Skip to main content
Microbial Biotechnology logoLink to Microbial Biotechnology
. 2015 Feb 12;8(3):510–518. doi: 10.1111/1751-7915.12253

Absence of lysogeny in wild populations of Erwinia amylovora and Pantoea agglomerans

Dwayne R Roach 1,2,, David R Sjaarda 1,2, Calvin P Sjaarda 1,2, Carlos Juarez Ayala 2, Brittany Howcroft 1,2, Alan J Castle 1, Antonet M Svircev 2,*
PMCID: PMC4408183  PMID: 25678125

Abstract

Lytic bacteriophages are in development as biological control agents for the prevention of fire blight disease caused by Erwinia amylovora. Temperate phages should be excluded as biologicals since lysogeny produces the dual risks of host resistance to phage attack and the transduction of virulence determinants between bacteria. The extent of lysogeny was estimated in wild populations of E. amylovora and Pantoea agglomerans with real–time polymerase chain reaction primers developed to detect E. amylovora phages belonging to the Myoviridae and Podoviridae families. Pantoea agglomerans, an orchard epiphyte, is easily infected by Erwinia spp. phages, and it serves as a carrier in the development of the phage-mediated biological control agent. Screening of 161 E. amylovora isolates from 16 distinct geographical areas in North America, Europe, North Africa and New Zealand and 82 P. agglomerans isolates from southern Ontario, Canada showed that none possessed prophage. Unstable phage resistant clones or lysogens were produced under laboratory conditions. Additionally, a stable lysogen was recovered from infection of bacterial isolate Ea110R with Podoviridae phage ΦEa35-20. These laboratory observations suggested that while lysogeny is possible in E. amylovora, it is rare or absent in natural populations, and there is a minimal risk associated with lysogenic conversion and transduction by Erwinia spp. phages.

Introduction

Erwinia amylovora, the causative agent of fire blight, is a highly challenging bacterial plant pathogen that threatens sustainable pome fruit production in North America, Central Europe, Middle East and New Zealand (Van der Zwet et al., 2012). The disease affects many species in the Rosaceae family, and in particular the economically important apple (Malus X domestica) and pear (Pyrus communis) cultivars (Vanneste, 2000; Van der Zwet et al., 2012). Bacterial colonization of the flower pistil and hypanthium leads to subsequent migration into plant tissues. The collapse of the plant parenchyma causes the typical disease symptoms of necrosis, wilting and ooze production. Depending upon the climatic conditions, fire blight outbreaks may destroy entire trees and orchards within a single season. Historically, control measures relied on the use of the highly efficacious antibiotic streptomycin (Stockwell and Duffy, 2012). The development of streptomycin resistance (McManus et al., 2002; Russo et al., 2008), and the regulatory restrictions on the use of antibiotics in agriculture have resulted in a move away from antibiotic use in certain geographic regions (Johnson and Temple, 2013). Biological control agents (BCAs) or biologicals were developed and made available for the control of fire blight in commercial orchards (Stockwell et al., 2009; Sundin et al., 2009; Kabaluk et al., 2010; Pusey and Stockwell, 2011). Biologicals are typically incorporated into integrated pest management programs and in some regions used as a supplement to the more conventional streptomycin applications. Commercially available biologicals have a common mode of action that involves pathogen suppression by providing a barrier, produce antibiotic compounds and/ or a nutrient competition with the pathogen (Stockwell et al., 2002; Pusey et al., 2009; Sundin et al., 2009).

Bacteriophages (phages) offer a novel biological control mechanism since they are ubiquitous in the orchard environment, self-replicating, nontoxic to eukaryotes, biodegradable unlike many agrochemicals and usually species and strain specific with no effect on indigenous bacteria. Phage-mediated control of fire blight has been studied in laboratory and under field conditions (Erskine, 1973; Gill et al., 2008; Lehman, 2007; Müller et al., 2011; Svircev et al., 2010; 2011; Boulé et al., 2011; Schwarczinger et al., 2011; Nagy et al., 2012). Erskine (1973) first demonstrated that a temperate phage that lysogenized a yellow saprophytic bacterium reduced fire blight symptoms when co-inoculated with E. amylovora on pear slices. This saprophytic bacterium delivered the temperate phage and was independently antagonist to E. amylovora. Subsequently, field-based trials and in planta bioassays have demonstrated that Erwinia spp. phages have the ability to control E. amylovora at levels comparable to that of streptomycin (Lehman, 2007; Svircev et al., 2010; 2011). This control was achieved by applying lytic phages along with a non-pathogenic orchard bacterial epiphyte, Pantoea agglomerans. Pantoea agglomerans plays a dual role in this system. Primarily, it provides sacrificial host cells (carriers) that propagate the lytic phage population that otherwise would succumb to desiccation or UV degradation on the blossom surface. Second, P. agglomerans is also a biological control agent that colonizes the flower pistil and prevents further colonization by E. amylovora (Lehman, 2007).

