PTPN14 interacts with and negatively regulates the oncogenic function of YAP

Abstract

The Hippo signaling pathway regulates cellular proliferation and survival, thus exerting profound effects on normal cell fate and tumorigenesis. The pivotal effector of this pathway is YAP, a transcriptional co-activator amplified in mouse and human cancers where it promotes epithelial-to-mesenchymal transition and malignant transformation. Here, we report a novel regulatory mechanism for the YAP oncogenic function via direct interaction with non-receptor tyrosine phosphatase 14 (PTPN14) through the WW domain of YAP and the PPxY domain of PTPN14. We also found that YAP is a direct substrate of PTPN14. In addition, luciferase reporter assay showed that the inhibition of the YAP transcriptional co-activator function by PTPN14 is mediated through their protein interactions and may result from an increase in the inactive cytoplasmic form of YAP. Last, knockdown of PTPN14 induces the nuclear retention of YAP and increases the YAP-dependent cell migration. In summary, our results indicate a potential regulatory role of PTPN14 on YAP and demonstrate a novel mechanism in YAP regulation.

INTRODUCTION

Functional screens in Drosophila have identified a novel signaling pathway that regulates organ size by modulating cell growth, proliferation and apoptosis.^1–4 The key components of this pathway include two serine/threonine kinases, Hippo and Warts, as well as a transcriptional co-activator Yorkie. Loss-of-function of Hippo or Warts results in increased proliferation and resistance to cell death^5–7 and overexpression of Yorkie phenocopies this effect, consistent with the negative regulation of Yorkie by Warts and Hippo. Yorkie activation has been associated with elevated expression of cyclin E and DIAP, potentially contributing to both proliferative and anti-apoptotic effects.^8,9 The mammalian Yorkie ortholog, YAP, was originally identified as a binding partner for the Src family member YES^10,11 and numerous additional interacting partners were subsequently described, including TEADs, Smad1, RUNX, ErbB4 and p73 transcription factors.^2,3,12–18 Among them, TEAD family transcription factors were found to be critical in the YAP regulation of gene expression.¹⁶

Using array comparative genomic hybridization (aCGH) in a mouse tumor model, we have previously identified YAP as the ‘driver’ gene in a small focal genomic amplification,¹⁹ which is syntenic to a larger multi-gene amplification present in human cancers of the pancreas, head and neck, ovary, cervix and oral squamous-cell carcinomas. We further demonstrated that overexpression of YAP can induce epithelial-to-mesenchymal transition in mammary epithelial MCF10A cells.¹⁹ Epithelial-to-mesenchymal transition was first recognized as a central process in early embryonic morphogenesis, and its reversal, mesenchymal-to-epithelial transition, also occurs and is important in tissue construction in normal development. Interestingly, both these physiological processes have been proposed to be involved in carcinoma progression, and particularly, metastasis. For example, epithelial-to-mesenchymal transition has been recently shown to have multiple roles in tumor metastasis, ranging from dissemination of primary cancer cells to formation of cancer stem cells and circulating tumor cells.^20,21

Since YAP is the pivotal effecter of the Hippo pathway, it is of crucial importance to understand its regulation within the physiological and pathological conditions. Genetic and biochemical studies have proposed that YAP is inhibited by the Hippo pathway.^2,3,22 Activation of the Hippo pathway leads to the phosphorylation and inhibition of YAP by Lats1/2 (ortholog of Drosophila Warts), in that phosphorylation of YAP Ser127 induces the binding of 14-3-3 and subsequent YAP sequestration in the cytoplasm.^23,24 YAP is thus physically separated from its interacting transcriptional partners and deprived of its transcriptional co-activation function. Phosphorylation of YAP can also result in its degradation.²⁵ More recently, adherens junction protein α-catenin, tight junction protein ZO-2, apical transmembrane protein Crumbs (Crb) and angiomotin (AMOT) family proteins have been shown to be strong interacting partners of YAP and contribute to the YAP localization to tight junctions as well as its inhibition through the phosphorylation-dependent and-independent mechanisms.^26–33

In the present study, we report a novel regulatory mechanism for the YAP oncogenic function by non-receptor tyrosine phosphatase 14 (PTPN14) through direct interaction between the PTPN14 PPxY motifs and YAP WW domains. In addition, we showed that YAP is a direct substrate of PTPN14; and PTPN14 inhibits the transcriptional co-activator activity of YAP through their protein interactions and likely the increased cytoplasmic accumulation of inactive YAP. Last, knockdown of PTPN14 leads to nuclear retention of YAP and increases the YAP-dependent cell migration. Taken together, our data indicate a potential regulatory role of PTPN14 on YAP and demonstrate a novel mechanism in the YAP regulation.

