Abstract
Background:
Adult worms of Orientobilharzia turkestanicum live in the portal veins, or intestinal veins of cattle, sheep, goat and many other mammals causing orientobilharziasis. Orientobilharziasis causes significant economic losses to livestock industry of Iran. However, there is limited information about genotypes of O. turkestanicum in Iran.
Methods:
In this study, 30 isolates of O. turkestanicum obtained from sheep were characterized by sequencing mitochondrial cytochrome c oxidase subunit 1 (cox1) and nicotinamide adenine dinucleotide dehydrogenase subunit 1 (nad1) gene. The mitochondrial cox1 and nad1 DNA were amplified by polymerase chain reaction (PCR) and then sequenced and compared with O. turkestanicum and that of other members of the Schistosomatidae available in Gen-Bank™.
Results:
Phylogenetic relationships between them were re-constructed using the maximum parsimony method. Phylogenetic analyses done in present study placed O. turkestanicum within the Schistosoma genus, and indicates that O. turkestanicum was phylogenetically closer to the African schistosome group than to the Asian schistosome group.
Conclusion:
Comparison of nad1 and cox1 sequences of O. turkestanicum obtained in this study with corresponding sequences available in Genbank™ revealed some sequence variations and provided evidence for presence of microvarients in Iran.
Keywords: Orientobilharzia turkestanicum, Sheep, Iran
Introduction
Parasites of the genus Orientobilharzia belong to Platyhelminthes, Trematoda, Digenea, Schistosomatidae, and the type species is Orientobilharzia turkestanicum (1, 2). Adult worms of O.turkestanicum live in portal veins, lungs or intestinal veins of cattle, sheep, goat and large numbers of other mammals (5, 6). The body size of male and female worm is 2–10 mm and 2–8 mm respectively (7). This parasite causes orientobilharziasis infection (6) reported in many parts of the world such as Kazakhstan, China, Pakistan, Mongolia, India, Iraq and Iran in Asia, and Russia and Turkey in Europe (2, 3, 4, 7, 8).
Despite animals such as dogs and birds, which did not show any sign of infection, this parasite causes harmful effects on venous systems and mucous membranes in sheep and goat (9). Cattle and sheep that are infected with O. turkestanicum often display a chronic disease, presenting the syndrome of emaciation, anemia and diarrhea, and may have deciduous mucosa and blood in the feces. Other symptoms include pale mucous membranes, edema in the jaw and abdomen. The female animals may suffer from abortion, and the young animals grow slowly (10). More importantly, the cercariae of O. turkestanicum can also infect humans and often cause cercarial dermatitis (11) and are considered the major pathogen of cercarial dermatitis in the Caspian Sea area of Iran (12) and several provinces of the People’s Republic of China (6) posing significant public health problem in a number of countries (10). According to previous studies many species of Orientobilharzia have been reported named O. bomfordi (13), O. cheni (14), O. turkestanicum (2), O. dattai (15), O. harinasutai (16) and O. turkestanicum var.tiberculata (17). Traditional classification and understanding of phylogenetic relationships among Schistosomatidae is based on geographic distribution, morphological characteristics of adult parasites and eggs, transmission and pathogenesis as well. Today, it has becoming a common practice to use DNA sequencing for inferring evolutionary relationship among parasites.
The present study was done to sequence the mitochondrial cytochrome c oxidase subunit1 and nicotinamide adenine dinucleotide dehydrogenase subunit1 genes of O. turkestanicum from sheep isolates in Iran and compare them with corresponding sequences of Orientobilharzia spp., available in GenBank™ for any probable variations and examine the phylogenetic relationships of O. turkestanicum with other members of the Schistosomatidae using the nucleotide sequences of cox1 and nad1 mtDNA.
Materials and Methods
Specimen collection
The O. turkestanicum isolate used in present study was from Mazandaran Province in Iran, 2014. Adult blood fluke of O. turkestanicum was obtained from the portal and mesenteric veins of sheep (Fig. 1), washed extensively in physiological saline, identified based on morphological characters according to existing keys and descriptions (18), and fixed in 70% (v/v) ethanol until use. For confirmation of diagnosis, 5 trematodes fixed in alcohol 70 % with a little glycerin were sent to British Natural Museum. The specimen deposited in British Natural Museum as O. turkestanicum with the code of BM (2013.04.18.1–5).
