Skip to main content
VA Author Manuscripts logoLink to VA Author Manuscripts
. Author manuscript; available in PMC: 2015 Apr 16.
Published in final edited form as: Reproduction. 2014 Mar 31;148(1):21–31. doi: 10.1530/REP-13-0602

Effects of IL8 and Immune Cells on the Regulation of Luteal Progesterone Secretion‡

Heather Talbott 1,2,*, Abigail Delaney 2,*, Pan Zhang 2, Yangsheng Yu 3, Robert A Cushman 4, Andrea Cupp 5, Xiaoying Hou 2, John S Davis 6,§
PMCID: PMC4400113  NIHMSID: NIHMS582862  PMID: 24686456

Abstract

Recent studies suggest that chemokines may mediate the luteolytic action of PGF2α (PGF). Our objective was to identify chemokines induced by PGF in vivo and to determine the effects of IL8 on specific luteal cell types in vitro. Midcycle cows were injected with saline or PGF, ovaries were removed after 0.5 – 4 h and chemokine expression was analyzed by qPCR. In vitro expression of IL8 was analyzed after PGF administration and with cell signaling inhibitors to determine the mechanism of PGF-induced chemokine expression. Purified neutrophils were analyzed for migration and activation in response to IL8 and PGF. Purified luteal cell types (steroidogenic, endothelial and fibroblast cells) were used to identify which cells respond to chemokines. Neutrophils and peripheral blood mononuclear cells (PBMCs) were co-cultured with steroidogenic cells to determine their effect on progesterone production. IL8, CXCL2, CCL2, and CCL8 transcripts were rapidly increased following PGF treatment in vivo and. The stimulatory action of PGF on IL8 mRNA expression in vitro was prevented by inhibition of p38 and JNK signaling. IL8, but not PGF, TNF, or TGFB1, stimulated neutrophil migration. IL8 had no apparent action in purified luteal steroidogenic, endothelial, or fibroblast cells, but IL8 stimulated ERK phosphorylation in neutrophils. In co-culture experiments neither IL8 nor activated neutrophils altered basal or LH-stimulated luteal cell progesterone synthesis. In contrast, activated PBMCs inhibited LH-stimulated progesterone synthesis from cultured luteal cells. These data implicate a complex cascade of events during luteolysis involving chemokine signaling, neutrophil recruitment, and immune cell action within the corpus luteum.

Introduction

The corpus luteum develops after ovulation and secretes progesterone, a steroid hormone essential for the establishment and maintenance of early pregnancy (Niswender et al. 2000, Stocco et al. 2007). In the absence of hormonal cues or pregnancy the corpus luteum will regress in a process termed luteolysis. In many species, luteolysis is mediated by uterine and/or intraluteal release of prostaglandin F2 alpha (PGF) (Davis & Rueda 2002, Wiltbank & Ottobre 2003, Niswender et al. 2007, Bogan et al. 2008). PGF has been shown to act indirectly at the vascular level to cause disruption of luteal capillaries (Maroni & Davis 2011) and apoptosis of capillary endothelial cells (Henkes et al. 2008). PGF has also been implicated in the initiation of luteal cell apoptosis in vivo (Davis & Rueda 2002, Quirk et al. 2013); however, PGF alone cannot directly reduce the viability of luteal cells in vitro (Davis & Rueda 2002, Kawaguchi et al. 2013). Thus, other mechanisms must be activated for luteolysis to proceed through both the functional (loss of progesterone secretion) and structural (apoptosis and tissue remodeling) stages of regression.

Immune cells and their effector cytokines participate in various reproductive processes (Pate & Landis Keyes 2001, Skarzynski 2008, Shirasuna et al. 2012a, 2012b) including: ovulation (Vinatier et al. 1995, Ujioka et al. 1998), endometrial function (Braundmeier et al. 2012, Care et al. 2013), as well as corpus luteum formation and regression (Erlebacher et al. 2004, Skarzynski 2008, Shirasuna et al. 2012a, 2012b, 2012c, Care et al. 2013). Interleukin 8 (IL8, also known as CXCL8) is a known chemotactic cytokine secreted by a variety of cells in response to inflammatory stimuli. IL8 secretion is implicated in the recruitment and activation of neutrophils (Mukaida 2000, 2003), including within the corpus luteum (Polec et al. 2009, Jiemtaweeboon et al. 2011, Shirasuna et al. 2012a). In rabbits, neutralization of IL8 suppresses neutrophil activation and ovulation (Ujioka et al. 1998). Recent studies also indicate that neutrophils and IL8 are involved in establishment of the corpus luteum following ovulation. IL8 and neutrophils are known to promote angiogenesis (Heidemann et al. 2003, Li et al. 2003) findings which have been recently extended to the developing corpus luteum (Jiemtaweeboon et al. 2011, Nitta et al. 2011, Shirasuna et al. 2012b, 2012c). IL8 is also capable of stimulating progesterone secretion by luteinizing granulosa (Shimizu et al. 2012) and theca cells (Shimizu et al. 2013).

Our objective was to identify chemokines induced by PGF in vivo and to determine the effect of IL8 on specific luteal cell types in vitro. We also employed co-cultures to evaluate the effects of immune cells on luteal progesterone synthesis. The present study demonstrates that PGF stimulates the expression of IL8, CCL8, CCL2 and CXCL2. While IL8 was effective at recruitment of neutrophils, neither IL8 nor activated neutrophils reduced LH-stimulated luteal progesterone synthesis. In contrast, activated polymorphic mononuclear cells (PBMCs) inhibited LH-stimulated progesterone by luteal cells in vitro. The activation of immune cells during luteolysis may be involved in the regression of the bovine corpus luteum.

Materials and Methods

In vivo Studies

All animal procedures were conducted under an IACUC-approved protocol and performed at the University of Nebraska-Lincoln, Animal Sciences Department. Post-pubertal female cattle of composite breeding age were given an intramuscular injection at midcycle (days 9–10) with saline (n = 3) or 25 mg of the PGF analogue, Lutalyse (Pharmacia & Upjohn Company, New York, NY, n = 12). Ovariectomies were performed at 0.5, 1, 2, and 4 h after PGF treatment and RNA was isolated from the corpora lutea using an Absolutely mRNA Purification Kit (Agilent Technologies Inc., Santa Clara, CA.) according to the manufacturer’s instructions. RNA yields were measured using a fluorescence detection kit (RiboGreen; Invitrogen, Carlsbad, CA). Screening with whole-transcript bovine microarray (Affymetrix, Santa Clara, CA) revealed several chemokines that were induced following treatment with PGF. Quantitative real-time PCR (qPCR) was used to validate changes in IL8, CCL2, CCL8, and CXCL2 mRNA using the primers provided in Table 1. First-strand cDNA was synthesized from 1 μg total RNA using iScript™ cDNA synthesis kit (Bio-Rad, Hercules, CA) according to the manufacturers’ instructions. qPCR was performed using the CFX96™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA) with ssoFast™ EvaGreen® Supermix (Bio-Rad, Hercules, CA) with the following parameters: 95 °C for 30 s followed by 40 cycles of: 95 °C for 5 s, and 55 °C for 5 s. ACTB or GADPH were used as internal standards of mRNA expression. The authenticity of the PCR signal was verified by reactions containing no RNA or reactions omitting reverse transcriptase. Melt curve analysis was performed to ensure amplification of a single product at the predicted melting temperature.

Table 1.

Bovine primers for qPCR.

