Skip to main content
BioMed Research International logoLink to BioMed Research International
. 2015 Apr 6;2015:753710. doi: 10.1155/2015/753710

Prevalence of Helicobacter pylori vacA, cagA, and iceA Genotypes in Cuban Patients with Upper Gastrointestinal Diseases

Onelkis Feliciano 1,*, Oderay Gutierrez 1, Lidunka Valdés 1, Trini Fragoso 2, Ana Maria Calderin 1, Antonio Eduardo Valdes 1, Rafael Llanes 1
PMCID: PMC4402555  PMID: 25945344

Abstract

Virulence factors of Helicobacter pylori can predict the development of different gastroduodenal diseases. There are scarce reports in Cuba about H. pylori isolates genotyping. The aim of the present investigation was to identify allelic variation of the virulence genes vacA, cagA, and iceA in sixty-eight patients diagnosed as H. pylori positive by culture. In seven out of 68 patients, strains from both gastric regions were obtained and considered independent. DNA was extracted from all the H. pylori strains and evaluated by PCR-genotyping. The vacA s1 allele, cagA gene, and iceA2 allele were the most prevalent (72.0%, 56.0%, and 57.3%, respectively). Alleles from m-region showed a similar frequency as s1a and s1b subtypes. The presence of multiple H. pylori genotypes in a single biopsy and two gastric region specimens were found. Significant statistical association was observed between iceA2 allele and patients with non-peptic ulcer dyspepsia (NUD) (P = 0.037) as well as virulence genotypes (s1, s1m2) and patients over 40 years old (P < 0.05). In conclusion, the results demonstrated a high prevalence of H. pylori virulent genotypes in Cuban patients over 40 years old while iceA2 alleles demonstrated a good specificity in patients with NUD.

1. Introduction

Helicobacter pylori is associated with the development of chronic gastritis, peptic ulcer disease (PUD), and gastric cancer (GC). Hence, since 1994, the World Health Organization has classified it as class I carcinogen [1]. Interestingly, despite the high prevalence of H. pylori infection in some countries, the frequency of severe diseases is much lower than other populations. In addition to host factors and diet, the varying outcomes of H. pylori infection could be related to the virulence of H. pylori strains differences [2].

Different virulence factors that play a role in the pathogenesis of the disease such as cytotoxin-associated gene A (CagA), vacuolating cytotoxin A (VacA), and iceA gene have been described [2, 3]. The cagA gene, which encoded the CagA protein, is reported to be found in more than half of the H. pylori isolates. It is known that cagA is a marker for the cag pathogenicity island and is associated with increased IL-8 production, nuclear factor-kB activation, mucosal inflammation, and development of PUD and GC [3].

The protein VacA is responsible for the gastric epithelial erosion observed in infected hosts. The vacA gene encoding the vacuolating toxin comprises three variable parts, the s-region (encoding the signal peptide) and two alleles, s1 and s2. Within the s1 allele, several subtypes (s1a, s1b, and s1c) can be distinguished. For the m-region (middle), two alleles, m1 and m2, have been recognized [4]. The VacA activity level is defined by vacA s- and m-regions combination; s1m1 produces high amount of toxin and is considered the most virulent; however, s2m2 produces an inactive toxin [4, 5]. In Western countries, infection with vacA s1m1 strain is more common in patients with PUD than those with chronic gastritis [5]. Recently, a third polymorphic determinant of vacuolating activity (located in the middle of s- and m-regions) has been described as an intermediate (i) region [6].

The iceA gene has two alleles: iceA1 and iceA2. The iceA1 allele, encoding a CATG-specific restriction endonuclease, is regulated by the contact of H. pylori with the human gastric cells [7]. In Western countries the presence of iceA1 allele is strongly associated with PUD [7, 8].

In Cuba, there are scarce investigations regarding the pattern of virulence genes in H. pylori strains [9, 10], but none have examined the s1 allele subtypes of vacA gene, the iceA gene nor the H. pylori strains genotypes isolated from younger or older patients. The aim of this study was to investigate the prevalence of cagA, vacA, and iceA genotypes of H. pylori isolates recovered from Cuban patients with dyspepsia.

