Modifying enzymes related aminoglycoside: analyses of resistant Acinetobacter isolates

Abstract

Enzymatic modification of aminoglycosides by nucleotidyltransferases, acetyltransferases and/or phosphotransferases accounts for the majority of aminoglycoside-resistant Acinetobacter isolates. In this study, we investigated the relationship between aminoglycoside resistance and the presence of aminoglycoside-modifying enzymes in Acinetobacter baumannii clinical isolate groups with different resistance profiles. Thirty-two clinical A. baumannii isolates were included in this study. Acinetobacter isolates were divided into 4 groups according to results of susceptibility testing. The presence of genes encoding the following aminoglycoside-modifying enzymes; aph (3’)-V1, aph (3’)-Ia, aac (3)-Ia, aac (3) IIa, aac (6’)-Ih, aac (6’)-Ib and ant (2’)-Ia responsible for resistance was investigated by PCR in all strains. The acetyltransferase (aac (6’)-Ib, aac (3)-Ia) and phosphotransferase (aph (3’)-Ia) gene regions were identified in the first group, which comprised nine imipenem, meropenem, and gentamicin-resistant isolates. The acetyltransferase (aac (6’)-Ib, aac (3)-Ia), phosphotransferase (aph (3’)-VI) and nucleotidyltransferase (ant2-Ia) gene regions were identified in the second group, which was composed of nine imipenem-resistant, meropenem-resistant and gentamicin-sensitive isolates. The acetyltransferase (aac (3)-Ia) and phosphotransferase (aph (3’)-Ia) regions were identified in the fourth group, which comprised eight imipenem-sensitive, meropenem-sensitive and gentamicin-resistant isolates. Modifying enzyme gene regions were not detected in the third group, which was composed of six imipenem, meropenem and gentamicin-sensitive isolates. Our data are consistent with previous reports, with the exception of four isolates. Both acetyltransferases and phosphotransferases were widespread in A. baumannii clinical isolates in our study. However, the presence of the enzyme alone is insufficient to explain the resistance rates. Therefore, the association between the development of resistance and the presence of the enzyme and other components should be investigated further.

Introduction

Resistance rates to all the clinically useful aminoglycoside antibiotics are higher in Acinetobacter spp. than in most other groups of pathogens [1,2] Most aminoglycoside resistance in Acinetobacter spp. involves production of aminoglycoside-modifying enzymes, and all three classes of aminoglycoside-modifying enzymes have been found in Acinetobacter spp.. Enzymatic modification of aminoglycosides by acetyltransferases, nucleotidyltransferases and/or phosphotransferases accounts for the majority of aminoglycoside-resistant Acinetobacter isolates [3] Several aminoglycoside-modifying enzymes (AMEs) have been detected in different Acinetobacter species (A. baumannii, A. pittii, A. nosocomialis, and A. johnsonii), including: the phosphotransferases aph (3’)-Ia, aph (3’)-VIa, aph (3’)-II, the acetyltransferases aac (3)-Ia, aac (3)-IIa, aac (6’)-Ib, aac (6’)-Iad, aac (6’)-Im and aac (6’)-II and the nucleotidyltransferases ant (2”)-Ia, ant (3”)-Ia, and ant (3”)-Id [3-8].

This study investigated the relationship between aminoglycoside resistance and the presence of aminoglycoside-modifying enzymes in Acinetobacter baumannii clinical isolate groups with different resistance profiles.

Materials and methods

Thirty-two A. baumannii strains present in the laboratory archieve and which have been isolated from the samples sent from various clinics to Sakarya University Training and Research Hospital Microbiology Laboratory (Turkey) were included in this study. The isolates were identified using the GN ID card (PN 21341, bioMérieux, ABD) and their susceptibility profiles assessed using the AST-N262 (bioMérieux, ABD) card of Vitek2 automated system (bioMérieux, Fransa). Densi-Check 2 system was used to calibrate the turbidity to 0.5 McFarland standards. Species identification was performed using conventional molecular methods with OXA₅₁ primer. Acinetobacter isolates were divided into 4 groups according to results of susceptibility testing. The first group, consisted of 9 strains that are identified as resistant gentamicin, Imipenem and Meropenem. The second group, consisted of 9 strains that are identified as sensitive gentamicin and resistant imipenem and meropenem. The third group, consisted of 6 strains that are identified as sensitive gentamicin, imipenem and meropenem. The forth group, consisted of 8 strains that are identified as resistant gentamicin and sensitive imipenem and meropenem (Table 1). Acinetobacter baumannii ATCC19606 was used as quality control strains.

Table 1.