Gene Name Primers for qPCR
ACTB-F ACACCGCAACCAGTTCGCCAT
ACTB-R AAGACGGCCCGGGGAGCATC
IL8-F TGTGAAGCTGCAGTTCTGTCAAG
IL8-R TGCACCCACTTTTCCTTGGGGT
GAPDH-F AGATGGTGAAGGTCGGAGTG
GAPDH-R GATCTCGCTCCTGGAAGATG
CCL2-F TGCTCGCTCAGCCAGATGCAAT
CCL2-R GGACACTTGCTGCTGGTGACTCT
bCCL8-F TCTCAGGCTGAAGCCCCCGT
CCL8-R ACTGAATCTGGCTGAGCGAGCA
CXCL2-F GCGCCCGTGGTCAACGAACT
CXCL2-R AGACTGGCTATGACTTCGGTTTGGT

In vitro Studies

All cell culture experiments described below were done in tissue culture plastic (Corning CoStar, Corning, NY) and included penicillin (100 IU/ml, Gibco Life Technologies, Carlesbad, CA) streptomycin (100 μg/ml, Gibco Life Technologies, Carlesbad, CA), and amphotericin (50 μg/ml, MP Biomedicals, Santa Ana, CA) in cell culture medium to prevent bacterial and fungal growth.

Isolation of Bovine Luteal cells

Bovine ovaries were collected from a local abattoir (XL Four Star Beef, Omaha, NE). The tissue was obtained from cows during early pregnancy (fetal crown rump length < 10 cm) to assure luteal function (Ireland et al. 1980). The luteal tissue was dissected from the ovary and dissociated with 103 IU/mL collagenase (Atlanta Biologicals, Norcross, GA) as described previously (Chakravorty et al. 2013). Luteal cell viability was determined using trypan blue exclusion, and luteal cell preparations with more than 90% viability were used. Enriched bovine steroidogenic luteal cells (1 × 105 cells/cm2) were plated as previously described (Hou et al. 2010). Cells were incubated overnight in medium 199 (M199, Lonza, Basel, Switzerland) supplemented with 5% fetal bovine serum (FBS, Valley Biomedical, Winchester, VA). The next day the medium was changed and the incubations were continued for 1 day in FBS-free media. On the day of the experiment, the medium was replaced with fresh FBS-free medium for 2–3 h to pre-equilibrate before applying the treatments detailed in the figure legends.

Isolation of Bovine Endothelial and Fibroblast cells

Endothelial cells were isolated from bovine corpus luteum of early pregnancy and purified as described before (Maroni & Davis 2011). Endothelial cells were positive for vascular endothelial cell cadherin (VE-cadherin) and negative for steroidogenic enzymes and prolyl 4-hydroxylase (antibodies are listed in Table 2). Cells were grown to ~80% confluence in Dulbecco’s Modified Eagle Medium (DMEM, Corning CellGro, Corning, NY) containing 10% FBS and 20 μg/ml endothelial cell growth supplement (ECGS, Millipore, Bedford, MA). The medium was changed to serum-free DMEM containing 20 μg/ml ECGS for 2 h prior to the treatments described in the figure legends.

Table 2.

Antibodies used for cell signaling, western blots, and flow analysis

Antibody Vendor
VE-cadherin Pierce Rockford, IL
StAR Douglas Stocco, PhD Texas Tech Univ
3β-HSD Ian Mason, PhD Dallas, TX
P450scc Millipore Danvers, MA
Prolyl 4-hydroxylase Acris Brisbane, QLD
Collagen 1 Rockland Monoclonal Gilbertsville, PA
Phospho ERK1/2 Cell Signaling Danvers, MA
Phospho p38 Cell Signaling Danvers, MA
Phospho JNK Santa Cruz Santa Cruz, CA
Phospho AKT Cell Signaling Danvers, MA
Phospho P65-NFκB Cell Signaling Danvers, MA
IκBα Santa Cruz Santa Cruz, CA
B-Actin Sigma Aldrich St. Louis, MO

Fibroblasts were isolated from the bovine corpus luteum and characterized as previously described (Maroni & Davis 2012). The fibroblasts were positive for prolyl 4-hydroxylase and collagen 1 and negative for steroidogenic enzymes and VE-cadherin (antibodies listed in Table 2). Luteal fibroblasts were grown to ~80% confluence and changed to serum-free DMEM for 2 h prior to treatment with IL8 as described in the figure legends.

Isolation of bovine neutrophils and migration assays

Potassium EDTA (Sigma-Aldrich, St. Louis, MO)-anticoagulated bovine blood samples were collected from a local abattoir (XL Four Star Beef, Omaha, NE), centrifuged, and subjected to Percoll gradient (Sigma-Aldrich, St. Louis, MO) separation to isolate neutrophils. The remaining erythrocytes were lysed by rapid treatment with dH2O and the remaining cells were resuspended in Roswell Park Memorial Institute 1640 medium (RPMI, Thermo Fisher Scientific HyClone, Waltham, MA). Cell migration was assayed using the Boyden chamber method. Bovine neutrophils (2.5 × 105) were seeded in transparent PET membrane cell culture inserts with 3 μm pores (B&D Falcon, Franklin Lakes, NJ) placed in 24-well plates. The lower chamber was filled with 500 μl RPMI with or without 30 ng/mL IL8 (R&D Systems, Minneapolis, MN), 100 nM PGF2α, 10 ng/ml tumor necrosis factor alpha (TNF, R&D Systems, Minneapolis, MN) or 1 ng/ml transforming growth factor beta 1 (TGFB1). Cell migration was carried out for up to 24 h at 37 °C. Migrated cells were counted with a hemacytometer.

To determine the signaling pathways used by IL8 in bovine neutrophils, we treated neutrophils with IL8 or TNF (R&D Systems, Minneapolis, MN), a modulator of immune function and activator of multiple signaling pathways. Western blot analysis was performed to examine the mitogen-activated protein kinase (ERK1/2, p38 and JNK), AKT and NFκB signaling pathways using phospho-specific antibodies. See Table 2 for a complete list of antibodies used.

Isolation of human neutrophils and degranulation assays

Human neutrophils were isolated from peripheral blood of healthy donors by density gradient centrifugation under an approved IRB at the University of Nebraska Medical Center, using polymorphprep (Axis-Shield, Oslo, Norway) in accordance with manufacturer’s instruction. Purified neutrophils were re-suspended in RPMI + 5% FBS. Neutrophils (3 × 105 cells) were incubated with different concentrations of IL8 at 37 °C for 1 h. Neutrophil degranulation was examined by florescence-activated cell sorting for increased cell surface expression of granule molecules carcinoembryonic antigen-related cell adhesion molecule 8 (CD66b); and integrin alpha M (CD11b). Cells were stained with fluorescein isothiocynate (FITC)-conjugated mouse anti-human CD66b antibody and allophycocyanin (APC)-conjugated mouse anti-human CD11b antibody on ice for 30 min. After rinsing, cells were fixed with PBS plus 2% formaldehyde. Flow cytometry analysis was done using a Becton Dickinson (Franklin Lakes, NJ) FACSCaliber flow cytometer and was performed at the UNMC Cell and Tissue Analysis Facility.

Isolation of bovine peripheral blood mononuclear cells

Acid citrate dextrose-anticoagulated blood samples from cows were collected from a local abattoir (XL Four Star Beef, Omaha, NE). Blood was then diluted 1:2 in cold Hank’s Balance Salt Solution (HBSS, Corning CellGro, Corning, NY) with 2 mM EDTA (Sigma-Aldrich, St. Louis, MO) and 5% FBS. Diluted blood was underlayed with an equal volume of Histopaque (specific gravity = 1.083, Sigma-Aldrich, St. Louis, MO) and centrifuged at 900 × g for 30 min. PBMCs were collected from interface between the plasma and Histopaque. The cells were then washed in HBSS three times before use.

