carrying antimicrobial resistance gene cassettes. Furthermore, these strains showed resistant to kanamycin and tetracycline that are prescribed to treatment of drug resistant diarrhea. The combination of these findings shows an increasing problem in EPEC strains. Due to antibiotic selective pressures, these resistant EPEC strains could become predominant and colonize easily the gastrointestinal tracts of children. Low level of antibiotic resistance among EPEC strains in this study in compare to detected gene cassettes in class 1 integrons may be due to their gene expression.
Overall, these results indicate the widespread distribution of class 1 integrons containing gene cassettes conferring resistance to trimethoprim, streptomycin, and spectinomycin among EPEC strains. These gene cassettes are potentially capable of transmitting resistance determinants to other EPEC strains or to other types of E.coli. Moreover, bacterial strains bearing integrons might become resistant to third generation cephalosporins (35). This transmission of resistant is a serious threat to containment of infectious diseases caused by E. coli.
References
- 1.Ochoa TJ, Barletta F, Contreras CA, Mercado E. New insights into the epidemiology of enteropathogenic Escherichia coli infection. Trans R Soc Trop Med Hyg. 2008;102:852–856. doi: 10.1016/j.trstmh.2008.03.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Ochoa TJ, Contreras CA. Enteropathogenic Escherichia coli infection in children. Curr Opin Infect Dis. 2011;24:478–483. doi: 10.1097/QCO.0b013e32834a8b8b. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Robins-Browne RM, Levine MM, Rowe B, Gabriel EM. Failure to detect conventional enterotoxins in classical Enteropathogenic (serotyped) Escherichia coli strains of proven pathogenicity. Infect Immun. 1982;38:798–801. doi: 10.1128/iai.38.2.798-801.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Aslani MM, Alikhani MY. Serotypes of enteropathogenic Escherichia coli isolated from children under 5 years of age. Iranian J Public Health. 2009;38:70–77. [Google Scholar]
- 5.Clarke SC. Diarrhoeagenic Escherichia coli—an emerging problem? Diagn Microbiol Infect Dis. 2001;41:93–98. doi: 10.1016/s0732-8893(01)00303-0. [DOI] [PubMed] [Google Scholar]
- 6.Paton JC, Paton AW. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin Microbiol Rev. 1998;11:450–479. doi: 10.1128/cmr.11.3.450. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Oteo J, Pérez-Vázquez M, Campos J. Extended-spectrum [beta]-lactamase producing Escherichia coli: changing epidemiology and clinical impact. Curr Opin Infect Dis. 2010;23:320–6. doi: 10.1097/qco.0b013e3283398dc1. [DOI] [PubMed] [Google Scholar]
- 8.Hong T, Moland ES, Abdalhamid B, Hanson ND, Wang J, Sloan C, et al. Escherichia coli: development of carbapenem resistance during therapy. Clin Infect Dis. 2005;40:e84–e86. doi: 10.1086/429822. [DOI] [PubMed] [Google Scholar]
- 9.Nordmann P, Naas T, Poirel L. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis. 2011;17:1791–1798. doi: 10.3201/eid1710.110655. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Fluit AC, Schmitz FJ. Class 1 integrons, gene cassettes, mobility, and epidemiology. Eur J Clin Microbiol Infect Dis. 1999;18:761–770. doi: 10.1007/s100960050398. [DOI] [PubMed] [Google Scholar]
- 11.Rowe-Magnus DA, Mazel D. The role of integrons in antibiotic resistance gene capture. Int J Med Microbiol. 2002;292:115–125. doi: 10.1078/1438-4221-00197. [DOI] [PubMed] [Google Scholar]