RESULTS

YAP interacts with PTPN14 protein

To identify YAP-interacting proteins, we performed affinity purification experiment using MCF10A cells stably expressing Flag-YAP, and the eluted YAP-associated proteins were analyzed by mass spectrometry. As a result, multiple peptides within the PTPN14 protein were recovered (Figure 1a). To confirm the interaction between PTPN14 and YAP, we performed co-immunoprecipitation and found that PTPN14 could be readily pulled down by YAP and vice versa (Figure 1b).

Figure 1.

Identification of PTPN14 as a YAP-interacting protein. (a) Mass spectrometry identification of PTPN14 in Flag-YAP immunoprecipitation of the MCF10A cell lysate. Peptide sequences of PTPN14 identified by mass spectrometry are shown. (b) Interaction of PTPN14 and YAP. Flag-YAP and V5-PTPN14 were co-transfected into HEK293T cells. YAP and PTPN14 interaction was examined by reciprocal co-immunoprecipitation as indicated.

PTPN14 contains two conserved structural elements: an amino terminal FERM domain (band 4.1-ezrin-radixin-moesin family of adhesion molecules) and a carboxyl terminal protein tyrosine phosphotase domain^34,35 (Figure 2a). To further investigate whether YAP interacts with PTPN14 through these conserved domains, we performed co-immunoprecipitation using PTPN14 constructs deleted of either the amino terminal FERM domain or the carboxyl terminal PTP domain. It was found that either domain is dispensable to the interaction between PTPN14 and YAP (Figure 2b).

Figure 2.

The PPxY motifs of PTPN14 and WW domains of YAP are essential for their interaction. (a) Schematic representation of the PTPN14 and YAP molecules. Human PTPN14 and YAP are drawn in scale. FERM, 4.1 protein, ezrin, radixin and moesin domain; PTP, protein tyrosine phosphatase domain; WW, WW domain. (b) Deletion of either FERM or PTP domain of PTPN14 has no effect on PTPN14 and YAP interaction. Flag-YAP was co-transfected with WT, C terminus-deleted or N terminus-deleted V5-PTPN14 into HEK293T cells. YAP and PTPN14 interaction was examined by co-immunoprecipitation as indicated. (c) PPxY motifs in PTPN14 are essential for YAP interaction. WT or PPxY-motif-mutant PTPN14 was co-transfected with Flag-YAP into HEK293T cells. PPxA1, PPxA2 and PPxA1PPxA2 denote PTPN14 with mutations of the first, second or both PPxY motifs, respectively. YAP was immunoprecipitated, and the co-immunoprecipitated PTPN14 was examined by anti-V5 immunoblot. (d) WW domain of YAP is essential for PTPN14 interaction. Experiments were performed similarly to those in c except that the first WW domain deletion (ΔWW1) and the second WW domain deletion (ΔWW2) of YAP were used.

One unique feature of the Hippo pathway is that many of its components contain either the WW or PPxY domain,^36,37 which mediates certain protein–protein interactions. Of note, YAP contains two WW domains and PTPN14 contains two PPxY motifs. Therefore, we hypothesized that PTPN14 interacts with YAP through these domains. To test this hypothesis, we built PTPN14 constructs containing mutations at either one or both of the PPxY motifs. Interestingly, mutations at either PPxY motif had minimal effect, whereas mutations at both PPxY motifs completely abolished the interaction between PTPN14 and YAP (Figure 2c). In contrast, co-immunoprecipitation also showed that deletion of either WW domain of YAP disrupted the PTPN14 and YAP interaction (Figure 2d). Taken together, our data strongly suggested that the YAP and PTPN14 interaction is mediated through the typical WW domain and PPxY motif.