Co-culture experiments

Enriched bovine steroidogenic luteal cells were plated (~1 × 105 cells/cm2) in basal M199 medium containing 5% FBS in 48-well plates overnight as described above.

Neutrophil-luteal cell co-culture

Neutrophils were isolated on the same day that luteal cells were prepared. Purified neutrophils were then cultured in RPMI (10% FBS) with or without 30 ng/ml IL8 and 20 nM phorbol myristate acetate (PMA, EMD Millipore Calbiochem, Billerica, MA) overnight. After 24 h the medium was replaced on the luteal cell cultures. Neutrophils (250,000 cells/ml) were then added to the luteal cells in M199 and RPMI (1:1) with 10% FBS for 2 h before adding control media or 10 ng/ml bLH (Tucker Endocrine Research Institute, Atlanta, GA). Medium from each well was collected 6 hours after LH or control treatments for progesterone analysis.

PBMC-luteal cell co-culture

Twenty-four hours after plating the luteal cells, the medium was removed from the culture wells and replaced with fresh M199. Then an equal volume of newly isolated bovine PBMCs in RPMI (100,000 cells/ml) were added to the luteal cell culture. Co-cultures were incubated for 24 h in M199 and RPMI (1:1 ratio) + 10% FBS, and with or without 10 μg/ml concavalin A (Sigma, St. Louis, MO) to activate the PBMCs. After 24 h of co-culture, medium was replaced with M199:RPMI + 10% FBS for 2 h to pre-equilibrate the cells before the addition of control media or 10 ng/ml LH. Medium was removed from each well after 6 h of control or LH treatment for progesterone analysis.

Western blot analysis

Cultures of neutrophils, steroidogenic cells, luteal endothelial cells, and luteal fibroblasts were harvested with ice cold cell lysis buffer [20 mM Tris-HCl (pH = 7), 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% Triton X-100 and protease and phosphatase inhibitor cocktails (Sigma-Aldrich, St. Louis, MO)]. Protein concentration was determined and 40–60 μg protein was subjected to 10% SDS-PAGE. After transfer to polyvinylidene fluoride (PVDF) membranes, the membranes were probed with appropriate amounts of primary antibodies and bound antibodies were detected with a horse radish peroxidase (HRP) conjugated secondary antibody and the Femto Western Blotting Detection Kit (GE Healthcare Amersham, Cleveland, OH). Signals were visualized using a Digital Sciences Image Station 440 (Kodak, Rochester, NY).

Progesterone Analysis

Conditioned media were collected for progesterone determination using Coat-A-Count progesterone RIA kit (Siemens, Deerfield, IL) according to the manufacturer’s instructions and as previously reported (Hou et al. 2010).

Statistical Analysis

All experiments were performed at least two times using different cell preparations with qualitatively comparable results. The data are presented as representative experiments or as the means ± SEM of the averages from multiple experiments. The differences in means were analyzed by t test or ANOVA followed by multiple range testing. P < 0.05 was considered statistically significant.

Results

PGF Stimulates Chemokine Gene Expression In Vivo

Treatment with PGF in vivo resulted in a 4.3 ± 1.0-fold increase in IL8 mRNA within 30 min and a 8.9 ± 2.2-fold increase in IL8 mRNA within 1 h of administration (Figure 1A). Treatment with PGF also increased CCL8, CXCL2, and CCL2 mRNA after 1 h (fold increases of 2.5 ± 0.6; 2.9 ± 0.7 and 3.1 ± 0.6, respectively). After a brief lag the expression of chemokine mRNA increased dramatically after 4 h of treatment with PGF. A 35 ± 4 fold increase in IL8 mRNA expression was observed in response to a 4 h treatment with PGF. At the 4 h mark PGF also stimulated significant (P < 0.05) increases in CCL8, CCL2 and CXCL2 mRNA expression (29 ± 3.8, 12 ± 1.5 and 6.4 ± 1 fold, respectively).

Figure 1. Induction of chemokines following treatment with PGF in vivo and in vitro.

Figure 1

A) Midluteal phase cows were treated with saline or the PGF analogue Lutalyse (25 mg) for up to 4 h. Ovaries were surgically removed and RNA was isolated from corpora lutea. Quantitative real-time PCR was performed. Results are shown as means ± SEM, n = 3. B) To determine the cellular signaling pathway leading to the induction of IL8 mRNA, bovine steroidogenic luteal cells were pre-treated for 60 min with vehicle, the ERK1/2 inhibitor U0126 (20 μM), the p38 MAPK inhibitor SB207580 (10 μM) or the JNK inhibitor SP600125 (20 μM). Luteal cells were then treated with control media (open bars) or PGF (100 nM, solid bars) for 60 min. Quantitative real-time PCR for IL8 mRNA was performed. Results are shown as means ± SEM, n = 3. *, P < 0.05; **, P < 0.01; ns, not significant.

PGF Stimulates IL8 Expression In Vitro

Treatment of steroidogenic luteal cells with PGF for 1 h in vitro also increased IL8 mRNA expression (2.7 ± 0.3-fold increase, P < 0.05; Figure 1B). Luteal steroidogenic cells were pretreated in the presence or absence of specific inhibitors of the mitogen-activated protein kinase (MAPK) signaling cascade to determine which intracellular signals contribute to the stimulatory effect of PGF on the induction of IL8 gene expression (Figure 1B). Pretreatment with the ERK1/2 inhibitor U0126 (Enzo Life Sciences, Farmingdale, NY) failed to prevent the stimulatory effect of PGF on IL8 mRNA (Figure 1B). In contrast, inhibition of the stress-activated protein kinase p38 MAPK with SB2037580 resulted in a complete inhibition of the response to PGF. Treatment with the JNK inhibitor SP600125 also resulted in a significant inhibition (77%, P < 0.05) of the PGF-induced increase in IL8 mRNA.

IL8 Induces Migration of Bovine Neutrophils

To determine whether IL8 would affect the function of bovine neutrophils, we purified neutrophils from blood collected at slaughter from cows. As shown in Figure 2A neutrophils stained with hematoxylin and eosin had distinct multi-lobular nuclei, a characteristic of neutrophils. A Boyden chamber assay (Figure 2A) was used to determine whether IL8 or other factors produced during luteolysis could increase migration of bovine neutrophils. We observed that treatment for 18 h with 30 ng/ml IL8 caused a 20-fold (P < 0.05) increase in neutrophil migration. However, treatment of neutrophils with 100 nM PGF under identical conditions had no effect on neutrophil migration (Figure 2B). Migration assays were also performed with other chemokines that have been implicated in luteal regression; namely TNF (Henkes et al. 2008, Skarzynski et al. 2009) and TGFB1 (Maroni & Davis 2011, 2012). In experiments evaluating neutrophil migration during a 3 h treatment period, we found that 30 ng/ml IL8, but not 100 nM PGF, 10 ng/ml TNF, or 1 ng/ml TGFB1, was capable of stimulating migration of neutrophils (Figure 2C).

Figure 2. Stimulatory effects of IL8 on neutrophils.

Figure 2

A) Bovine neutrophils were isolated as described in the Methods. Shown is an H&E stain of the purified bovine neutrophils used in the chemotaxis assay. Neutrophils (105 cells) were placed in the upper chamber of a Boyden apparatus and control media or IL8 (30 ng/ml) was placed in the lower chamber. Cell numbers in the lower chamber were quantified at various intervals. B) Control media (Control), IL8 (30 ng/ml) or PGF (100 nM) was added to the lower chamber and migration of bovine neutrophils was determined after 18 h. Results are shown as means ± SEM, n = 3. *, P < 0.05, vs Control. C) Control media (Control), IL8 (30 ng/ml), PGF (100 nM), TNF (10 ng/ml) or TGFB1 (1 ng/ml) was added to the lower chamber and migration of bovine neutrophils was determined after 3 h. Results are shown as means ± SEM, n = 4 for CTL, IL8, PGF and n=2 for TNF and TGFB1. *, P < 0.05, vs. Control.