- 12.White PA, McIver CJ, Rawlinson WD. Integrons and gene cassettes in the Enterobacteriaceae. Antimicrob Agents Chemother. 2001;45:2658–2661. doi: 10.1128/AAC.45.9.2658-2661.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Andrysiak AK, Olson AB, Tracz DM, Dore K, Irwin R, Ng LK, et al. Genetic characterization of clinical and agri-food isolates of multi drug resistant Salmonella enterica serovar Heidelberg from Canada. BMC Microbiology. 2008;8:89. doi: 10.1186/1471-2180-8-89. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. CLSI M100-S20U. Clinical and Laboratory Standards Institute; Wayne, PA: Update June 2010. [Google Scholar]
- 15.Clinical and Laboratory Standards Institute. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. 8. Clinical and Laboratory Standards Institute; Wayne, PA: 2009. Approved standard M07-A8. [Google Scholar]
- 16.Alikhani MY, Mirsalehian A, Aslani MM. Detection of typical and atypical enteropathogenic Escherichia coli (EPEC) in Iranian children with and without diarrhoea. J Med Microbiol. 2006;55:1159–1163. doi: 10.1099/jmm.0.46539-0. [DOI] [PubMed] [Google Scholar]
- 17.Estrada-García T, Cerna JF, Paheco-Gil L, Velázquez RF, Ochoa TJ, Torres J, et al. Drug-resistant diarrheogenic Escherichia coli, Mexico. Emerg Infect Dis. 2005;11:1306–1308. doi: 10.3201/eid1108.050192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Jenkins C, Lawson AJ, Cheasty T, Willshaw GA, Wright P, Dougan G, et al. Subtyping intimin genes from enteropathogenic Escherichia coli associated with outbreaks and sporadic cases in the United Kingdom and Eire. Mol Cell Probes. 2003;17:149–156. doi: 10.1016/s0890-8508(03)00046-x. [DOI] [PubMed] [Google Scholar]
- 19.Yatsuyanagi J, Saito S, Sato H, Miyajima Y, Amano K, Enomoto K. Characterization of enteropathogenic and enteroaggregative Escherichia coli isolated from diarrheal outbreaks. J Clin Microbiol. 2002;40:294–297. doi: 10.1128/JCM.40.1.294-297.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Gomes TA, Hernandes RT, Torres AG, Salvador FA, Guth BE, Vaz TM, et al. Adhesin-encoding genes from Shiga toxin-producing Escherichia coli are more prevalent in atypical than in typical enteropathogenicE. coli. J Clin Microbiol. 2011;49:3334–3337. doi: 10.1128/JCM.00779-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Tennant SM, Tauschek M, Azzopardi K, Bigham A, Bennett-Wood V, Hartland EL, et al. Characterization of atypical enteropathogenic E. coli strains of clinical origin. BMC Microbiol. 2009;9:117. doi: 10.1186/1471-2180-9-117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Moreira FC, Vieira MA, Ferreira AJ, Girão DM, Vaz TM, Rosa AC, et al. Escherichia coli strains of serotype O51:H40 comprise typical and atypical enteropathogenic E. coli strains and are potentially diarrheagenic. J Clin Microbiol. 2008;46:1462–1465. doi: 10.1128/JCM.01854-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Shahcheraghi F, Nasiri S, Noveiri H. The Survey of Genes Encoding Beta-Lactamases, in Escherichia Coli Resistant to Beta-Lactam and Non-Beta-Lactam Antibiotics. Iran J Basic Med Sci. 2009;13:230–237. [Google Scholar]
- 24.Nguyen TV, Le PV, Le CH, Weintraub A. Antibiotic resistance in diarrheagenic Escherichia coli and Shigella strains isolated from children in Hanoi Vietnam. Antimicrob Agents Chemother. 2005;49:816–819. doi: 10.1128/AAC.49.2.816-819.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Scaletsky ICA, Souza TB, Orand KRS, Okeke IN. Genetic elements associated with antimicrobial resistance in enteropathogenic Escherichia coli (EPEC) from Brazil. BMC Microbiol. 2010;10:25–29. doi: 10.1186/1471-2180-10-25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Aslani MM, Salmanzadeh-ahrabi S, Alikhani MY, Jafari F, Zali MR, Mani M. Molecular detection and antimicrobial resistance of diarrheagenic Escherichia coli strains isolated from diarrheal cases. Saudi Med J. 2008;29:388–392. [PubMed] [Google Scholar]