YAP is a direct substrate of PTPN14

Given the fact that PTPN14 is a non-receptor tyrosine phosphotase, we next asked whether YAP is a direct substrate of PTPN14. To address this question, we made use of the GST-tagged constructs containing either the N-terminal three tyrosine sites of YAP between amino acid 176–202 (YAP-N3Y) or the C-terminal three tyrosine sites between amino acid 379–460 (YAP-C3Y). As YAP was initially identified as a Src family protein YES-interacting protein,¹¹ we first tested whether Src could phosphorylate YAP-N3Y and/or -C3Y using the in vitro kinase assay (Figure 3a). Indeed, we found that YAP-N3Y and -C3Y could be readily phosphorylated by the Src kinase. To further investigate whether PTPN14 could remove the phosphate group added by Src kinase, we carried out the in vitro de-phosphorylation assay using IPed-PTPN14 (Figure 3b). However, no change at the signal level of P³²-labeled YAP tyrosine was detected for either YAP-N3Y or -C3Y (Figures 3c and d). As fragment of YAP may not accurately represent the behavior of the whole molecule, we took advantage of the more natural context in cultured cells and a commercially available antibody specific for the tyrosine-357 of YAP. Consistently, co-transfection of v-Src or constitutively active c-Src mutant (Y527F) together with YAP into HEK293T cells showed a dramatic increase of tyrosine-phosphorylated YAP (Figure 3e). More interestingly, when we co-transfected YAP and v-Src with PTPN14-WT or PTPN14-ΔC, which contains no phosphatase domain, we observed a dramatic decrease of tyrosine-phosphorylated YAP in PTPN14-WT compared with PTPN14-ΔC-transfected cells (Figure 3f). In conclusion, our results demonstrated that YAP is a direct substrate of PTPN14.

Figure 3.

YAP is a direct substrate of PTPN14. (a) Tyrosines contained in the N-terminal and C-terminal portion of YAP are targeted by Src in vitro. Coomassie staining shows GST-tagged paxillin, the N-terminal tyrosines of YAP (YAP-N3Y) and the C-terminal tyrosines of YAP (YAP-C3Y) expressed from the pGEX vector and purified from the BL21-pLysS bacteria following IPTG induction. In vitro kinase assay shows Src-phosphorylated YAP-N3Y and -C3Y; Paxillin served as positive control. (b) Immunoprecipitated PTPN14-WT and PTPN14-ΔC by anti-V5 antibody. (c) In vitro phosphatase assay failed to detect de-phosphorylation of YAP tyrosine in YAP –N3Y. Phosphorylated YAP-N3Y was diluted in phosphatase buffer and reacted with immunoprecipitated WT- or ΔC-PTPN14 for increasing amounts of time at 30 °C. Reactions were subjected to SDS–PAGE, and ³²P incorporation was detected by autoradiography. (d) In vitro phosphatase assay failed to detect de-phosphorylation of YAP tyrosine in YAP-C3Y. (e) Src-phosphorylated YAP in vivo. v-Src or constitutively active c-Src (Y527F) plasmids were co-transfected with YAP in HEK293T cells. Immunoblot shows increased level of YAP phospho-Y357 in response to Src. β-actin used as loading control. (f) YAP is a direct substrate of PTPN14. WT- or ΔC-PTPN14 co-transfected with YAP and v-Src in HEK293T cells. Protein levels were quantitated by phosphorimaging and the amount of phosphorylated YAP, relative to the total YAP was determined (lower panel). β-actin used as loading control.

PTPN14 regulates YAP subcellular localization and inhibits its transcriptional co-activator activity

One known YAP regulatory mechanism in the Hippo signaling pathway is through YAP phosphorylation at Ser127 by Lats1/2 and subsequent cytoplasmic retention by 14-3-3 binding. Therefore, to test whether PTPN14 exerts the negative effect on YAP through cytoplasmic sequestration, we first performed immunofluorescence microscopy to visualize YAP localization in PTPN14-overexpressing ACHN cells. YAP was exclusively localized in the cytoplasm of PTPN14-transduced cells in contrast to the vector control cells in which YAP was localized in the nucleus (Figure 4a). We further examined the level of cytoplasmic phospho-Ser127 YAP by immunoblot in ACHN cells. Of great interest, we detected an increased level of the inactive cytoplasmic form of phospho-Ser127 YAP, as well as an increase of the upstream kinase Lats1 protein (Figure 4b). The above data provided an intriguing possibility for a second regulatory mechanism of PTPN14 on YAP, that is, through increased serine phosphorylation of YAP.