Activation of neutrophils results in the rapid cell surface expression of molecules that allows for endothelium attachment for extravasation. Treatment of human neutrophils with increasing concentrations of human IL8 (0–100 ng/ml) resulted in the rapid expression of the cell adhesion molecules CDIIb (integrin alpha-M0, ITGAM) and CD66b (carcinoembryonic antigen-related cell adhesion molecule 8, CEACAM8) as determined by flow cytometry (not shown).

IL8 selectively stimulates signaling in bovine neutrophils

Treatment with IL8 for 15 min stimulated an increase (5-fold, P < 0.05) in ERK1/2 phosphorylation (Figure 3A). The response was transient and returned to control levels within 120 min following IL8 treatment (Figures 3A and 5A). IL8 did not stimulate either the p38 or the JNK MAPK signaling pathways (Figure 3A). TNF was used as a positive control since it activates many signaling pathways in immune cells. In contrast to IL8, TNF provoked sustained ERK phosphorylation, as well as p38 and JNK phosphorylation in bovine neutrophils throughout the 120 min investigated (Figure 3A). IL8 exerted a slight, but consistent, increase in the phosphorylation of p65-NFκB and AKT; whereas, TNF stimulated a robust increase in p65 NFkB and AKT phosphorylation in neutrophils. To determine whether IL8 could similarly stimulate other cells of the corpus luteum, we treated bovine luteal fibroblasts, endothelial cells and steroidogenic cells with IL8 under various treatment times and concentrations. IL8 did not stimulate the phosphorylation of AKT, ERK or NFκB in any of these luteal cell types. As a positive control we observed that TNF stimulated MAPK and NFκB signaling in each cell type examined (data not shown).

Figure 3. IL8 stimulates early signaling responses in bovine neutrophils.

Figure 3

A) Bovine neutrophils were treated without or with IL8 (30 ng/ml) or TNF (10 ng/ml) for 15 or 120 min to identify early cell signaling responses. Western blot analysis was performed using phospho-specific antibodies for ERK, p38 and JNK MAPKs, AKT, and p65 NFκB. B-actin served as a loading control. B) Cells were treated as above and quantitative analysis of phospho-ERK signaling is shown as means ± SEM, n = 4.

Figure 5. IL8 and neutrophils do not inhibit luteal progesterone production.

Figure 5

A) Steroidogenic luteal cells were pretreated with increasing amounts of IL8 (0–30 ng/ml) for 30 min and then treated without (Control) or with LH (10 ng/ml) for 4 h. Progesterone in the media was measured by RIA. Results are shown as means ± SEM, n = 4. B) Steroidogenic luteal cells were co-cultured with bovine neutrophils or activated bovine neutrophils as described in the Methods. Cells were then treated without (Control) or with LH (10 ng/ml) for 4 h. Progesterone in the media was measured by RIA. Results are shown as means ± SEM, n = 3. *, P < 0.05, vs Control; ns, not significant.

In view of the very prominent effect of IL8 on ERK signaling in neutrophils, we tested whether the IL8-induced increase in ERK phosphorylation was associated with the effect of IL8 on neutrophil migration. Pretreatment with 5 μM of U0126, completely blocked the induction of ERK phosphorylation (Figure 4A), but did not prevent the stimulatory effect of IL8 on bovine neutrophil migration (Figure 4B).

Figure 4. IL8 stimulated neutrophil migration is independent of ERK signaling.

Figure 4

A) Neutrophils were pre-treated for 60 min with vehicle or the ERK1/2 inhibitor U0126 (5 μM) prior to treatment for 15 or 60 min with IL8 (30 ng/ml). Western blot analysis was performed for ERK and phospho-ERK. B-actin served as a loading control. B) Neutrophils were placed in a Boydon chamber and pre-treated for 60 min with vehicle or U0126 (5 μM) prior to treatment with IL8 (30 ng/ml). Neutrophil migration was determined after 24 h. Results are shown as means ± SEM, n = 3.

Effect of IL8 and immune cells on progesterone secretion

Experiments were performed to determine whether IL8 altered progesterone secretion. Pretreatment of steroidogenic luteal cells with increasing amounts of IL8 (0–30 ng/ml) did not alter basal or LH-simulated progesterone production in luteal cells (Figure 5A). Next, we co-cultured neutrophils with steroidogenic cells and evaluated the ability of LH to stimulate progesterone secretion. We observed that co-cultures of steroidogenic cells and neutrophils had no effect on the ability of LH to increase progesterone (Figure 5B). Furthermore, co-cultures of steroidogenic cells and activated neutrophils had no effect on basal or LH-stimulated progesterone production.

Co-cultures of steroidogenic cells and PBMCs had no effect on the ability of LH to secrete progesterone (Figure 6). However, LH-stimulated progesterone production was completely abrogated (P < 0.05) in cultures of activated PBMCs and steroidogenic luteal cells (Figure 6).

Figure 6. Co-cultures of luteal cells with activated peripheral blood mononuclear cells (PBMCs) inhibit luteal progesterone production.

Figure 6

Steroidogenic luteal cells were co-cultured with bovine PBMCs or activated PBMCs as described in the Methods. Cells were then treated without (Control) or with LH (10 ng/ml) for 4 h. Progesterone in the media was measured by RIA. Results are shown as means ± SEM, n = 4. Bars with different letters are significantly different, P < 0.05; ns, not significant.

Discussion

For over thirty years the immune system has been postulated as essential for fertility (Espey 1980). The present study provides additional insight into the expression and function of chemokines during luteal regression. We observed that induction of luteal regression in cows with a bolus of PGF in vivo resulted in a rapid increase in the expression of IL8, CCL8, CCL2, and CXCL2. Our findings confirm recent findings by (Shirasuna et al. 2012a) that PGF treatment of dairy cattle increased luteal IL8 mRNA by approximately 4-fold within 30 min. In that study, the fold increase in IL8 mRNA remained constant over a 12 h of period of treatment with PGF. In the present study using beef cattle we observed more robust increases in luteal IL8 mRNA expression; 9-fold increases within 1 h and 35-fold increases after 4 h of PGF treatment. At present it is not clear whether the differences in the magnitude of the responses are due to differences in the cattle breeds or other factors, because there are reported differences in the responses of beef and dairy cattle to synchronization protocols using PGF (Lucy et al. 2001). Based on the pronounced increase in IL8 expression, it was selected for further analysis. We found that IL8 acted directly on neutrophils but had little effect on other cell types in the mid-cycle corpus luteum. Furthermore, co-cultures of luteal cells with activated neutrophils did not alter LH-stimulated progesterone synthesis; whereas co-cultures with activated PBMCs suppressed LH-stimulated progesterone synthesis.

Activation of the PGF receptor rapidly induces calcium mobilization and activation of PKC (Davis et al. 1987). These initial signaling events lead to the activation of ERK1/2 (Chen et al. 1998, Arvisais et al. 2010), p38, and JNK (Yadav et al. 2002, Yadav & Medhamurthy 2006, Mao et al. 2013) in vivo and in vitro, with subsequent activation of multiple transcription factors. The MAPK signaling family induces early-response genes such as FOS and JUN (Chen et al. 2001), NR4A1 (Stocco et al. 2007, Atli et al. 2012), EGR1 (Hou et al. 2008, Atli et al. 2012), and ATF3 (Mondal et al. 2011, Mao et al. 2013) in the corpus luteum. To determine which intracellular signals contribute to the stimulatory effect of PGF on IL8 gene expression, luteal cells were treated with specific inhibitors of ERK1/2, p38, and JNK. We observed that the ERK1/2 inhibitor U0126 had no effect on IL8 mRNA expression in response to PGF, while the p38 MAPK inhibitor SB2037580 and the JNK inhibitor SP600125 significantly inhibited the PGF-mediated upregulation of IL8 mRNA. The results indicate that the stress-activated MAPKs: p38 and JNK play an important and perhaps overlapping role in the induction of IL8 mRNA in response to PGF.