Fig. 1:

Orientobilharzia turkestanicum in mesenteric veins in a sheep Infected (left) and Adult male & Female of Orientobilharzia turkestanicum isolated from infected sheep (right)
DNA extraction and amplification
Total genomic DNA was extracted from a mixture of five males and five females by QIAamp DNA Mini Kit according to the manufacturer’s instructions (QIAGEN). The DNA sample was stored at −20 °C until further use. To obtain mtDNA sequences, fragments of approximately 1,100 bp and 525 bp of mitochondrial cytochrome C oxidase sununit 1 (cox1) and nicotinamide adenine dinucleotide dehydrogenase subunit 1 (nad1) genes were amplified respectively using forward primer p1 (5′- GGCGGGTTTATAGGTTTAG -3′) and altered reverse primer p2 (5′- CTTATTTAATGAATAACCAACTATA - 3′) for cox1 gene reported by Li, 2008 and forward primer p3 (5′- AGATTCGTAAGGGGCCTAATA -3′) and reverse primer p4 (5′- ACCACTAACT-AATTCACTTTCGGA -3′ )for nad1 gene (Li, 2008).
The PCR mixture was carried out in 50 μl volumes containing 2 μl of sample DNA (100 ng), 1× PCR buffer, 2 mM MgCl2, 240 μM dNTP mix 200 nM of each primers and 1.5 unit Taq DNA polymerase, in an automated thermocycler. The PCR was performed using the following protocol: 3 minutes incubation at 94 °C to denature the double stranded DNA, then 35 cycles of a 1 min at 94 °C (denaturing step), 45 s at 53 °C (annealing step), and 45 s at 72 °C (extension step). Finally, the PCR was completed with an additional extension step for 10 min for cox1. For nad1, PCR protocol was as 3 minutes incubation at 94 °C, then 35 cycles of a 1 min at 94 °C (denaturing step), 45 s at 50 °C (annealing step), and 45 s at 72 °C (extension step), followed by final extension at 72 °C for 10 min. Samples without genomic DNA were used as negative controls. The PCR products were analyzed on 1.5% agarose gels in 0.5× TBE buffer and visualized using gel documentation system (KODAK Gel Logic 200 Imaging System).
Sequence alignment and Phylogenetic analyses
The PCR product was purified using a quick PCR product purification kit (Roche) according to the manufacturer’s recommendations. DNA sequencing was performed for each of the PCR products by Bioneer Company. The sequence chromatograms were analyzed using the Chromas version 3.1 software and compared to those registered in GenBank™ using the ‘Basic Local Alignment Search Tool’ (BLAST). Then the nucleotide sequences were aligned using the ClstalW method of MegA-lign (DNA Star) and Mega5 programs. Phylo-genetic analyses were performed using the maximum parsimony method utilizing the Mega5 program. A correspondent nucleotide sequence of Fasciola hepatica (GenBank™ accission AJ628039 for cox1 gene and AJ630405 for nad1 gene) was used as an out-group.
Results
The extracted genomic DNA was used to amplify the cox1 and nad 1 PCR. The cox1 and nad1 PCR products showed an expected fragment of nearly 1,100 bp and 500 bp in length respectively. Nucleotide sequence analysis revealed that all of the samples were Orientobilharzia turkestanicum. The sequences were analyzed by multiple alignments with reported reference sequences for the Orientobilharzia genotype.
The phylogenetic relationship between the isolated sequences and various genotypes of orientobilharzia based on cox1 and nad1 genes were shown in Fig. 2.