Figure 4.

PTPN14 reduces the transcriptional co-activator activity of YAP on TEAD and leads to YAP nuclear exclusion. (a) Overexpression of PTPN14 results in YAP nuclear exclusion. Immunofluorescence microscopy (magnification, ×63) shows YAP localization in the cytoplasm of PTPN14-overexpressing ACHN cells in contrast to the nuclear localization in vector control cells. Quantification of YAP localization in either nuclear or cytoplasm were indicated. (b) Overexpression of PTPN14 increases the level of phospho-Ser127 YAP and Lats1 in ACHN cells. β-actin used as loading control. (c) PTPN14 inhibits YAP transcriptional co-activity in the luciferase reporter assay. Indicated plasmids were co-transfected with 5 × UAS-luciferase reporter, Gal4-TEAD4 and Renilla (as internal control for transfection efficiency). (d) qRT–PCR analysis of the YAP target genes in ACHN cells. GAPDH was used as an internal control. Error bars equal ± s.d.

To investigate whether PTPN14 has an effect on the transcriptional co-activator activity of YAP, we performed in HEK293T cells the transcriptional co-activation assay of YAP and TEAD4, a major mediator of the YAP function. It was found that although YAP strongly co-activated TEAD4-mediated transcription, this effect was abolished by PTPN14. More intriguingly, PTPN14 deficient in both PPxY motifs lost this inhibitory effect on YAP, indicating the important role of PTPN14 and YAP interaction in their function (Figure 4c). To further validate the effect of PTPN14 on YAP transcriptional co-activity in a more natural environment, we examined the expression of some YAP target genes such as CTGF, Cyr61 and COL8A1, which had been previously identified by the authors and other groups.^16,22,28 Real-time qRT–PCR was performed using the RNA harvested from PTPN14- and vector-control-transduced ACHN cells. It was found that the expression of CTGF, Cyr61 and COL8A1 was significantly decreased in the PTPN14-transduced cells, but not in the control cells (Figure 4d). Together, our results indicated that PTPN14 led to sequestration of YAP in the cytoplasm and inhibited the YAP transcriptional co-activator function, potentially through both direct and indirect effects on YAP.

Knockdown of PTPN14 induces YAP nuclear retention and increases YAP-dependent cell migration

To determine the role of endogenous PTPN14 in controlling YAP subcellular localization and function, we investigated the effect of PTPN14 knockdown with two independent lentiviral shRNA constructs in the human mammary epithelial MCF10A cells. Efficient knockdown of PTPN14 was confirmed by immunoblot (Figure 5a). As expected, in the PTPN14-knockdown cells, decreased cytoplasmic form of phospho-Ser127 YAP was observed without obvious alterations at the total YAP protein level (Figure 5a). The subcellular localization of YAP has been reported to be regulated by cell density,²³ that is, at low cell density YAP is predominantly localized in the nucleus, whereas at high density YAP is translocated into the cytoplasm. Interestingly, PTPN14 has been shown to be localized in the nucleus of the proliferating human umbilical vein endothelial cells but in the cytoplasm of the quiescent cells.³⁵ We thus first investigated whether the localization of endogenous PTPN14 is also dependent on the cell density in MCF10A cells. Surprisingly, PTPN14 was only found to be localized in the cytoplasm regardless of cell density (Supplementary Figure S1). We then used immunofluorescence microscopy to examine whether knockdown of PTPN14 would have an effect on the YAP localization. As expected, at low cell density YAP was indeed localized in the nucleus of both PTPN14-knockdown and control cells (Supplementary Figure S2). However, at high cell density, YAP was only localized in the cytoplasm of control cells, but remained exclusively in the nucleus of the PTPN14-knockdown cells (Figure 5b). This result is of great interest, because it indicated that the loss of endogenous PTPN14 leads to mislocalization of YAP at high cell density. Furthermore, to investigate the altered YAP function due to PTPN14-knockdown, we performed real-time qRT–PCR and found that the expression of YAP targets, CTGF, Cyr61 and COL8A1, was significantly increased in the PTPN14-knockdown cells compared with control cells (Figure 5c). Finally, we carried out the transwell cell migration assay in MCF10A cells to see whether loss of endogenous PTPN14 would affect cell migration. As a result, we observed a significant increase of cell migration in the PTPN14-knockdown cells as compared with the control cells (Figure 5d). In addition, when we concomitantly knocked down YAP and PTPN14 (Supplementary Figure S3), the previously observed increase of cell migration was abrogated (Figure 5d), strongly suggesting that the enhanced cell migration induced by PTPN14-knockdown is mediated through YAP.