Chemokines like IL8 are responsible for the recruitment of immune cells to chemokine-producing tissues. Our findings demonstrate that IL8 is chemotactic for bovine neutrophils, in agreement with previous literature (Mukaida 2000, 2003, Jiemtaweeboon et al. 2011, Shirasuna et al. 2012a). IL8 stimulated a 6-fold increase in neutrophil migration within 3 h and after 24 h IL8-treatment increased neutrophil migration nearly 20-fold. In contrast, treatment with PGF had no effect on neutrophil migration at either time point. These findings are consistent with the studies by (Liptak et al. 2005, Shirasuna et al. 2012a) showing that immune cells are unresponsive to PGF because they do not express the PGF receptor. In the present study we also report that TNF and TGBF1, two cytokines induced rapidly in the bovine corpus luteum in response to PGF and implicated in events associated with luteal regression (Henkes et al. 2008, Hou et al. 2008, Mondal et al. 2011, Maroni & Davis 2012) did not increase the migration of bovine neutrophils in the Boyden chamber assay. Our observations support the recent reports (Sales et al. 2009, Mondal et al. 2011, Atli et al. 2012, Shirasuna et al. 2012a) showing that PGF induces IL8 mRNA and that the expression of IL8 is associated with the appearance of neutrophils in the bovine corpus luteum (Jiemtaweeboon et al. 2011, Shirasuna et al. 2012a, 2012b). In addition, our studies indicate that IL8 stimulates the degranulation of human neutrophils which may be important for their migration from the blood into the corpus luteum. These findings correspond with the studies of Shirasuna et al. (2012a) demonstrating the rapid appearance of P-selectin on endothelial cells following treatment with PGF, which allows for adhesion of neutrophils to endothelial cells. Other chemokines (CCL8, CCL2, and CXCL2) are induced concomitantly with IL8, therefore it will be important to evaluate the contributions of each individual chemokine to the recruitment of specific immune cells into the regressing corpus luteum. Future experiments should also address how combinations of these chemokines signal the recruitment and activation of immune cells within the corpus luteum (Gouwy et al. 2008).

Treatment of neutrophils with IL8 stimulated a robust increase in ERK phosphorylation, a slight increase in AKT and NFκB phosphorylation, and had no effect on p38 and JNK signaling. In contrast, TNF activated all of these pathways simultaneously in neutrophils. Since ERK signaling was the most prominent pathway activated following IL8 treatment of bovine neutrophils, we determined whether neutrophil migration could be blocked by treatment with the MEK1/2 inhibitor U0126. Interestingly, we found that inhibition of ERK signaling with U0126 had no inhibitory effect on IL8-stimulated neutrophil migration. These results suggest that another signaling pathway is responsible for IL8-stimulated chemotaxis, likely the PI3K and RAC signaling pathway (Neptune et al. 1999, Futosi et al. 2013). Further studies are required to determine the contributions of other signaling pathways to neutrophil activation and migration.

IL8 has been shown to induce diverse cellular responses in cells other than neutrophils (Mukaida 2003). Recent studies suggest that IL8 may contribute to angiogenesis in the newly forming corpus luteum (Jiemtaweeboon et al. 2011) and progesterone secretion by granulosa (Shimizu et al. 2012) and theca (Shimizu et al. 2013) cells. Treatment with various IL8 concentrations and treatment times revealed no changes in cell signaling in steroidogenic cells, endothelial cells, or fibroblasts isolated from the bovine corpus luteum. However, IL8 stimulated a robust increase in ERK phosphorylation in neutrophils. Furthermore, IL8 did not affect basal or LH-stimulated progesterone secretion from cultured luteal cells. In contrast to the findings by Shimizu et al. 2012 using cells from the ovarian follicle, we found no evidence suggesting that IL8 acted directly on bovine luteal cells types that are involved in luteal regression (e.g., endothelial cells, fibroblasts and steroidogenic cells). Based on these findings it appears that IL8 exerts specific effects on ovarian cell types depending on their stage of differentiation. Given that the corpus luteum is highly differentiated and undergoes regression in response to PGF, the lack of a stimulatory effect of IL8 on angiogenesis and steroidogenesis may be expected since the vasculature and steroid secretion are disrupted during regression (Davis & Rueda 2002, Niswender 2002, Stocco et al. 2007, Maroni & Davis 2012). It is possible that during luteal regression IL8-activated neutrophils contribute to phagocytosis during structural regression of the corpus luteum.

The increase observed in multiple chemokines suggests that immune cells other than neutrophils could be recruited in to the corpus luteum following administration of PGF. In fact, studies from multiple laboratories have demonstrated an increase in neutrophils, T cells, or macrophages during the regression of the corpus luteum in rodents (Kuranaga et al. 1999), rabbits (Krusche et al. 2002), ruminants (Murdoch 1987, Penny et al. 1999), primates (Braundmeier et al. 2012) and women (Wang et al. 1992, Best et al. 1996, Gaytan et al. 1998, Suzuki et al. 1998). A previous report indicated that co-culture of rat neutrophils with luteal cells resulted in a decrease in progesterone secretion, presumably as a result of oxidative stress (Behrman et al. 2001). However, under our experimental conditions co-cultures of bovine neutrophils and steroidogenic luteal cells did not alter basal or LH-stimulated progesterone synthesis. Treatment of neutrophils with IL8 and PMA, alone or in combination, to activate neutrophils was not sufficient to reduce progesterone secretion under co-culture conditions. In addition to neutrophils, monocytes are immune effector cells that are also equipped with chemokine receptors and adhesion receptors that mediate migration from blood to tissues (Murray & Wynn 2011). Since we observed that PGF rapidly induced the expression of other chemokines (CCL8, CCL2, and CXCL2), which could recruit other types of immune cells, we established a co-culture system with PBMCs and luteal cells. Although, un-activated PBMCs did not reduce progesterone secretion, we observed that activated PBMCs effectively reduced LH-driven progesterone secretion. These observations support our earlier findings (Liptak et al. 2005) that activated immune cells may contribute a factor (or factors) that impair steroidogenesis in response to LH. It is known that activated monocytes produce inflammatory cytokines, nitric oxide, and reactive oxygen species (Murray & Wynn 2011, Zhou et al. 2014) all of which may contribute individually or in combination to the inhibition of progesterone synthesis (Al-Gubory et al. 2012, Quirk et al. 2013, Skarzynski et al. 2013). In the in vivo setting, activated monocytes may also secrete matrix metalloproteinases that contribute to the degradation of the extracellular matrix (Murray & Wynn 2011), which could facilitate the recruitment of additional inflammatory cells to the regressing corpus luteum.

A complex interaction of endocrine and immune cells appears to be required to mediate the structural and functional regression of the bovine corpus luteum. Since chemokines act synergistically to activate their target cells (Gouwy et al. 2008), additional studies are needed to examine the actions of chemokines as a complex cocktail rather than in isolation, as performed in the present study. The current findings complement a recent review (Walusimbi & Pate 2013) that postulates that immune cells in the developing and functional corpus luteum play a supportive role, but once corpus luteum regression is triggered, the immune cells promote apoptosis, debris clearage and tissue remodeling. Understanding these endocrine and immune events is important for increasing our ability to control reproductive function to facilitate full-term pregnancies in both humans and livestock.