2. Materials and Methods

2.1. Patients

Gastric biopsies from 150 patients referred to gastroscopy at two Cuban hospitals in Havana from 2009 to 2010 were collected. Patients with a history of gastric surgery, active gastrointestinal bleeding or who had received antibiotics, proton pump inhibitors, or bismuth compounds in the last four weeks were excluded. Sixty-eight patients (35 male and 33 female) with a mean age of 39.2 (years range = 9 to 68) reported positive for H. pylori infection by culture were included. The protocol was approved by the Ethical Review Committee of the Tropical Medicine Institute “Pedro Kourí” (IPK) and all patients provided an informed consent.

2.2. Culture and Genomic DNA Isolation

Antrum and corpus biopsy specimens from each patient were kept in sterile saline solution (0.9%) at 4°C. The endoscopic biopsy specimens were smeared on the surface of Columbia chocolate agar plates enriched with Dent supplement (Oxoid, England) and 1% of fetal calf serum (Gibco, USA) and incubated under microaerophilic conditions (Campy Packs, Oxoid) for up to 3 days. H. pylori isolates were identified by typical Gram-staining morphology and positive biochemical urease, oxidase, and catalase [11]. Biopsies of 68 patients yielded 75 H. pylori isolates; those obtained from two gastric biopsy sites of seven patients were considered independent. Primary cultures of H. pylori were conserved at −80°C in brain heart infusion with 20% glycerol and later on were subcultured as it was described above.

All colonies from the subculture were used for chromosomal DNA extraction by Wizard Genomic DNA Purification Kit (Promega, USA) according to the manufacturer's instructions. DNA content and purity were determined by measuring the absorbance at 260–280 nm (Spectrophotometer MRC, Spain) and by amplification of ureA gene [12]. Samples were stored at −20°C before polymerase chain reaction (PCR) amplification was performed.

2.3. PCR

Primers used in this study are shown in Table 1. Amplification of ureA, cagA, vacA, and iceA genes by PCR was made in a volume of 50 μL containing 1X PCR buffer (pH = 7), 3 mM MgCl2, 0.2 mM deoxynucleoside triphosphate, 0.5U Taq polymerase (Sigma, USA), 25 pmol of each primer, 2 μL of chromosomal DNA, and sterile distilled water (Sigma). PCR amplifications were performed in an automated thermal cycler (Techne, Belgium). All runs included a negative DNA control consisting of PCR grade water and two positive DNA controls from H. pylori reference strains, ATCC43504 (genotype vacAs1am1/cagA+/iceA1) and 26695 (genotype vacAs1bm1/cagA+/iceA1). The PCR products were electrophoresed on 2% agarose gel stained with ethidium bromide (Promega) and visualized under UV light. Standards of 100 bp DNA Step Ladder (Promega) were used as molecular size marker.

Table 1.

Primers used in PCR for amplification of cagA, vacA, and iceA sequences and s1 region sequencing.

DNA amplified region Primer Primer sequence PCR product PCR program Reference
(5′-3′) (bp)
cagA CAG-L TGCTAAATTAGACAACTTGAGCGA 289 30 cycles (1 min at 95°C, 1 min at 50°C, and 1 min at 72°C) [13]
CAG-R AATAATCAACAAACATCACGCCAT

vacAs1a SS1-F GTCAGCATCACACCGCAAC 190 35 cycles (1 min at 95°C, 1 min at 56°C, and 1 min at 72°C) [5]
vacAs1b SS3-F AGCGCCATACCGCAAGAG 187
vacAs1c SS1C-F CTAGCTTTAGTGGGGATA 213 [14]
vacAs2 SS2-F GCTAACACGCCAAATGATCC 199 [5]
VA1-R* CTGCTTGAATGCGCCAAAC
vacA m1/m2 VAG-F CAATCTGTCCAATCAAGCGAG 567/645± [5]
VAG-R GCGTCAAAATAATTCCAAGG

VacAs1 SIG-F ATGGAAATACAACAAACACACCG 338 [8]
SIG-R CAACCTCCATCAATCTTACTGGA
VA1-F ATGGAAATACAACAAACACAC 259 [5]

iceA1 iceA1-F GTGTTTTTAACCAAAGTATC 246 30 cycles (1 min at 95°C, 1 min at 50°C, and 1 min at 72°C) [8]
iceA1-R CTATAGCCATTATCTTTGCA
iceA2 iceA2-F GTTGGGTATATCACAATTTAT 229/334¥
iceA2-R TTTCCCTATTTTCTAGTAGGT

*Used as reverse primer with SS1-F, SS3-F, SS1C-F, SS2-F, and VA1-F. ±The size of the product is variable depending on the present subtype 567 bp for m1 and 645 pb for m2. ¥The primers yield a fragment of 229 or 334 bp depending on the presence of a repetitive sequence of 105 nucleotides codifying for 35 amino acids in some iceA2 alleles.