Figure 5.

Knockdown of PTPN14 induces YAP nuclear retention and increases cell migration in a YAP-dependent manner. (a) Knockdown of PTPN14 decreases the level of phospho-Ser127 YAP. Immunoblot demonstrates efficient knockdown of PTPN14 with the two independent lentiviral shPTPN14 constructs in MCF10A cells. Reduced phospho-Ser127 YAP level was detected in PTPN 14-knockdown cells compared with the control cells, with no change observed at the total YAP protein level. β-actin used as loading control. (b) Knockdown of PTPN14 results in YAP nuclear retention at high cell density in MCF10A cells. At high cell density, immunofluorescence microscopy shows that YAP (magnification, ×63) was localized in the cytoplasm of vector control cells, whereas YAP nuclear retention remained in the PTPN14-knockdown cells. Quantification of YAP localization in either nuclear or cytoplasm were indicated. (c) qRT–PCR analysis of the YAP target genes in MCF10A cells. GAPDH was used as an internal control. Error bars equal ± s.d. (d) Knockdown of PTPN14 increases YAP-dependent cell migration. Control, two independent PTPN14-knockdown or YAP and PTPN14 concomitant knockdown MCF10A cells were plated onto 8-µm transwell filters and allowed to migrate for 24 h. Data are the mean number of migrated cells per field of four fields from each of the triplicate wells. Error bars equal ± s.d. of three independent experiments.

DISCUSSION

Our study reports the identification of a novel YAP-interacting protein PTPN14 and its negative regulation of the YAP oncogenic function. First, we identified PTPN14 and YAP interaction through the typical WW domain and PPxY motif; second, we showed that YAP is a direct substrate of PTPN14; third, PTPN14 leads to the cytoplasmic sequestration of YAP, which negatively regulates its transcriptional co-activation function in a manner both dependent and independent of their protein interactions; and last, knockdown of PTPN14 by shRNA results in the mislocalization of YAP. Overall, our study identified PTPN14 as a novel regulator of YAP.

PTPN14 has been reported to reside at different subcellular loci subject to a variety of influential factors, such as cell type, cell-matrix adhesion,³⁸ serine phosphorylation³⁹ and cell confluence.³⁵ This characteristic of PTPN14 implicates differential regulation from this molecule in alternative cell states and cellular contexts.⁴⁰ Our current study sheds more light on the regulatory mechanism of PTPN14, as we identified that the key effector of the Hippo pathway, YAP, not only interacts with PTPN14, but also serves as its direct substrate. One of the further questions to ask is whether the YAP and PTPN14 interaction adds another layer to the fine-tuning of the YAP function. It has been reported that the phosphorylation YAP tyrosine is necessary for its interaction with Runx2 as well as for its subsequent nuclear trafficking,¹⁸ and inhibition of the Src/Yes kinase blocks the tyrosine phosphorylation of YAP and dissociates the endogenous Runx2–YAP complexes.¹⁸ Therefore, it will be of interest to examine whether PTPN14 has any effect on the Runx2–YAP interaction and subsequently has a role in the processes orchestrated by YAP and its interacting transcriptional factors, for example, osteoblast maturation and bone formation.