Acknowledgments

Funding

This project was supported by Agriculture and Food Research Initiative Competitive Grant no. 2011-67015-20076 from the USDA National Institute of Food and Agriculture (JSD); the Department of Veterans Affairs (JSD), the National Institutes of Health 1 P01 AG029531; the Olson Center for Women’s Health (AD and JSD), and an Exceptional Incoming Graduate Student Award (HT).

Footnotes

‡

Names are necessary to report factually on available data; however, the USDA neither guarantees nor warrants the standard of the product, and the use of names by the USDA implies no approval of the product to the exclusion of others that may also be suitable.

Declaration of interest

The authors have no declarations of interest to disclose.

References

  1. Al-Gubory KH, Garrel C, Faure P, Sugino N. Roles of antioxidant enzymes in corpus luteum rescue from reactive oxygen species-induced oxidative stress. Reproductive Biomedicine Online. 2012;25:551–60. doi: 10.1016/j.rbmo.2012.08.004. [DOI] [PubMed] [Google Scholar]
  2. Arvisais E, Hou X, Wyatt TA, Shirasuna K, Bollwein H, Miyamoto A, Hansen TR, Rueda BR, Davis JS. Prostaglandin F2α represses IGFI-stimulated IRS1/Phosphatidylinositol-3-Kinase/AKT signaling in the corpus luteum: role of ERK and P70 ribosomal S6 kinase. Molecular Endocrinology. 2010;24:632–643. doi: 10.1210/me.2009-0312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Atli MO, Bender RW, Mehta V, Bastos MR, Luo W, Vezina CM, Wiltbank MC. Patterns of gene expression in the bovine corpus luteum following repeated intrauterine infusions of low doses of prostaglandin F2alpha. Biology of Reproduction. 2012;86:1–13. doi: 10.1095/biolreprod.111.094870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Behrman HR, Kodaman PH, Preston SL, Gao S. Oxidative stress and the ovary. Journal of the Society for Gynecologic Investigation. 2001;8:40–43. doi: 10.1016/s1071-5576(00)00106-4. [DOI] [PubMed] [Google Scholar]
  5. Best CL, Pudney J, Welch WR, Burger N, Hill JA. Localization and characterization of white blood cell populations within the human ovary throughout the menstrual cycle and menopause. Human Reproduction. 1996;11:790–797. doi: 10.1093/oxfordjournals.humrep.a019256. [DOI] [PubMed] [Google Scholar]
  6. Bogan RL, Murphy MJ, Stouffer RL, Hennebold JD. Prostaglandin synthesis, metabolism, and signaling potential in the rhesus macaque corpus luteum throughout the luteal phase of the menstrual cycle. Endocrinology. 2008;149:5861–5871. doi: 10.1210/en.2008-0500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Braundmeier A, Jackson K, Hastings J, Koehler J, Nowak R, Fazleabas A. Induction of endometriosis alters the peripheral and endometrial regulatory T cell population in the non-human primate. Human Reproduction. 2012;27:1712–1722. doi: 10.1093/humrep/des083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Care AS, Diener KR, Jasper MJ, Brown HM, Ingman WV, Robertson, Sarah A. Macrophages regulate corpus luteum development during embryo implantation in mice. The Journal of Clinical Investigation. 2013;123:3472–3487. doi: 10.1172/JCI60561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chakravorty A, Joslyn MI, Davis JS. Characterization of insulin and insulin-like growth factor-I actions in the bovine luteal cell: regulation of receptor tyrosine kinase activity, phosphatidylinositol-3-kinase, and deoxyribonucleic acid synthesis. Endocrinology. 1993;133:1331–1340. doi: 10.1210/endo.133.3.8396016. [DOI] [PubMed] [Google Scholar]
  10. Chen D, Fong HW, Davis JS. Induction of c-fos and c-jun messenger ribonucleic acid expression by prostaglandin F2alpha is mediated by a protein kinase C-dependent extracellular signal-regulated kinase mitogen-activated protein kinase pathway in bovine luteal cells. Endocrinology. 2001;142:887–895. doi: 10.1210/endo.142.2.7938. [DOI] [PubMed] [Google Scholar]
  11. Chen D, Westfall SD, Fong HONW, Roberson MS, Davis JS. Prostaglandin F2 stimulates the Raf/MEK1/Mitogen-Activated Protein Kinase signaling cascade in bovine luteal cells. Endocrinology. 1998;139:3876–3885. doi: 10.1210/endo.139.9.6197. [DOI] [PubMed] [Google Scholar]
  12. Davis JS, Rueda BR. The corpus luteum: an ovarian structure with maternal instincts and suicidal tendencies. Frontiers in Bioscience. 2002;7:1949–1978. doi: 10.2741/davis1. [DOI] [PubMed] [Google Scholar]
  13. Davis JS, Weakland LL, Weiland DA, Farese RV, West LA. Prostaglandin F2a stimulates phosphatidylinositol 4,5-bisphosphate hydrolysis and mobilizes intracellular Ca2″ in bovine luteal cells. Proceedings of the National Academy of Sciences. 1987;84:3728–3732. doi: 10.1073/pnas.84.11.3728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Erlebacher A, Zhang D, Parlow AF, Glimcher LH. Ovarian insufficiency and early pregnancy loss induced by activation of the innate immune system. The Journal of Clinical Investigation. 2004;114:39–48. doi: 10.1172/JCI20645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Espey LL. Ovulation as an inflammatory reaction - a hypothesis. Biology of Reproduction. 1980;22:73–106. doi: 10.1095/biolreprod22.1.73. [DOI] [PubMed] [Google Scholar]
  16. Futosi K, Fodor S, Mócsai A. Neutrophil cell surface receptors and their intracellular signal transduction pathways. International Immunopharmacology. 2013;17:1185–1197. doi: 10.1016/j.intimp.2013.11.010. [DOI] [PubMed] [Google Scholar]
  17. Gaytan F, Morales C, Garcia-Pardo L, Reymundo C, Bellido C, Sanchez-Criado JE. Macrophages, cell proliferation, and cell death in the human menstrual corpus luteum. Biology of Reproduction. 1998;59:417–425. doi: 10.1095/biolreprod59.2.417. [DOI] [PubMed] [Google Scholar]
  18. Gouwy M, Struyf S, Noppen S, Schutyser E, Springael JY, Parmentier M, Proost P, Van Damme J. Synergy between coproduced CC and CXC chemokines in monocyte chemotaxis through receptor-mediated events. Molecular Pharmacology. 2008;74:485–495. doi: 10.1124/mol.108.045146. [DOI] [PubMed] [Google Scholar]
  19. Heidemann J, Ogawa H, Dwinell MB, Rafiee P, Maaser C, Gockel HR, Otterson MF, Ota DM, Lugering N, Domschke W, Binion DG. Angiogenic effects of interleukin 8 (CXCL8) in human intestinal microvascular endothelial cells are mediated by CXCR2. The Journal of Biological Chemistry. 2003;278:8508–8515. doi: 10.1074/jbc.M208231200. [DOI] [PubMed] [Google Scholar]