2.4. Sequencing of s-Region

To analyze nucleotide sequence similarity of vacA genotypes among nontypable H. pylori strains for s1 region, entire s-region of vacA gene was amplified using both the forward and reverse primers (Table 1). Amplified products purified by High Pure PCR Product Purification Kit (Roche, Switzerland) were directly sequenced (Beckman Coulter, Belgium) using DTCS Quick Start Master Mix (GenomeLab, USA). Sequence comparison was carried out using the BLASTn program and the GenBank databases (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.5. Statistical Analysis

Data were analysed using Chi-square test. Any P value < 0.05 was considered to be statistically significant. Association between clinical findings and genotypes was tested independently in two groups, defined according to age group (patients aged less than 40 years were grouped in group 1 and those within 40 years and older in group 2).

3. Results

3.1. Distribution of vacA, cagA, and iceA Genotypes

The vacA s-region was amplified in all 75 H. pylori strains studied: 54 (72.0%) were identified as s1 and 17 (22.7%) as s2 and the remainder 4 strains (5.3%) harboured both alleles (Table 2). The s1 variants were detected in 94.4% (51/54 strains) and three strains could not be typed by the primers used in this study. In 49 of 51 strains only two single s1 subtypes were identified (25 as s1a and 24 as s1b) and two strains were classified as s1a-s1b subtype. Two of the three selected strains for sequencing the s1 region were identified as s1a-s1b variant with more than 91% of homology (IPK56C, IPK191C) and as s1a variant with 89% of homology (IPK201A) (GenBank accession numbers: KP462879, KP462880, and KP462878). All strains were typed by vacA m-region, resulting in 50.7% (38 strains) with m2 allele and 49.3% (37 strains) with m1 allele. Four possible single combinations of the s/m alleles were detected and the most frequent was s1m1 (36 strains, 48.0%) followed by s1m2 (18 strains, 24.0%), s2m2 (16 strains, 21.4%), and s2m1 (1 strain, 1.3%). Four strains (5.3%) corresponded with s1-s2m2 combination. According to s1 subtypes (54 strains) the most frequent combination was s1bm1 (19 strains, 35.2%), s1am1 (15 strains, 27.8%), s1am2 (12 strains, 22.2%), s1a-s1bm1 (2 strains, 3.7%), and s1bm2 (1 strain, 1.9%).

Table 2.

Association of H. pylori subtypes/genotypes with endoscopic findings and age of patients.

Genotypes Clinical status Age groups
NUD  PUD  P value Group 1  Group 2  P value
n = 44 (%) n = 24 (%) n = 35 (%) n = 33 (%)
vacA
s1 31 (70.5) 19 (79.2) 0.249 23 (65.7) 27 (81.8) 0.008*
s2 11 (25.0) 3 (12.5) 12 (34.3) 2 (6.1)
s1-s2 ± 2 (4.5) 2 (8.3)    0 (0.0) 4 (12.1)
m1 20 (45.5) 15 (62.5) 0.179 17 (48.6) 18 (54.5) 0.622
m2 24 (54.5) 9 (37.5) 18 (51.4) 15 (45.5)
s1m1 20 (45.5) 14 (58.4) 0.095 17 (48.6) 17 (51.5) 0.589
s1m2 11 (25.0) 5 (20.8) 0.728 6 (17.1) 10 (30.4) 0.003*
s2m1 0 (0.0) 1 (4.2) 0 (0.0) 1 (3.0)
s2m2 11 (25.0) 2 (8.3) 0.395 12 (34.3) 1 (3.0) 0.016*
s1-s2m2 ± 2 (4.5) 2 (8.3) 0 (0.0) 4 (12.1)
cagA
cagA+ 22 (50.0) 16 (66.7) 0.186 18 (51.4) 20 (60.6) 0.446
cagA− 22 (50.0) 8 (33.3) 17 (48.6) 13 (39.4)
iceA
iceA1 14 (31.8) 11 (45.8) 0.037* 12 (34.3) 13 (39.4) 0.455
iceA2 28 (63.6) 12 (50.0) 23 (65.7) 17 (51.5)
iceA1-iceA2 ± 2 (4.6) 1 (4.2) 0 (0.0) 3 (9.1)
Clinical status
 NUD 28 (80) 16 (48.5) 0.007*
 PUD 7 (20) 17 (51.5)