Groups of Our Isolates

Group	Gentamicin	Imipenem	Meropenem
Group 1	R	R	R
Group 2	S	R	R
Group 3	S	S	S
Group 4	R	S	S

R: Resistance, S: Susceptible.

The presence of genes encoding the following aminoglycoside-modifying enzymes was investigated by PCR:, phosphotransferases aph (3’)-V1 and aph (3’)-la, acetyltransferases aac (3)-Ia, aac (3)-Iia, aac (6’)lh and aaa (6’)-lb, and nucleotidyltransferases ant (2’)-Ia. The primers were those given Table 2.

Table 2.

Primer sets used in our study

Primer Sets	Nucleotide sequence (5’-3’)	Target DNA	Genbank accession number	Size of amplicon (bp)	Reference
1	F: TCAGCAAGAGGCACAGTTTG	blaOXA-51	EU255296.1	188 bp	[17]
	R: GCTGAACAACCCATCCAGTT
2	F: GACATAAGCCTGTTCGGTT	aac (3)-Ia	X15852	372 bp	[18]
	R: CTCCGAACTCACGACCGA
3	F: ATGCATACGCGGAAGGC	aac (3)-IIa	M62833	822 bp	[18]
	R: TGCTGGCACGATCGGAG
4	F: ATCTGCCGCTCTGGAT	ant (2’)-Ia	U17586	404 bp	[18]
	R: CGAGCCTGTAGGACT
5	F: TGCCGATATCTGAATC	aac (6’) Ih	L29044.1	407 bp	[18]
	R: ACACCACACGTTCAG
6	F: TATGAGTGGCTAAATCGAT	aaa (6’)-Ib	M21682.1	395 bp	[18]
	R: CCCGCTTTCTCGTAGCA
7	F: CGGAAACAGCGTTTTAGA	aph (3’)-V1	X07753.1	716 bp	[18]
	R: TTCCTTTTGTCAGGTC
8	F: ATCGCGTATTTCGTCTCGCT	aph (3’)-Ia	J01839	292 bp	This Study
	R: GGAGAAAACTCACCGAGGCA
9	F: GAC GAT CTG TAG CGG GTC TG	16S rRNA	FJ855135.1	791 bp	This Study
	R: CCC AAC ATC TCA CGA CAC GA
10	GAGGGTGGCGGTTCT	M13			[19]

F, forward primer; R, reverse primer.

DNA was extracted from fresh culture of A. baumannii colonies according to the following protocol performed by GeneJET Genomic DNA Purification Kit (Thermo Scientific, USA). The RNA extraction was performed by GeneJET RNA Purification Kit (Thermo Scientific, USA) extraction kit. In this study, 16S rRNA gene was used as housekeeping gene.

Optimization studies were performed using conventional polymerase chain reaction (PZR). The transcription product levels of blaOXA-51-like, m13 were identified with real-time polymerase chain reaction (qPRC) method using a Fluorion Instrument (Iontek, Turkey). The presence of genes encoding the following aminoglycoside-modifying enzymes; aph (3’)-V1, aph (3’)-Ia, aac (3)-Ia, aac (3)IIa, aac (6’)-Ih, aac (6’)-Ib and ant (2’)-Ia responsible for resistance was investigated by PCR in all strains. All PCR methods used the following concentrations of reagents unless otherwise indicated. The reaction volume calculated as 25 µl and prepared by 12.5 µl master mix, 1 µl F primer, 1 µl R primer, 2 µl sample and 8 µl distilled water without DNA of each primer. All PCR followed a standard PCR protocol of a 5-min hot start. All had a 10 min final extension step at 72°C. PCR reactions were performed on a Sensoquest Labcycler cooled thermocycler. To be able to evaluate the similarity among the strains the arbitrarily primed polymerase chain reaction (AP-PCR) were used [9,10]

Electrophoresis was applied for the analysis of the amplicons by using ORTE (Salubris, Turkey) Real time electrophoresis. Agarose gel (2%) was prepared. PCR products were visualized over led illuminator.

Hospital-isolated carbapenem-resistant A. baumannii strains were investigated to determine whether there was an association between the presence of aminoglycoside-modifying enzymes (AMEs) and carbapenem resistance.