  20. Henkes LE, Sullivan BT, Lynch MP, Kolesnick R, Arsenault D, Puder M, Davis JS, Rueda BR. Acid sphingomyelinase involvement in tumor necrosis factor a-regulated vascular and steroid disruption during luteolysis in vivo. Proceedings of the National Academy of Sciences. 2008;105:7670–7675. doi: 10.1073/pnas.0712260105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hou X, Arvisais E, Davis J. Luteinizing hormone stimulates mammalian target of rapamycin signaling in bovine luteal cells via pathways independent of AKT and mitogen-activated protein kinase. Endocrinology. 2010;151:2846–2857. doi: 10.1210/en.2009-1032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hou X, Arvisais E, Jiang C, Chen D, Roy SK, Pate JL, Hansen TR, Rueda BR, Davis JS. Prostaglandin F2α stimulates the expression and secretion of transforming growth factor B1 via induction of the early growth response 1 gene (EGR1) in the bovine corpus luteum. Molecular Endocrinology. 2008;22:403–414. doi: 10.1210/me.2007-0272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Ireland JJ, Murphee RL, Coulson PB. Accuracy of predicting stages of bovine estrous cycle by gross appearance of the corpus luteum. Journal of Dairy Science. 1980;63:155–160. doi: 10.3168/jds.S0022-0302(80)82901-8. [DOI] [PubMed] [Google Scholar]
  24. Jiemtaweeboon S, Shirasuna K, Nitta A, Kobayashi A, Schuberth H, Shimizu T, Miyamoto A. Evidence that polymorphonuclear neutrophils infiltrate into the developing corpus luteum and promote angiogenesis with interleukin-8 in the cow. Reproductive Biology and Endocrinology. 2011;9:79. doi: 10.1186/1477-7827-9-79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kawaguchi S, Bowolaksono A, Yoshioka S, Sakumoto R, Okuda K. Luteoprotective mechanisms of prostaglandin F2α stimulated by luteinizing hormone in the bovine corpus luteum. The Journal of Reproduction and Development. 2013;59:2–7. doi: 10.1262/jrd.2012-187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Krusche CA, Vloet TD, Herrler A, Black S, Beier HM. Functional and structural regression of the rabbit corpus luteum is associated with altered luteal immune cell phenotypes and cytokine expression patterns. Histochemistry and Cell Biology. 2002;118:479–489. doi: 10.1007/s00418-002-0471-6. [DOI] [PubMed] [Google Scholar]
  27. Kuranaga E, Kanuka H, Bannai M, Suzuki M, Nishihara M, Takahashi M. Fas/Fas ligand system in prolactin-induced apoptosis in rat corpus luteum: possible role of luteal immune cells. Biochemical and Biophysical Research Communications. 1999;260:167–173. doi: 10.1006/bbrc.1999.0858. [DOI] [PubMed] [Google Scholar]
  28. Li A, Dubey S, Varney ML, Dave BJ, Singh RK. IL-8 directly enhanced endothelial cell survival, proliferation, and matrix metalloproteinases production and regulated angiogenesis. Journal of Immunology. 2003;170:3369–3376. doi: 10.4049/jimmunol.170.6.3369. [DOI] [PubMed] [Google Scholar]
  29. Liptak AR, Sullivan BT, Henkes LE, Wijayagunawardane MPB, Miyamoto A, Davis JS, Rueda BR, Townson DH. Cooperative expression of monocyte chemoattractant protein 1 within the bovine corpus luteum: evidence of immune cell-endothelial cell interactions in a coculture system. Biology of Reproduction. 2005;72:1169–1176. doi: 10.1095/biolreprod.104.032953. [DOI] [PubMed] [Google Scholar]
  30. Lucy M, Billings H, Butler WR, Ehnis LR, Fields MJ, Kesler DJ, Kinder JE, Mattos RC, Short RE, Thatcher WW, Wettemann RP, et al. Efficacy of an intravaginal progesterone insert and an injection of PGF2alpha for synchronizing estrus and shortening the interval to pregnancy in postpartum beef cows, peripubertal beef heifers, and dairy heifers. Journal of Animal Science. 2001;79:982–995. doi: 10.2527/2001.794982x. [DOI] [PubMed] [Google Scholar]
  31. Mao D, Hou X, Talbott H, Cushman R, Cupp A, Davis JS. ATF3 expression in the corpus luteum: possible role in luteal regression. Molecular Endocrinology. 2013;27:2066–2079. doi: 10.1210/me.2013-1274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Maroni D, Davis JS. TGFB1 disrupts the angiogenic potential of microvascular endothelial cells of the corpus luteum. Journal of Cell Science. 2011;124:2501–2510. doi: 10.1242/jcs.084558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Maroni D, Davis JS. Transforming Growth Factor Beta 1 stimulates profibrotic activities of luteal fibroblasts in cows. Biology of Reproduction. 2012;87:1–11. doi: 10.1095/biolreprod.112.100735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mondal M, Schilling B, Folger J, Steibel JP, Buchnick H, Zalman Y, Ireland JJ, Meidan R, Smith GW. Deciphering the luteal transcriptome: potential mechanisms mediating stage-specific luteolytic response of the corpus luteum to prostaglandin F(2)alpha. Physiological Genomics. 2011;43:447–456. doi: 10.1152/physiolgenomics.00155.2010. [DOI] [PubMed] [Google Scholar]
  35. Mukaida N. Interleukin-8: an expanding universe beyond neutrophil chemotaxis and activation. International Journal of Hematology. 2000;72:391–398. [PubMed] [Google Scholar]
  36. Mukaida N. Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases. American Journal of Physiology. Lung Cellular and Molecular Physiology. 2003;284:L566–77. doi: 10.1152/ajplung.00233.2002. [DOI] [PubMed] [Google Scholar]
  37. Murdoch WJ. Treatment of sheep with prostaglandin F2 alpha enhances production of a luteal chemoattractant for eosinophils. American Journal of Reproductive Immunology and Microbiology. 1987;15:52–56. doi: 10.1111/j.1600-0897.1987.tb00152.x. [DOI] [PubMed] [Google Scholar]
  38. Murray P, Wynn T. Protective and pathogenic functions of macrophage subsets. Nature Reviews Immunology. 2011;11:723–737. doi: 10.1038/nri3073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Neptune ER, Iiri T, Bourne HR. Galphai is not required for chemotaxis mediated by Gi-coupled receptors. The Journal of Biological Chemistry. 1999;274:2824–2828. doi: 10.1074/jbc.274.5.2824. [DOI] [PubMed] [Google Scholar]
  40. Niswender GD. Molecular control of luteal secretion of progesterone. Reproduction. 2002;123:333–339. doi: 10.1530/rep.0.1230333. [DOI] [PubMed] [Google Scholar]
  41. Niswender GD, Davis TL, Griffith RJ, Bogan RL, Monser K, Bott RC, Bruemmer JE, Nett TM. Judge, jury and executioner: the auto-regulation of luteal function. Society of Reproduction and Fertility Supplement. 2007;64:191–206. doi: 10.5661/rdr-vi-191. [DOI] [PubMed] [Google Scholar]
  42. Niswender GD, Juengel JL, Silva PJ, Rollyson MK, McIntush EW. Mechanisms controlling the function and life span of the corpus luteum. Physiological Reviews. 2000;80:1–29. doi: 10.1152/physrev.2000.80.1.1. [DOI] [PubMed] [Google Scholar]
  43. Nitta A, Shirasuna K, Haneda S, Matsui M, Shimizu T, Matsuyama S, Kimura K, Bollwein H, Miyamoto A. Possible involvement of IFNT in lymphangiogenesis in the corpus luteum during the maternal recognition period in the cow. Reproduction. 2011;142:879–892. doi: 10.1530/REP-11-0157. [DOI] [PubMed] [Google Scholar]