NUD: non-peptic ulcer dyspepsia. PUD: peptic ulcer disease. Group 1: under 40 years old. Group 2: those within 40 years and older. *Statistically significant (P < 0.05). ±Strains with multiple genotypes and seven strains recovered from gastric corpus were excluded from analysis. (—) This analysis is impossible to do.

The cagA gene was detected in 42 (56.0%) strains. Overall 68 (90.7%) isolates had a single iceA allele; iceA2 was detected in 43 (57.3%) and iceA1 in 25 (33.3%) strains. Seven strains were identified with both iceA alleles (7 strains, 9.3%).

3.2. H. pylori Genotypes and Clinical Association

Regarding endoscopy aspects of the mucosa, patients were distributed into non-peptic ulcer dyspepsia (NUD) in 64.7% (44/68), PUD in 35.3% (24/68: 10 gastric and 14 duodenal ulcers). Despite the fact that s1 allele of vacA gene and cagA+ H. pylori strains were more frequently identified in patients with NUD (31 patients, 70.5%) and with PUD (16 patients, 66.7%), respectively, no statistical association was observed. However, the presence of iceA2 allele in 63.6% (28 strains) of isolated strains from patients having NUD was associated statistically (P = 0.037) (Table 2).

3.3. Association between Age of Patients and H. pylori Genotypes

The 50.7% (38 strains) of H. pylori strains were isolated from patients under 40 years old (group 1) while the 49% (37 strains) were recovered from patients over 40 years old (group 2). Genotypes s1 and s1m2 were more frequently found in patients belonging to group 2 while the genotypes s2 and s2m2 were more often detected in group 1, both with a significant statistical association (P < 0.05). H. pylori strains isolated from patients over 40 years old were more frequent in those with PUD; between these two variables a statistical association was observed (P = 0.007) (Table 2).

3.4. H. pylori Strains Recovered from Different Gastric Regions

Fourteen H. pylori strains were isolated from two stomach regions, antrum and corpus of seven patients. In only one of these patients, a strain with identical genotype (s1am1/cagA+/iceA2) was found. However, in the majority of them, at least a variation in one of the investigated genes was observed. The variation percentages of the following genes, cagA+, vacA (s-region), and iceA1, were 57.1% (8/14 strains), 71.4% (10/14 strains), and 42.9% (6/14 strains), respectively (Table 3).

Table 3.

H. pylori strains recovered from gastric antrum and corpus of seven patients.

Patients Stomach region Endoscopic diagnostic vacA gene subtypes cagA gene presence* iceA gene subtypes
73 A NUD s1b m1 iceA2
C s1a, s2 m2 + iceA1, iceA2

71 A NUD s2 m2 + iceA2
C s2 m2 iceA2

72 A NUD s1b m2 iceA2
C s2 m2 + iceA1, iceA2

62 A NUD s1a m1 + iceA1, iceA2
C s1a, s1b m1 + iceA1, iceA2

69 A NUD s2 m2 iceA1
C s2 m2 iceA1, iceA2

78 A NUD s2 m2 + iceA2
C s1a, s2 m2 iceA2

81 A NUD s1a m1 + iceA2
C s1a m1 + iceA2

A: gastric antrum. C: gastric corpus. NUD: non-peptic ulcer dyspepsia. *Negative (−), cagA gene absent; positive (+), cagA gene present.

4. Discussion

In the current investigation the predominant types in Cuban H. pylori strains were the s1 (50/68 strains, 73.5%), iceA2 (40/68 strains, 53.3%), and cagA gene (38/68 strains, 55.9%). Our results are in agreement with other developed studies in Cuba, Europe, and East Africa where a higher prevalence (70% or more) of the s1 subtype had been reported [9, 15, 16]. In contrast, an elevated frequency of strains belonging to s2 subtype was described in Jordan [17]. These data demonstrated the high genetic variability of strains in different countries. A low percentage of the strains (5%) harbouring both alleles s1 and s2 has been reported previously [18].