Fig.2-A:

phylogenic relationship between the isolated sequences and various members of Schistosomatidae by maximum parsimony method based on the nad1 sequences. Fasciola hepatica (AJ630405) used as the out group. The various members of the Schistosomatidae used were consist of: orientobilharzia cheni (AF289088), Schistosoma haematobium (NC_008074), Schistosoma mansoni (AF216698), Schistosoma malayensis (AF295106) and Schistosoma mekongi (AF217449)
Fig. 2-B:

phylogenic relationship between the isolated sequences and various members of Schistosomatidae by maximum parsimony method based on the cox1 sequences. Fasciola hepatica (AJ628039) used as the out group. The various members of the Schistosomatidae that used were consist of Schistosoma bovis (AY157212), Schistosoma intercalatum (AY157208), Schistosoma leiperi (AY157207), Schistosoma haematobium (AY157209), Schistosoma mattheei (AY157211), Schistosoma margrebowiei (AY157206), Schistosoma mansoni (U82265), Schistosoma rodhaini (AY157202), Orientobilharzia turkestanicum (AY157200), Schistosoma malayensis (AY157198), Schistosoma mekongi (AY157199), Schistosoma japonicum (U82264), Gigantobilharzia huronensis (AY157188), Trichobilharzia regenti (AY157190), Dendritobilharzia pulverulenta (AY157187), Bilharziella polonica (AY157186), Austrobilharzia variglandis (AY157196), Orientobilharzia canaliculata (AY157194)
Phylogenetic analyses done in present study placed O. turkestanicum within the Schistosoma genus, and indicates that O. turkestanicum was phylogenetically closer to the African schisto-some group than to the Asian schistosome group. The sequencing results of cox1 and nad1 genes of O. turkestanicum from sheep isolates of Iran were registered in GenBank™ under the fallowing accession numbers: KC456231, KC456232, KC456233, KC456234 for cox1 and KC456227, KC456228, KC456229, KC456230 for nad1.
Discussion
Limited surveys have been performed on the genotypes of O. turkestanicum originating from sheep around the world, and the present study is the first comprehensive strain characterization of sheep isolates in Iran. O.turkestanicum was reported from Khozestan Province of Iran (19). O.turkestanicum and some other related Schistosoma are distributed throughout some regions of Iran (20) and in a latest study which was performed by Razi Vaccine and Serum Research Institute, O. turkestanicum cercaria was detected by nested-PCR in intermediate snail, in Iran(9). The present study is the first genotype analysis of O. turkestanicum from sheep isolates in Iran. Mitochondrial genome is one of the best targets for discriminating between strains, so cox1 and nad1 genes provided valuable information for detection of variants of Orientobilharzia (6) as present study used nad1 and cox1 mitochondrial genes for molecular characterization of O. turkestanicum. Traditional classification of schistosomes based on different factors such as geographical distributions, intermediate and definitive hosts and morphological characteristics of adult parasites and eggs (10) is not a reliable method for systematic studies of schistosomes. So, DNA sequences of mitochondrial genes can be used as genetic markers for reliable systematic studies (21). Comparison of nad1 sequences of O. turkestanicum obtained in the present study with corresponding sequences available in Genbank™ (Accession number AF289088) revealed that there were few sequence variations at sequence position 112 (T to A) for KC456227, sequence position 276 (T to C) for KC456227, KC456228, KC456229 and KC456230, sequence position 327 (G to A) for KC456227, KC456228 and KC456229. Also comparison of the cox1 representing the O. turkestanicum samples examined in the present study with the corresponding sequence available in Genbank™ (Accession number AY157200) revealed that there were also sequence variations at sequence positions 196 (Gto A), 233 (G to A) and 441 (G to A) for KC456233, sequence positions 233 (G to C) and 325 (G to A) for KC456232 and sequence position 233 (G to A) for KC456234. These variations showed that O. turkestanicum parasite like Echinococcus granulosus genotypes G1 may have microvariants as reported in Iran (22), Prue (23) and Turkey (24).
Phylogenetic relationship of the schistosomes has been the focus of several recent studies using different genetic makers and approaches (25–29), and some of these studies placed O. turkestanicum within the genus Schistosoma. In the present study, the partial cox1 and nad 1 DNA of O. turkestanicum were amplified and sequenced used to re-construct the phylogenetic relationships of O. turkestanicum with other members of the Schistosomatidae using maximum parsimony method.
Phylogenetic analyses performed in present study placed O. turkestanicum within the Schistosoma genus, and indicates that O. turkestanicum was phylogenetically closer to the African schistosome group than to the Asian schistosome group; it was in common with the study of Wang et al. for the phylogenetic position of O. turkestanicum within the family of Schistosomatidae (10). Though Orientobilharzia species are now considered as important zoonotic agents, studies on their biochemistry, histochemistry, immunopathology and molecular biology are lacking and limited compare was performed to S. japonicum and S. mansoni. Orientobilharziasis is an important and severe disease in several mammals, and cercarial dermatitis caused by Orientobilharzia spp. may be regarded as an under-reported/neglected disease. Therefore, it is important to evaluate in detail the impact of Orientobilharzia species on human and animal health from a global perspective and intensive studies are needed in order to better control of human and animal infections with Orientobilharzia species (10). The present study is the first comprehensive genotypic analysis of O. turkestanicum infecting sheep by using PCR analysis and DNA sequencing in Iran and provided evidence for presence of microvarients.