Results

All isolates were OXA₅₁ positive. OXA₅₁ that is located in the structural gene region of A. baumannii conventional and molecular species identification was confirmed. The acetyltransferase (aac (6’)-Ib, aac (3)-Ia) and phosphotransferase (aph (3’)-Ia) gene regions were identified in the first group, which comprised nine imipenem, meropenem, and gentamicin-resistant isolates. The acetyltransferase (aac (6’)-Ib, aac (3)-Ia), phosphotransferase (aph (3’)-VI) and nucleotidyltransferase (ant2-Ia) gene regions were identified in the second group, which was composed of nine imipenem-resistant, meropenem-resistant and gentamicin-sensitive isolates. The acetyltransferase (aac (3)-Ia) and phosphotransferase (aph (3’)-Ia) regions were identified in the fourth group, which comprised eight imipenem-sensitive, meropenem-sensitive and gentamicin-resistant isolates. Modifying enzyme gene regions were not detected in the third group, which was composed of six imipenem, meropenem and gentamicin-sensitive isolates. None of the strains showed aac (3’)_IIa enzyme positivity. Modifying enzyme gene regions were not detected in A. baumannii ATCC 19606 strains (Table 3).

Table 3.

PCR results

Isolates	Resistance group	Gentamicin	Amikacin	Imipenem	Meropenem	AP-PCR groups	Aminoglycoside-modifying enzymes Primers
							ant2_la	aph (3)_VI	aph (3)_la	aac (3)_la	aac (6)_lb	aac (3)_lh
							Result	Result	Result	Result	Result	S result
A1	1	R	R	R	R	S1					Positive
A2	1	R	R	R	R	S2				Positive
A3	1	R	R	R	R	S2				Positive
A4	1	R	R	R	R	S2				Positive
A5	1	R	R	R	R	S2				Positive
A6	1	R	R	R	R	S2				Positive
A7	1	R	S	R	R	S1				Positive
A8	1	R	S	R	R	S2			Positive	Positive
A9	1	R	S	R	R	S2				Positive
A10	2	S	R	R	R	S1					Positive
A11	2	S	R	R	R	S2			Positive
A12	2	S	R	R	R	S4
A13	2	S	R	R	R	S5	Positive	Positive
A14	2	S	R	R	R	S5
A15	2	S	S	R	R	S3
A16	2	S	S	R	R	S2			Positive
A17	2	S	S	R	R	S2				Positive
A18	2	S	S	R	R	S1
A19	3	S	S	S	S	S6
A20	3	S	S	S	S	S7
A21	3	S	S	S	S	S8
A22	3	S	S	S	S	S9
A23	3	S	S	S	S	S7
A24	3	S	S	S	S	S2
A25	4	R	R	S	S	S7			Positive	Positive		Positive
A26	4	R	R	S	S	S1	Positive		Positive
A27	4	R	R	S	S	S3			Positive	Positive
A28	4	R	R	S	S	S7			Positive	Positive
A29	4	R	R	S	S	S3			Positive	Positive
A30	4	R	R	S	S	S7			Positive	Positive
A31	4	R	R	S	S	S7			Positive	Positive
A32	4	R	R	S	S	S3			Positive	Positive
ATCC1		S	S	S	S	S10
ATCC2		S	S	S	S	S10

Eight aac (3)_Ia, two aph (3)_Ia, and two aac (6)_Ib enzyme profiles were identified in our study. Additionally, the genes for seven aac (3)_Ia and aph (3)_Ia resistance profiles were identified simultaneously (Table 4).

Table 4.

Enzymes detected in A. baumannii isolates

Enzymes	Number	(%)
aac (3)_Ia	8	24.2
aph (3)_Ia	2	6.1
aac (6)_Ib	2	6.1
aac (3)_Ia + aph (3)_Ia	7	21.2
aph (3)_VI + ant2_Ia	1	3.0
aph (3)_Ia + ant2_Ia	1	3.0
aph (3)_Ia + aac (3)_Ia + aac (3)_Ih	1	3.0

The data obtained in this study were consistent with previous reports, with the exception of four isolates. Two isolates that were amikacin-resistant and gentamicin-sensitive were negative for AME genes. Also, two amikacin and gentamicin-sensitive isolates were AME positive. According to AP-PZR results band profiles were compared for the similarities between strains and 10 different patterns were observed (Table 4).

Discussion

Although aminoglycosides present ototoxicity and nephrotoxicity risks and problems with resistance, they are important agents and frequently used to treat infections. In general, aminoglycosides such as gentamicin, tobramycin, amikacin, netilmicin, isepamicin, dibekacin and arbekacin have a broader antibacterial spectrum than the older agents such as streptomycin and kanamycin [11]. Concentration-dependent bactericidal activity, post-antibiotic activity, favorable pharmacokinetics, and synergistic interactions with other antibiotics favor the future usage of aminoglycosides [12].

In recent years, broad-spectrum antibiotics including cephalosporins, fluoroquinolones, and carbapenems have been used in combination with many other agents for treatment of A. baumannii infection [12-14]. However, improper antibiotic use and the acquisition of novel genetic factors by A. baumannii have contributed to an increase in aminoglycoside resistance [15]. AMEs are the source of this resistance [16].