The current research is the first study developed in Cuba to analyze both the s1 variants of vacA gene and the gene iceA in H. pylori strains. Concerning previous research, the dominant vacA gene subtype in North and South America, Central Europe, and Australia was s1a [19] but in Portugal and Brazil was s1b [20, 21]. The same frequency of s1a and s1b subtypes, as it was observed in our study, is similar to reports from industrialised countries as France, Italy, USA, and Canada [22].

The existence of nontypeable H. pylori strains has been described previously, using similar primers [23]. In our investigation, two of the three sequenced strains were identified as s1a-s1b subtypes. Similar results have been informed by other authors, defining the consensus sequence as a recombinant of two originals with different subtypes each [24]. For m-region of the H. pylori strains, m1 and m2 subtypes were approximately equally prevalent as in Europe and Latin America [25].

The percentage of vacA genotype s1b/m1 in this study is similar to research developed in Mexico, Brazil, and Costa Rica [26]. However, in Japan and China, the most prevalent genotypes are s1c/m1 and s1c/m2, respectively [27].

In European, Venezuelan, and North American populations, only 60% of H. pylori isolates harboured cagA gene [16, 28], as what occurred in the current study. However, in Japan and Korea, the proportion of cagA + strains is usually over 90% [29]. In our investigation, the prevalence of cagA + strains is similar to the report of Torres [9] but is lower in comparison with another Cuban study (70%) [10].

The predominance of iceA2 subtype is in agreement with reports from Colombia and USA [30]. Both subtypes of the iceA gene have been identified in Brazil, Malaysia, and Korea [31, 32].

Patients with H. pylori strains recovered from gastric antrum and corpus were infected with different cagA, vacA, and iceA genotypes. Also, multiple H. pylori genotypes were observed in a single biopsy specimen. Previous detailed molecular analysis has shown that each of the H. pylori strains contains only one cagA allele and each one of the s- and m-region subtypes of vacA gene. Therefore, it is an exact indicator for the presence of multiple strains of this organism if different genotypes are found [33]. The coexistence of more than one strain in the same individual may reflect the capacity of H. pylori to evolve genetic variations during the long-term colonization from childhood [3].

The absence of association between virulence genes explored and PUD could be influenced by the small number of patients studied with this pathology. Similar results have been described previously [3, 9, 10]. Moreover, the predominance of high virulence Cuban H. pylori strains in the group of patients with benign gastric diseases has unusual results in Western population. As it was reported in previous Cuban studies [9, 10], despite the presence of highly virulent H. pylori, the incidence of gastric cancer is lower in dyspeptic patients (gastric cancer death rate in Cuba: 7.5/100 000, http://files.sld.cu/dne/files/2014/05/anuario-2013-esp-e.pdf). Although this behavior has been observed in several previous studies [3, 7], it is probable that these findings suggest the action of environmental and host factors in Cuban patients. Further research studies to examine the role of host immunological factors might help to explain the different outcomes of H. pylori-induced disease in Cuban individuals.

We found an association between H. pylori strains harbouring the iceA2 allele in patients with NUD. This behaviour has also been described in Europe, Saudi Arabia, and Turkey [34]. Several studies suggest an association of the iceA1 variant and PUD and between iceA2 variants with gastritis [34, 35]. However, this association varies among populations; in Brazil, for instance, iceA1 allele is associated with gastritis [31]. A recent meta-analysis confirms the relationship between the iceA allelic types and clinical outcomes [7].

The current investigation also showed statistical association of more virulent variants of H. pylori (s1 and s1m2) strains in the group of older patients. In Portugal and Tunisia, virulent strains have been detected in adult patients more frequently than children [36]. It has been described that H. pylori strains experiment recombination with others more virulent and better adapted strains to host changes, resulting in genotypes variable distribution between age groups [37, 38].

In summary, our results show a high prevalence of main virulence factors in Cuban isolates similar to that observed in other Western populations. In addition, we found strains with multiple genotypes, as it has been observed in countries with a high prevalence of H. pylori infection. Notably, a significant association was found among iceA2 allele and NUD as well as strains with more virulent types and older patients. The iceA gene may be considered a useful marker in patients with gastroduodenal diseases. The relationship between H. pylori virulence factors and clinical outcomes in Cuban population is still unclear; therefore, further studies are required to determine the role of environmental and immunological factors.