A major risk of phage therapy is associated with the inadvertent use of temperate phages, which can enter the lysogenic state by integration into the host genome and exist as a prophage. Lysogens, bacterial hosts with prophage(s), cannot be infected by homologous phage through superinfection immunity (Abedon, 2008). This phage resistance mechanism produces a population of resistant bacteria, which may negate BCA efficacy. The presence of a prophage may also increase the potential of transduction, phage-mediated transfer of genes that can improve bacterial virulence and/or fitness (Wagner and Waldor, 2002; Brüssow et al., 2004; Canchaya et al., 2004; Brüssow, 2009; Addy et al., 2012b), contribute to loss of phytopathogen virulence (Addy et al., 2012a), change host cell morphology (Weinbauer, 2004; Addy et al., 2012a,b), transfer toxin genes (Mauro and Koudelka, 2011), impact strain individuality (Canchaya et al., 2003; 2004), alter sensitivity to antibiotics (Wagner and Waldor, 2002), spread antibiotic resistance (Muniesa et al., 2013), activate restriction-methylation systems (Weinbauer, 2004) and improve bacterial survival under poor growth conditions (Williamson et al., 2002; Williamson and Paul, 2006; Paul, 2008).

Temperate phages have been found in many phytopathogens and plant-associated bacteria such as Rhizobium spp. (Malek, 1990; Uchiumi et al., 1998), Ralstonia solanacearum (Yamada et al., 2007; Murugaiyan et al., 2011; Addy et al., 2012a,b), rhizosphere pseudomonads (Shaburova et al., 2000), Xanthomonas campestris pv. azadirachtae (Borkar, 1997), Erwinia carotovora subsp. carotovora (Faltus and Kishko, 1980; Ruban et al., 1981; Toth et al., 1993; Tovkach, 2002a,b) and P. agglomerans (previously known as Erwinia herbicola) (Harrison and Gibbins, 1975). Furthermore, the genomes of all fully sequenced E. amylovora phages lack the necessary genes for prophage integration (Lehman et al., 2009; Born et al., 2011; Nagy et al., 2012).

The main purpose of this study was to screen with real-time polymerase chain reaction (PCR) for the occurrence of lysogeny in E. amylovora wild-type isolates obtained from a global collection. Screening for prophages was extended to the orchard epiphyte P. agglomerans since research showed that P. agglomerans isolates, Pantoea vegans C9-1, formerly known as Pantoea agglomerans C9-1 and P. agglomerans E325 (Svircev unpublished data) can be easily infected by Erwinia spp. phages (Lehman, 2007). In addition, classical induction methods were used to produce bacteriophage insensitive bacterial mutants (BIMs) by challenging the host with high-titre phage solutions. Collectively, this research facilitated in the understanding of lysogeny in E. amylovora and its bacteriophages. This information will help designate which lytic phages should be selected as components of phage-carrier mixture in the development of this novel biological control system.

Results

Real-time PCR screening for prophages

Multiplex real-time PCR was used to detect the presence of prophage DNA in E. amylovora (Table 1, Table S1) and P. agglomerans (Table 1, Table S2) isolates collected from various rosaceous hosts. All 161 E. amylovora isolates originating from 16 global locations were identified as E. amylovora with Ea-lsc primers/probe targeting the levansucrase gene (Table 2). Eighty-two isolates of P. agglomerans were collected from pear, apple, mountain ash, crab apple, hawthorn and cotoneaster blossom washings. Pantoea agglomerans identity was confirmed with Pa-gnd2 primers and probe targeting the gluconate-6-dehydrogenase gene (Table 2). Specificities for the Podoviridae and Myoviridae phage primer/probe combinations were confirmed by screening numerous phage isolates (Table 3) that had been previously identified with electron microscopy and restriction fragment length polymorphism (RFLP) analysis (Gill et al., 2008). All isolates of E. amylovora and P. agglomerans were shown to be negative for both phage prophages families (Table 4) regardless of the geographic location of the isolation site. In addition, seven isolates of Erwinia pyrifolia from Korea and Japan were tested similarly, and no evidence of prophages was obtained (data not shown).