As a non-receptor protein tyrosine phosphatase (PTP),⁴¹ PTPN14 is reported to mediate the de-phosphorylation of tyrosine residues in an adherens junction protein, β-catenin.⁴² Interestingly, it has been recently shown that YAP interacts with another adherens junction protein, α-catenin in epidermis.^30,33 Binding of the YAP/14-3-3 complex to α-catenin stabilizes this complex and inhibits the access of PP2A to YAP.³⁰ Furthermore, the Crb polarity complex, including PALS1, PATJ, MUPP1, LIN7C and AMOT, interacts with YAP and relays cell density information by promoting YAP phosphorylation and its cytoplasmic retention as well as by suppressing the TGF-β signaling.³¹ All these facts suggest for a hypothesis that there may be extensive crosstalk among the adherens junction and polarity complex proteins, PTPN14 and the Hippo pathway. Indeed, our finding that the protein level of Lats1 was increased in the PTPN14-transduced cells offered initial hints to their interplay, whereas more intensive and extensive studies are in order to decipher the underlying mechanisms. Intriguingly, while our manuscript was undergoing revision, a report was published by Poernbacher and his colleagues demonstrating that Drosophila Pez (the ortholog of PTPN14) interacts with the upstream Hippo signaling component Kibra and functions as a negative upstream regulator of Yki (the ortholog of YAP) in the regulation of Drosophila intestinal stem cell proliferation.⁴³ It has also been shown that mammalian Kibra protein interacts with Lats1/2 and stabilizes Lats protein.⁴⁴ Therefore, it will be of interest to test whether the interaction between PTPN14 and Kibra is conserved in mammals and whether this interaction contributes to the increased protein level of Lats1.

The role of PTPN14 in cancer has been proposed as a number of its mutations are reported in breast and colorectal tumors.^45,46 In particular, a gene expression profiling of mouse pancreatic tumors revealed PTPN14 as significantly downregulated (P<10^−10.8) in the tumor invasion front and liver metastasis as compared with the primary tumor, and the finding was validated by immunohistochemistry.⁴⁷ Combined with our identification of PTPN14 as an interacting protein of YAP and a negative regulator of the YAP oncogenic property, it would be tempting to propose PTPN14 as a tumor-suppressor gene. Conceivably, further studies of the interactions between YAP and PTPN14, as well as the interactions among their extended partners, and of their functional mechanisms, will greatly contribute to our understanding of the Hippo pathway and to the advancement of cancer therapeutics.

MATERIALS AND METHODS

Cell culture and transfection

MCF10A cell culture was performed as previously described.⁴⁸ ACHN cells were maintained in Dulbecco’s modified eagle medium supplemented with 10% fetal bovine serum, 2mm l-glutamine, 50 U/ml penicillin/streptomycin and incubated at 5% CO₂ at 37 °C.

For knockdown experiments, shRNA hairpins targeting human YAP and PTPN14 were obtained from the RNAi Consortium (The Broad Institute, Boston, MA, USA). The target sequences are listed (in the 5’–3’ direction):

• shYAP: CCCAGTTAAATGTTCACCAA;

• shPTPN14-1: GCGGTAATATACAGGTGGAAT;

• shPTPN14-2: CGCTCAGTACAAGTTTGTCTA;

• Control-shRNA: CAACAAGATGAAGAGCACCAA.

Lentivirus packaging, ACHN and MCF10A cell transduction and drug selection were performed following standard protocols and was described previously.^22,49

Plasmid constructs

The human PTPN14 ORF was cloned into pCDNA3 vector as an EcoRI–NotI fragment. YAP expression construct was described previously.²² PTPN14 mutant and YAP mutant constructs were established by PCR-based mutagenesis and confirmed by DNA sequencing.

Antibodies and molecular biology analyses

YAP (phospho-Ser127), Src antibody was purchased from Cell Signaling Technology (Beverly, MA, USA); YAP and PTPN14 antibodies from Santa Cruz (Santa Cruz, CA, USA); β-actin antibody from Upstate (Lake Placid, NY, USA); Flag (M2) antibodies from Sigma (St Louis, MO, USA); V-5 antibody from Invitrogen (Grand Island, NY, USA); YAP (phospho-Tyr-357) from Abcam (Cambridge, MA, USA). For protein extraction, cells were washed with phosphate-buffered saline and collected with IP buffer: 20mm Tris-HCl (pH 8.0), 150mm NaCl, 20% glycerol, 0.5% NP-40, 1 × protease inhibitor cocktail (Complete EDTA-free, Roche, South San Francisco, CA, USA). Cell lysate was cleared by centrifugation at 14 000 r.p.m. for 20 min at 4 °C. Lysate was loaded onto 4–15% MINI-PROTEAN TGX gel (Bio-Rad, Hercules, CA, USA) with 4× SDS sample buffer. For immunoblot, proteins were transferred onto Immobilon-P membrane (Millipore, Billerica, MA, USA), detected by various antibodies and visualized with ECL Plus Western Blotting Detection Reagents (GE Healthcare, Piscataway, NJ, USA).