Acknowledgments

The authors acknowledged Dr. Guillermo Perez-Perez for his opportune advises and contribution to this paper. Thanks are due to the assistance staff from the Gastroenterological Unit in the IPK and Pedro Borrás Hospital for their great support during this investigation.

Ethical Approval

The project was approved by the Ethical Review Committee of the IPK, Cuba.

Conflict of Interests

The authors declare that they have no conflict of interests.

References

  • 1.Kusters J. G., van Vliet A. H. M., Kuipers E. J. Pathogenesis of Helicobacter pylori infection. Clinical Microbiology Reviews. 2006;19(3):449–490. doi: 10.1128/cmr.00054-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Yamaoka Y. Mechanisms of disease: Helicobacter pylori virulence factors. Nature Reviews Gastroenterology and Hepatology. 2010;7(11):629–641. doi: 10.1038/nrgastro.2010.154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Suzuki R., Shiota S., Yamaoka Y. Molecular epidemiology, population genetics, and pathogenic role of Helicobacter pylori . Infection, Genetics and Evolution. 2012;12(2):203–213. doi: 10.1016/j.meegid.2011.12.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Cover T. L., Blanke S. R. Helicobacter pylori VacA, a paradigm for toxin multifunctionality. Nature Reviews Microbiology. 2005;3(4):320–332. doi: 10.1038/nrmicro1095. [DOI] [PubMed] [Google Scholar]
  • 5.Atherton J. C., Cao P., Peek R. M., Jr., Tummuru M. K. R., Blaser M. J., Cover T. L. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. The Journal of Biological Chemistry. 1995;270(30):17771–17777. doi: 10.1074/jbc.270.30.17771. [DOI] [PubMed] [Google Scholar]
  • 6.Rhead J. L., Letley D. P., Mohammadi M., et al. A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer. Gastroenterology. 2007;133(3):926–936. doi: 10.1053/j.gastro.2007.06.056. [DOI] [PubMed] [Google Scholar]
  • 7.Shiota S., Suzuki R., Yamaoka Y. The significance of virulence factors in Helicobacter pylori . Journal of Digestive Diseases. 2013;14(7):341–349. doi: 10.1111/1751-2980.12054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.van Doorn L.-J., Figueiredo C., Sanna R., et al. Clinical relevance of the cagA,vacA, and iceA status of Helicobacter pylori . Gastroenterology. 1998;115(1):58–66. doi: 10.1016/s0016-5085(98)70365-8. [DOI] [PubMed] [Google Scholar]
  • 9.Torres L. E., Melián K., Moreno A., et al. Prevalence of vacA, cagA and babA2 genes in Cuban Helicobacter pylori isolates. World Journal of Gastroenterology. 2009;15(2):204–210. doi: 10.3748/wjg.15.204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ortiz-Princz D., Guariglia-Oropeza V., Ávila M., et al. Helicobacter pylori cagA and vacA genotypes in Cuban and Venezuelan populations. Memórias do Instituto Oswaldo Cruz. 2010;105(3):331–335. doi: 10.1590/s0074-02762010000300016. [DOI] [PubMed] [Google Scholar]
  • 11.Llanes R., Feliciano O., Guzmán D., et al. Use of a single biopsy specimen for diagnosing Helicobacter pylori infection by culture and two different PCR methods: report from Cuba. Tropical Gastroenterology. 2010;31(2):111–112. [PubMed] [Google Scholar]
  • 12.Fernando N., Holton J., Vaira D., DeSilva M., Fernando D. Prevalence of Helicobacter pylori in Sri Lanka as determined by PCR. Journal of Clinical Microbiology. 2002;40(7):2675–2676. doi: 10.1128/jcm.40.7.2675-2676.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Covacci A., Telford J. L., del Giudice G., Parsonnet J., Rappuoli R. Helicobacter pylori virulence and genetic geography. Science. 1999;284(5418):1328–1333. doi: 10.1126/science.284.5418.1328. [DOI] [PubMed] [Google Scholar]