Conclusion
The present study is the first comprehensive genotypic analysis of O. turkestanicum infecting sheep by using PCR analysis and DNA sequencing in Iran and provided evidence for presence of microvarients.
Acknowledgements
The authors would like to express their appreciation to Dr. Soud Rohani in Babol Veterinary Clinic for providing the samples. The authors declare that they have no conflicts of interest.
References
- 1.Farley J.A review of the family Schistosomatidae: Excluding the genus Schistosoma from mammals. J Helminthol . 1971; 45: 289– 320. [DOI] [PubMed] [Google Scholar]
- 2.Skrjabin KI. Schistosomum turkestanicum, nov. sp., ein neuer parasit des Rinder aus Russich-Turkestan. Ztschr. Infektionskr. u. Haustier 1913; 13: 457– 468. [Google Scholar]
- 3.Price EW.A synopsis of the trematode family Schistosomatidae with descriptions of new genera and species. Proc. US Nat Mus Wash. 1929; 75: 1– 39. [Google Scholar]
- 4.Dutt SC, Srivastava HD.Revision of the genus Ornithobilharzia odhner, 1912 (Trematoda: Schistosomatidae). Proc. 42nd Sci. Congr, 1955: 3: 285. [Google Scholar]
- 5.Soulsby EJ L.Helminths, Arthropods and Protozoa of domestic animals. Published in USA, Williams and Wilkins Company; 1982: 81– 83. [Google Scholar]
- 6.Li L, Yu LY, Zhu XQ, Wang CR, Zhai YQ, Zhao JP.Orientobilharzia turkestanicum is grouped within African schistosomes based on phylogenetic analyses using sequences of mitochondrial genes. Parasitol Res. 2008: 102: 939– 943. [DOI] [PubMed] [Google Scholar]
- 7.Yamagiwa S.A study of lesions caused by the invasion of Schistosoma turkestanicum in cattle. J Jap Soc Vet Sci. 1931: 2: 131– 132. [Google Scholar]
- 8.Tang CT, Tang ZZ, Cao H, Tang L, Cui GW, Qian YC, Lu HC.Studies on the Ornithobilharzia turkestanica in sheep in the eastern part of the Inner Mongol Autonomous Region. Acta Zool Sinica. 1983: 29: 249– 255. [Google Scholar]
- 9.Motamedi GR, Ghorashi SA, Paykari H, Dalimi AH, Salehi Tabar R, Motamedi N, Karimi GhR.Detection of Ornithobilharzia turkestanikum cercaria (trematoda) by nested-PCR in intermediate host snail, Lymnaea gedrosiana. Arch Razi Inst. 2008; 63: 35– 40. [Google Scholar]
- 10.Wang CR, Li L, Ni HB, Orientobilharzia turkestanicum is a member of Schistosoma genus based on phylogenetic analysis using ribosomal DNA sequences. Exp Parasitol. 2009; 121 ( 2): 193– 7. [DOI] [PubMed] [Google Scholar]
- 11.Digentile L, Picot H, Bordeau P, Bardet R, Kerjam A, Piriou M, Leguennic A, Bayssade-Dufour C, Chabasse D, Mott KE.Cercarial dermatitis in Europe: A new public health problem. Bulletin of the World Health Org. 1996; 74: 159– 163. [PMC free article] [PubMed] [Google Scholar]
- 12.Sahba GH, Malek A.Dermatitis caused by cercariae of Orientobilharzia turkestanicum in the Caspian area of Iran. Am J Trop Med Hyg. 1979; 28: 912– 913. [PubMed] [Google Scholar]
- 13.Montgomery R E.Observations on bilharziosis among animals in India. J Trop Vet Sci 1906; 1: 138– 174. [Google Scholar]
- 14.Hsü ST, Yang P.A preliminary study on blood flukes of cattle and sheep in Kansu province, including descriptions of a new species. Acta Vet. 1957; 2: 117– 124. [Google Scholar]
- 15.Dutt SC, Srivastava HD.On the morphology and life history of a new mammalian blood–fluke Ornithobilharzia dattai n. sp. Parasitology. 1952; 42: 144– 150. [DOI] [PubMed] [Google Scholar]