  44. Pate JL, Landis Keyes P. Immune cells in the corpus luteum: friends or foes? Reproduction. 2001;122:665–676. doi: 10.1530/rep.0.1220665. [DOI] [PubMed] [Google Scholar]
  45. Penny LA, Armstrong D, Bramley TA, Webb R, Collins RA, Watson ED. Immune cells and cytokine production in the bovine corpus luteum throughout the oestrous cycle and after induced luteolysis. Journal of Reproduction and Fertility. 1999;115:87–96. doi: 10.1530/jrf.0.1150087. [DOI] [PubMed] [Google Scholar]
  46. Polec A, Tanbo T, Fedorcsak P. Cellular interaction regulates interleukin-8 secretion by granulosa-lutein cells and monocytes/macrophages. American Journal of Reproductive Immunology. 2009;61:85–94. doi: 10.1111/j.1600-0897.2008.00668.x. [DOI] [PubMed] [Google Scholar]
  47. Quirk SM, Cowan RG, Harman RM. Role of the cell cycle in regression of the corpus luteum. Reproduction. 2013;145:161–75. doi: 10.1530/REP-12-0324. [DOI] [PubMed] [Google Scholar]
  48. Sales KJ, Maldonado-Perez D, Grant V, Catalano RD, Wilson MR, Brown P, Williams ARW, Anderson RA, Thompson EA, Jabbour HN, Maldonado-Pérez D. Prostaglandin F 2 α-F-prostanoid receptor regulates CXCL8 expression in endometrial adenocarcinoma cells via the calcium – calcineurin – NFAT pathway. Biochimica et Biophysica Acta - Molecular Cell Research. 2009;1793:1917–1928. doi: 10.1016/j.bbamcr.2009.09.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Shimizu T, Imamura E, Magata F, Murayama C, Miyamoto A. Interleukin-8 stimulates progesterone production via the MEK pathway in ovarian theca cells. Molecular and Cellular Biochemistry. 2013;374:157–161. doi: 10.1007/s11010-012-1515-4. [DOI] [PubMed] [Google Scholar]
  50. Shimizu T, Kaji A, Murayama C, Magata F, Shirasuna K, Wakamiya K, Okuda K, Miyamoto A. Effects of interleukin-8 on estradiol and progesterone production by bovine granulosa cells from large follicles and progesterone production by luteinizing granulosa cells in culture. Cytokine. 2012;57:175–181. doi: 10.1016/j.cyto.2011.11.007. [DOI] [PubMed] [Google Scholar]
  51. Shirasuna K, Jiemtaweeboon S, Raddatz S, Nitta A, Schuberth HJ, Bollwein H, Shimizu T, Miyamoto A. Rapid accumulation of polymorphonuclear neutrophils in the corpus luteum during prostaglandin F(2alpha)-induced luteolysis in the cow. PloS One. 2012a;7:e29054. doi: 10.1371/journal.pone.0029054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Shirasuna K, Nitta A, Sineenard J, Shimizu T, Bollwein H, Miyamoto A. Vascular and immune regulation of corpus luteum development, maintenance, and regression in the cow. Domestic Animal Endocrinology. 2012b;43:198–211. doi: 10.1016/j.domaniend.2012.03.007. [DOI] [PubMed] [Google Scholar]
  53. Shirasuna K, Shimizu T, Matsui M, Miyamoto A. Emerging roles of immune cells in luteal angiogenesis. Reproduction, Fertility and Development. 2012c;25:351–361. doi: 10.1071/RD12096. [DOI] [PubMed] [Google Scholar]
  54. Skarzynski D. Regulation of luteal function and corpus luteum regression in cows: hormonal control, immune mechanisms and intercellular communication. Reproduction in Domestic Animals. 2008;43:57–65. doi: 10.1111/j.1439-0531.2008.01143.x. [DOI] [PubMed] [Google Scholar]
  55. Skarzynski DJ, Piotrowska KK, Bah MM, Korzekwa A, Woclawek-Potocka I, Sawai K, Okuda K. Effects of exogenous tumour necrosis factor-alpha on the secretory function of the bovine reproductive tract depend on tumour necrosis factor-alpha concentrations. Reproduction in Domestic Animals. 2009;44:371–379. doi: 10.1111/j.1439-0531.2007.01016.x. [DOI] [PubMed] [Google Scholar]
  56. Skarzynski DJ, Piotrowska-Tomala KK, Lukasik K, Galvao A, Farberov S, Zalman Y, Meidan R. Growth and regression in bovine corpora lutea_: regulation by local survival and death pathways. Reproduction in Domestic Animals. 2013;48:25–37. doi: 10.1111/rda.12203. [DOI] [PubMed] [Google Scholar]
  57. Stocco C, Telleria C, Gibori G. The molecular control of corpus luteum formation, function, and regression. Endocrine Reviews. 2007;28:117–149. doi: 10.1210/er.2006-0022. [DOI] [PubMed] [Google Scholar]
  58. Suzuki T, Sasano H, Takaya R, Fukaya T, Yajima A, Date F, Nagura H. Leukocytes in normal-cycling human ovaries: immunohistochemical distribution and characterization. Human Reproduction. 1998;13:2186–2191. doi: 10.1093/humrep/13.8.2186. [DOI] [PubMed] [Google Scholar]
  59. Ujioka T, Matsukawa A, Tanaka N, Matsuura K, Yoshinaga M, Okamura H. Interleukin-8 as an essential factor in the human chorionic gonadotropin-induced rabbit ovulatory process: interleukin-8 induces neutrophil accumulation and activation in ovulation. Biology of Reproduction. 1998;58:526–530. doi: 10.1095/biolreprod58.2.526. [DOI] [PubMed] [Google Scholar]
  60. Vinatier D, Dufour P, Tordjeman-Rizzi N, Prolongeau JF, Depret-Moser S, Monnier JC. Immunological aspects of ovarian function: role of the cytokines. European Journal of Obstetrics & Gynecology and Reproductive Biology. 1995;63:155–168. doi: 10.1016/0301-2115(95)02227-9. [DOI] [PubMed] [Google Scholar]
  61. Walusimbi SS, Pate JL. Physiology and Endocrinology Symposium: Role of immune cells in the corpus luteum. Journal of Animal Science. 2013;91:1650–1659. doi: 10.2527/jas.2012-6179. [DOI] [PubMed] [Google Scholar]
  62. Wang LJ, Pascoe V, Petrucco OM, Norman RJ. Distribution of leukocyte subpopulations in the human corpus luteum. Human Reproduction. 1992;7:197–202. doi: 10.1093/oxfordjournals.humrep.a137616. [DOI] [PubMed] [Google Scholar]
  63. Wiltbank MC, Ottobre JS. Regulation of intraluteal production of prostaglandins. Reproductive Biology and Endocrinology. 2003;2:1–11. doi: 10.1186/1477-7827-1-91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Yadav VK, Medhamurthy R. Dynamic changes in Mitogen-Activated Protein Kinase activities in the corpus luteum of the Bonnet monkey (Macaca radiata) during development, induced luteolysis, and simulated early pregnancy: A role for p38 MAPK in the regulation of luteal function. Endocrinology. 2006;147:2018–2027. doi: 10.1210/en.2005-1372. [DOI] [PubMed] [Google Scholar]
  65. Yadav VK, Sudhagar RR, Medhamurthy R. Apoptosis during spontaneous and prostaglandin F2a-induced luteal regression in the buffalo cow (Bubalus bubalis): Involvement of mitogen-activated protein kinases. Biology of Reproduction. 2002;67:752–759. doi: 10.1095/biolreprod.102.004077. [DOI] [PubMed] [Google Scholar]
  66. Zhou D, Huang C, Lin Z, Zhan S, Kong L, Fang C, Li J. Macrophage polarization and function with emphasis on the evolving roles of coordinated regulation of cellular signaling pathways. Cellular Signalling. 2014;26:192–7. doi: 10.1016/j.cellsig.2013.11.004. [DOI] [PubMed] [Google Scholar]

RESOURCES