The genes encoding AMEs can be disseminated via integrons, and expression of AMEs enable bacteria to catalyze the modification of amino and hydroxyl groups on sugar moieties, such as aminoglycosides [17,18]. This ability is a major cause of aminoglycoside resistance in many bacteria [19,20]. In addition, efflux pumps and 16s rRNA methylases are also important resistance factors [21]. Recently, 16S rRNA methylation via ArmA has been shown to cause very high aminoglycoside resistance in clinical A. baumannii isolates [22].

AMEs in A. baumannii isolates were first classified in 1993 [23]. A wide array of aminoglycoside-modifying enzymes have previously been reported in A. baumannii [24]. The largest published data set evaluated AMEs detected by a combination of phenotypic inference and DNA hybridization in 1,189 Acinetobacter spp. isolates from South Africa, Europe, China, Latin America, and Mediterranean countries [1]. The predominant AME was an aac (3)-class enzyme, which occurred in nearly 50% of the isolates.

Noppe-Leclercq et al. analyzed the aminoglycoside resistance genes of 40 A. baumannii strains that were found to synthesize several types of AME, including aminoglycoside phosphotransferases, acetyltransferases, and nucleotidyltransferases (75%, 62.5% and 12.5%, respectively) [25]. Similar results were obtained in this study, and no isolates were positive for aac (3’)_IIa resistance profiles.

More recently, a South Korean study reported a different prevalence of AME genes in a polyclonal group of A. baumannii isolates: aac (3)-Ia in 14.8%, aac (6’)-Ib in 83.6%, ant (3”)-Ia in 85.2%, aph (3’)-Ia in 88.5%, and aph (3’)-VI in 1.6% [8]. Another study reported AMEs that acetylates to be less common (42.6%) among their isolates. The ant (2”)-Ia adenylase was the predominant gene present in their isolates (62.6%) and the only one statistically correlated with resistance to each of the aminoglycosides tested [24].

Cho et al. reported that more than 80% of isolates were positive for nucleotidyltransferase, acetyltransferase, and phosphotransferase activity [8]. Akers et al. identified nucleotidyltransferases (62.6%) as the most prevalent AME genes [24].

In a study of 50 Acinetobacter isolates, phosphotransferases were identified in 88% of isolates and acetyltransferases in 4% of isolates [26]. In another study examining AMEs in Gram-negative bacteria, acetyltransferases were identified in 65.2%, and nucleotidyltransferases in 40% of Pseudomonas spp. [27]. In this study 19 (57.6%) isolates were positive for acetyltransferase genes, and 12 (36.4%) were positive for nucleotidyltransferase genes.

There have been few reports on the presence of multiple AMEs in the literature. Miller et al. found that 11.3% of isolates were positive for both aac (3)-ant (2”)-I and aph (3’)-VI-ant (2”)-I resistance profiles [1]. Cho et. al. report three enzymes high positivity for all enzymes but have not to clarify enzymes association in resistant isolates [8]. Therefore, the presence of multiple enzymes, and the relationship between AMEs and aminoglycoside resistance has yet to be fully elucidated. This study identified the following resistance profiles: seven aac (3)_Ia and aph (3)_Ia, one aph (3)_VI and ant2_Ia, and one aph (3)_Ia and ant2_Ia. Additionally we found genes for aph (3)_Ia, aac (3)_Ia, and aac (3)_Ih enzymes in a single isolate that was aminoglycoside-resistant and carbapenem-sensitive.

The data obtained in this study were consistent with previous reports, with the exception of four isolates. Two isolates that were amikacin-resistant and gentamicin-sensitive were negative for AME genes. Also, two amikacin- and gentamicin-sensitive isolates were AME positive. These results suggest that efflux pumps and outer membrane proteins should be investigated to explain the aminoglycoside resistance in A. baumannii isolates. The presence or absence of AME genes is unlikely to be sufficient to explain the resistance profiles detected.

AP-PCR method used in this study was not sufficient to molecularly distinguish A. baumannii isolates. Therefore, the various resistance groups and AP-PCR group were grouped together. We suggest that pulsed-field gel electrophoresis and a molecular typing method should be used to analyze A. baumannii isolates.

In this study, hospital isolated carbapenem-resistant A. baumannii strains were investigated to determine whether there is an association between AMEs and carbapenem-resistance. We detected no relationship between carbapenem-sensitivity and the presence of AME genes. In conclusion, both acetyltransferases and phosphotransferases were widespread in A. baumannii clinical isolates in our study. However, the presence of the enzyme alone is insufficient to explain the resistance rates. Therefore, the association between the development of resistance and the presence of the enzyme and other components should be investigated further.

Disclosure of conflict of interest

None.