- 16.Kruatrachue M, Bhaibulaya M, Harinasuta C. Ornithobilharzia harinasutai sp. nov., a mammalian blood-fluke, its morphology and life-cycle. Ann Trop Med Parasitol. 1965; 59: 181– 188. [DOI] [PubMed] [Google Scholar]
- 17.Bhalerao GD.On the identity of the schisto-some found in cases of bovine nasal granuloma and some observations on a few other members of the Schistosomatidae. Ind J Vet Sci Anim Husb. 1932; 2: 338– 356. [Google Scholar]
- 18.Dutt SC, Srivastava HD.A revision of the genus Ornithobilharzia odhner (1912), with the creation of two genera Orientobilharzia dutt and srivastava (1955) and Sinobilharzia dutt and srivastava (1955) (Trematoda: Schistosomatidae). Ind J Helminthol. 1961; 13: 61– 73. [Google Scholar]
- 19.Massoud J.The effect of variation in miracidial exposure dose on laboratory infections of Ornithobilharzia turkestanicum in lymnaea gedrosiana. J Helminthology. 1974; 48: 139– 144. [DOI] [PubMed] [Google Scholar]
- 20.Eslami A.Trematoda Veterinary Helminthology. Tehran University Publications; 1990; 116– 146. [Google Scholar]
- 21.Wang Y, Wang CR, Zhao GH, Gao JF, Li MW, Zhu XQ.The complete mitochondrial genome of Orientobilharzia turkestanicum supports its affinity with African Schistosoma spp. Infection, Genetics and Evolution. 2011; 11: 1964– 1970. [DOI] [PubMed] [Google Scholar]
- 22.Youssefi MR, Tabaripour R, Fallah-Omrani V, Spotin A, Esfandiari B.Genotypic characterization of Echinococcus granulosus in Iranian goats. Asian Pac J Trop Dis. 2013; 3( 5): 362– 366. [Google Scholar]
- 23.Sánchez E, Cáceres O, Náquira C, Garcia D, Patiño G, Silvia H, Volotão AC, Fernandes O.Molecular characterization of Echinococcus granulosus from Peru by sequencing of the mitochondrial cytochrome C oxidase subunit 1 gene. Mem Inst Oswaldo Cruz, 2010; 105( 6): 806– 810. [DOI] [PubMed] [Google Scholar]
- 24.Vural G, Baca AU, Gauci CG, Bagci O, Gicik Y, Lightowlers MW.Variability in the Echinococcus granulosus Cytochrome C oxidase 1 mitochondrial gene sequence from livestock in Turkey and a re-appraisal of the G1–3 geno-type cluster. Vet Parasitol. 2008; 154: 347– 350. [DOI] [PubMed] [Google Scholar]
- 25.Snyder SD, Loker ES.Evolutionary relationships among the Schistosomatidae (Platyhelminthes: Digenea) and an asian origin for Schistosoma. J Parasitol. 2000; 86( 2): 283– 288. [DOI] [PubMed] [Google Scholar]
- 26.Attwood SW, Upatham ES, Meng XH, Qiu DC, Southgate VR, The phylogeography of Asian Schistosoma (Trematoda: Schistosomatidae). Parasitology. 2002; 125: 99– 112. [DOI] [PubMed] [Google Scholar]
- 27.Lockyer AE, Olson PD, Ostergaard P, Rollinson D, Johnston DA, Attwood SW, Southgate, et al. The phylogeny of the Schistosomatidae based on three genes with emphasis on the interrelationships of Schistosoma Weinland, 1858. Parasitology. 2003; 126: 203– 224. [DOI] [PubMed] [Google Scholar]
- 28.Brant SV, Loker ES, Can specialized pathogens colonize distantly related hosts? Schistosome evolution as a case study. PLoS Path. 2005; 1: e38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Webster BL, Southgate VR, Littlewood DT, A revision of the interrelationships of Schistosoma including the recently described Schistosoma guineensis. Int J Parasitol. 2006; 36: 947– 955. [DOI] [PubMed] [Google Scholar]