- 27.Paulsen IT, Littlejohn TG, Rådström P, Sundström L, Sköld O, Swedberg G, et al. The 3′ conserved segment of integrons contains a gene associated with multidrug resistance to antiseptics and disinfectants. Antimicrob Agents Chemother. 1993;37:761–768. doi: 10.1128/aac.37.4.761. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Hollingshead S, Vapnek D. Nucleotide sequence analysis of a gene encoding a streptomycin/spectinomycin adenyltransferase. Plasmid. 1985;13:17–30. doi: 10.1016/0147-619x(85)90052-6. [DOI] [PubMed] [Google Scholar]
- 29.Zhao S, White DG, Ge B, Ayers S, Friedman S, English L, et al. Identification and characterization of integron-mediated antibiotic resistance among Shiga toxin-producing Escherichia coli isolates. Appl Environ Microbiol. 2001;67:1558–1564. doi: 10.1128/AEM.67.4.1558-1564.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Gestal AM, Stokes HW, Partridge SR, Hall RM. Recombination between the dfrA12-orfF-aadA2 cassette array and an aadA1 gene cassette creates a hybrid cassette, aadA8b. Antimicrob Agents Chemother. 2005;49:4771–4774. doi: 10.1128/AAC.49.11.4771-4774.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Collis CM, Hall RM. Gene cassettes from the insert region of integrons are excised as covalently closed circles. Mol Microbiol. 1992;6:2875–2885. doi: 10.1111/j.1365-2958.1992.tb01467.x. [DOI] [PubMed] [Google Scholar]
- 32.Krauland MG, Marsh JW, Paterson DL, Lee H. Integron-mediated Multidrug Resistance in a Global Collection of Nontyphoidal Salmonella enterica Isolates. Emerg Infect Dis. 2009;15:388–396. doi: 10.3201/eid1503.081131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Firoozeh F, Zahraei-Salehi T, Shahcheraghi F, Karimi V, Aslani MM. Characterization of class I integrons among Salmonella enterica serovar Enteritidis isolated from humans and poultry. FEMS Immunol Med Microbiol. 2012;64:237–243. doi: 10.1111/j.1574-695X.2011.00883.x. [DOI] [PubMed] [Google Scholar]
- 34.Shahcheraghi F, Badmasti F, Feizabadi MM. Molecular characterization of class1 integrons in MDR Pseudomonas aeruginosa isolated from clinical settings in Iran Tehran. FEMS Immunol Med Microbiol. 2010;58:421–425. doi: 10.1111/j.1574-695X.2009.00636.x. [DOI] [PubMed] [Google Scholar]
- 35.Poirel L, Weldhagen GF, De Champs C, Nordmann P. A nosocomial outbreak of Pseudomonas aeruginosa isolates expressing the extended-spectrum beta-lactamase GES-2 in South Africa. J Antimicrob Chemother. 2002;49:561–565. doi: 10.1093/jac/49.3.561. [DOI] [PubMed] [Google Scholar]
- 36.Gunzburg ST, Tornieporth NG, Riley LW. Identification of EPEC by PCR-based detection of the bundle-forming pilus gene. J Clin Microbiol. 1995;33:1375e7. doi: 10.1128/jcm.33.5.1375-1377.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Beaudry M, Zhu C, Fairbrother JM, Harel J. Genotypic and phenotypic characterization of Escherichia coli isolates from dogs manifesting attaching and effacing lesions. J Clin Microbiol. 1996;34:144–148. doi: 10.1128/jcm.34.1.144-148.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Levesque C, Piche L, Larose C, Roy PH. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother. 1995;39:185–191. doi: 10.1128/aac.39.1.185. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Baggesen DL, Sandvang D, Aarestrup FM. Characterization of Salmonella enterica serovar Typhimurium DT104 isolated from Denmark and comparison with isolates from Europe and the United States. J Clin Microbiol. 2000;38:1581–1586. doi: 10.1128/jcm.38.4.1581-1586.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]