  • 14.Yamaoka Y., Kodama T., Kita M., Imanishi J., Kashima K., Graham D. Y. Relationship of vacA genotypes of Helicobacter pylori to cagA status, cytotoxin production, and clinical outcome. Helicobacter. 1998;3(4):241–253. doi: 10.1046/j.1523-5378.1998.08056.x. [DOI] [PubMed] [Google Scholar]
  • 15.Homan M., Luzar B., Kocjan B. J., et al. Prevalence and clinical relevance of cagA, vacA, and iceA genotypes of Helicobacter pylori isolated from slovenian children. Journal of Pediatric Gastroenterology and Nutrition. 2009;49(3):289–296. doi: 10.1097/mpg.0b013e31818f09f2. [DOI] [PubMed] [Google Scholar]
  • 16.Chiurillo M. A., Moran Y., Cañas M., et al. Genotyping of Helicobacter pylori virulence-associated genes shows high diversity of strains infecting patients in western venezuela. International Journal of Infectious Diseases. 2013;17(9):e750–e756. doi: 10.1016/j.ijid.2013.03.004. [DOI] [PubMed] [Google Scholar]
  • 17.Nimri L. F., Matalka I., Hani K. B., Ibrahim M. Helicobacter pylori genotypes identified in gastric biopsy specimens from Jordanian patients. BMC Gastroenterology. 2006;6, article 27 doi: 10.1186/1471-230x-6-27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.López A. M., Delgado M. P., Jaramillo C., Amézquita A., Parra G., Echeverry M. M. Characterization of the Helicobacter pylori vacuolating cytotoxin gene in gastric biopsy specimens from patients living in tolima, Colombia. Revista Argentina de Microbiologia. 2009;41(1):4–10. [PubMed] [Google Scholar]
  • 19.Nagiyev T., Yula E., Abayli B., Koksal F. Prevalence and genotypes of Helicobacter pylori in gastric biopsy specimens from patients with gastroduodenal pathologies in the Cukurova region of Turkey. Journal of Clinical Microbiology. 2009;47(12):4150–4153. doi: 10.1128/jcm.00605-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Figueiredo C., van Doorn L.-J., Nogueira C., et al. Helicobacter pylori genotypes are associated with clinical outcome in portuguese patients and show a high prevalence of infections with multiple strains. Scandinavian Journal of Gastroenterology. 2001;36(2):128–135. doi: 10.1080/003655201750065861. [DOI] [PubMed] [Google Scholar]
  • 21.Brito C. A. A., Silva L. M. B., Jucá N., et al. Prevalence of cagA and vacA genes in isolates from patients with Helicobacter pylori-associated gastroduodenal diseases in Recife, Pernambuco, Brazil. Memorias do Instituto Oswaldo Cruz. 2003;98(6):817–821. doi: 10.1590/s0074-02762003000600018. [DOI] [PubMed] [Google Scholar]
  • 22.Lehours P., Ménard A., Dupouy S., et al. Evaluation of the association of nine Helicobacter pylori virulence factors with strains involved in low-grade gastric mucosa associated lymphoid tissue lymphoma. Infection and Immunity. 2004;72(2):880–888. doi: 10.1128/iai.72.2.880-888.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kumar S., Kumar A., Dixit V. K. Genetic diversity in strains of Helicobacter pylori from India and their relatedness to strains from other parts of the world. Infection, Genetics and Evolution. 2011;11(1):242–247. doi: 10.1016/j.meegid.2010.09.001. [DOI] [PubMed] [Google Scholar]
  • 24.Kraft C., Suerbaum S. Mutation and recombination in Helicobacter pylori: mechanisms and role in generating strain diversity. International Journal of Medical Microbiology. 2005;295(5):299–305. doi: 10.1016/j.ijmm.2005.06.002. [DOI] [PubMed] [Google Scholar]
  • 25.Ghose C., Perez-Perez G. I., van Doorn L. J., Domínguez-Bello M. G., Blaser M. J. High frequency of gastric colonization with multiple Helicobacter pylori strains in Venezuelan subjects. Journal of Clinical Microbiology. 2005;43(6):2635–2641. doi: 10.1128/jcm.43.6.2635-2641.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ashour A. A. R., Magalhães P. P., Mendes E. N., et al. Distribution of vacA genotypes in Helicobacter pylori strains isolated from Brazilian adult patients with gastritis, duodenal ulcer or gastric carcinoma. FEMS Immunology and Medical Microbiology. 2002;33(3):173–178. doi: 10.1016/s0928-8244(02)00311-5. [DOI] [PubMed] [Google Scholar]