For RNA preparation and qRT–PCR, RNA was extracted using the Trizol reagent (Invitrogen). cDNA synthesis was performed using First-Strand cDNA Synthesis Kit (GE Healthcare) and quantitative real-time PCR was performed using Power SYBR Green PCR Master Mix (Invitrogen).

Sequences of the qPCR primer pairs (in the 5’-3’ direction) are as follows:

• GAPDH-F: GGTGAAGGTCGGAGTCAACGG;

• GAPDH-R: GAGGTCAATGAAGGGGTCATTG;

• COL8A1-F: CAGAAACCAGCCCCAGAGGTGTCAC;

• COL8A1-R: GAAATGGTAAGCAGCACTCCCAGCAG;

• CTGF-F: GCAGAGCCGCCTGTGCATGG;

• CTGF-R: GGTATGTCTTCATGCTGG;

• CYR61-F: CACACCAAGGGGCTGGAATG;

• CYR61-R: CCCGTTTTGGTAGATTCTGG.

All measurements were performed in triplicate and standardized to the levels of GAPDH.

Cell migration

Transwell cell migration assay was performed as previously described.¹⁹

Immunofluorescence microscopy

ACHN and MCF10A cells were cultured on coverslips to appropriate density. Cells were fixed with 4% paraformaldehyde for 15 min and then permeabilized with 0.1% Triton X-100 for 15 min. After blocking in 3% BSA for 30 min, slides were incubated with the primary antibody diluted in 1% BSA for 1 h. After washing with PBS, slides were incubated with Alexa Fluor 488- or 594-conjugated secondary antibodies (1:1000 dilution) for 1 h.

GST-pull-down assay and in vitro kinase assay

GST-tagged versions of paxillin, the N-terminal tyrosines of YAP (amino acid 176–202, YAP-N3Y) and the C-terminal tyrosines of YAP (amino acid 379–460, YAP-C3Y) were expressed from the pGEX vector (GE) and purified from BL21-pLysS bacteria following IPTG induction. Protein quality and loading was verified by Coomassie staining. Equal amounts of protein were reacted with recombinant Src and 10uCi ³²P-ATP in buffer containing 50mm Tric-Cl, pH 7.4, 10mm MgCl₂, plus protease inhibitors. Following incubation at 30 °C for 30 min, reactions were subjected to SDS–PAGE, and ³²P incorporation was detected by autoradiography.

In vitro phosphotase assay

V5-tagged wild-type (WT)-PTPN14 or a mutant version lacking the PTP domain (ΔC) were expressed in HEK293T. Cells were lysed in RIPA buffer, and cleared lysates were subjected to immunoprecipitation with anti-V5 antibody, followed by immobilization on protein A/G agarose. Beads were washed twice with RIPA buffer and twice with phosphatase buffer (50mm Tris-Cl, pH 7.5, 100mm NaCl, 2mm EDTA, 5mm DTT, 0.01% Brij 35, plus protease inhibitors) before use in phosphatase assay. Purified GST-YAP-N3Y or -C3Y were pre-phosphorylated in vitro by reacting with Src and ³²P-ATP in buffer containing 50mm Tric-Cl, pH 7.4, 10mm MgCl₂, 1mm DTT, plus protease inhibitors. Subsequently, Src was heat-inactivated, and excess ATP was removed. Phosphorylated YAP-N3Y or -C3Y were diluted in phosphatase buffer and reacted with immunoprecipitated WT or ΔC PTPN14 for increasing amounts of time at 30 °C. Reactions were subjected to SDS–PAGE, and ³²P incorporation was detected by autoradiography.

Statistical analysis

Statistical analysis of data was performed using the SPSS statistics software package (SPSS, IBM, Armonk, NY, USA). All results are expressed as mean ± s.d. *P<0.05; **P<0.001; ***P<0.0001.