  • 27.Aziz F., Chen X., Yang X., Yan Q. Prevalence and correlation with clinical diseases of Helicobacter pyloricagA and vacA genotype among gastric patients from northeast China. BioMed Research International. 2014;2014:7. doi: 10.1155/2014/142980.142980 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Miernyk K., Morris J., Bruden D., et al. Characterization of Helicobacter pylori cagA and vacA genotypes among Alaskans and their correlation with clinical disease. Journal of Clinical Microbiology. 2011;49(9):3114–3121. doi: 10.1128/jcm.00469-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Matsunari O., Shiota S., Suzuki R., et al. Association between Helicobacter pylori virulence factors and gastroduodenal diseases in Okinawa, Japan. Journal of Clinical Microbiology. 2012;50(3):876–883. doi: 10.1128/JCM.05562-11. Erratum to Journal of Clinical Microbiology, vol. 50, no. 7, pp. 2542, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Podzorski R. P., Podzorski D. S., Wuerth A., Tolia V. Analysis of the vacA, cagA, cagE, iceA, and babA2 genes in Helicobacter pylori from sixty-one pediatric patients from the Midwestern United States. Diagnostic Microbiology and Infectious Disease. 2003;46(2):83–88. doi: 10.1016/s0732-8893(03)00034-8. [DOI] [PubMed] [Google Scholar]
  • 31.Gatti L. L., Módena J. L. P., Payão S. L. M., et al. Prevalence of Helicobacter pylori cagA, iceA and babA2 alleles in Brazilian patients with upper gastrointestinal diseases. Acta Tropica. 2006;100(3):232–240. doi: 10.1016/j.actatropica.2006.08.014. [DOI] [PubMed] [Google Scholar]
  • 32.Kim Y. S., Kim N., Kim J. M., et al. Helicobacter pylori genotyping findings from multiple cultured isolates and mucosal biopsy specimens: strain diversities of Helicobacter pylori isolates in individual hosts. European Journal of Gastroenterology and Hepatology. 2009;21(5):522–528. doi: 10.1097/meg.0b013e3283196af0. [DOI] [PubMed] [Google Scholar]
  • 33.Blaser M. J. Heterogeneity of Helicobacter pylori . European Journal of Gastroenterology and Hepatology. 1997;9(1, Supplement):S3–S7. doi: 10.1097/00042737-199701000-00004. [DOI] [PubMed] [Google Scholar]
  • 34.Amjad N., Osman H. A., Razak N. A., Kassian J., Din J., Abdullah N. B. Clinical significance of Helicobacter pylori cagA and iceA genotype status. World Journal of Gastroenterology. 2010;16(35):4443–4447. doi: 10.3748/wjg.v16.i35.4443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Boyanova L., Yordanov D., Gergova G., Markovska R., Mitov I. Association of iceA and babA genotypes in Helicobacter pylori strains with patient and strain characteristics. Antonie van Leeuwenhoek. 2010;98(3):343–350. doi: 10.1007/s10482-010-9448-y. [DOI] [PubMed] [Google Scholar]
  • 36.Ben Mansour K., Fendri C., Zribi M., et al. Prevalence of Helicobacter pylori vacA, cagA, iceA and oipA genotypes in Tunisian patients. Annals of Clinical Microbiology and Antimicrobials. 2010;9, article 10 doi: 10.1186/1476-0711-9-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Lee J. H., Choe Y. H., Jeon B. H., et al. Genotypes of the Helicobacter pylori vacA signal sequence differ with age in Korea. Helicobacter. 2004;9(1):54–58. doi: 10.1111/j.1083-4389.2004.00198.x. [DOI] [PubMed] [Google Scholar]
  • 38.Allison C. C., Ferrero R. L. Role of virulence factors and host cell signaling in the recognition of Helicobacter pylori and the generation of immune responses. Future Microbiology. 2010;5(8):1233–1255. doi: 10.2217/fmb.10.84. [DOI] [PubMed] [Google Scholar]

Articles from BioMed Research International are provided here courtesy of Wiley

RESOURCES