Table 1.

Sources of wild-type bacteria isolates and bacteriophages

Isolate Source/Phage family Reference
E. amylovora
Ea6-4 Malus X domestica A.M. Svircev
EaD-7 Malus X domestica A.M. Svircev
Ea29-7 Malus X domestica A.M. Svircev
EaG-5 Pyrus communis (Gill et al., 2008)
Ea17-1-1 Malus X domestica (Gill et al., 2008)
Ea110R Malus X domestica (Gill et al., 2008)
155 Isolates Global Collection, AAFC Vineland Table S1
P. agglomerans
Pa1 Malus X domestica This study
Pa1-28a Malus X domestica
Pa1-28b Malus X domestica
Pa7-5 Malus X domestica
Pa17-17 Malus X domestica
Pa21-5 Pyrus communis
76 Isolates Malus and Pyrus Table S2
Erinia spp. bacteriophages
ΦEa10-1 Myoviridae (Gill et al., 2008)
ΦEa10-2 Myoviridae
ΦEa10-4 Myoviridae
ΦEa21-2 Myoviridae
ΦEa21-4 Myoviridae
ΦEa21-3 Myoviridae
ΦEa31-1 Myoviridae
ΦEa35-2 Myoviridae
ΦEa45-1B Myoviridae
ΦEa9-2 Podoviridae (Gill et al., 2008)
ΦEa9-4 Podoviridae
ΦEa10-7 Podoviridae
ΦEa10-8 Podoviridae
ΦEa10-9 Podoviridae
ΦEa10-10 Podoviridae
ΦEa10-11 Podoviridae
ΦEa10-13 Podoviridae
ΦEa10-15 Podoviridae
ΦEa31-3 Podoviridae
ΦEa35-20 Podoviridae This study
ΦEa35-6 Podoviridae
ΦEa46-1A2 Podoviridae
ΦEa51-2 Podoviridae (Gill et al., 2008)
ΦEa51-4 Podoviridae
ΦEa51-6 Podoviridae
ΦEa51-7 Podoviridae

Table 2.

Primers and TaqMan probes utilized in multiplex real-time PCR

Target/Primer namea Sequence (5′ – 3′)b Amplicon size (nt) Source
E. amylovora
Ea-Lsc-F cgctaacagcagatcgca 105 bp (Lehman, 2007)
Ea-Lsc-R aaatacgcgcacgaccat
Ea-Lsc-P CY5/ctgataatccgcaattccaggatg\IAbRQSp
P. agglomerans
Pa-Gnd2-F cgctaacccgactgtgct 73 bp This study
Pa-Gnd2-R tgaaggtttgccctttgc
Pa-Gnd2-P FAM/atgacaccatcatcgtaaaggcgg\BHQ_1
Myoviridae
PUN45-F aacgaacagcgccttgac 140 bp This study
PUN45-R ccagttgcagccagtgtg
PUN45-P ROX/actgagaagtacggtatcaaaccttc/IAbRQS
Podoviridae
STS3-F gacaaacaagaacgcggcaactga 96 bp This study
STS3-R atacccagcaaggcgtcaacctta
STS3-P FAM/agatgaagtaggttatcttcacagtgccct/BHQ_1
a

F forward primer, R reverse primer, P probe.

b

Flurorophores: Cy5, 6-FAM, HEX, ROX; Quenchers: IAbRQSp NHS Ester Iowa Black RQTM-Sp, BHQ_1 Black Hole Quencher. Integrated DNA Technologies, Coralville, IA, USA.

Table 3.

Summary of real-time PCR diagnostics using Podoviridae and Myoviridae specific probe and primers

Bacteriophage Family Probe/Primer
STS3 PUN45
Podoviridae 16/17a 0/17
Myoviridae 0/9 9/9
a

Number of phages detected/total number of phages. Phage family was determined by RFLP and TEM (Gill et al., 2008) and probe/primer detection (this paper). Only Erwinia spp. phage Φ9-2 was not detected by Podoviridae-specific probe/primer.

Table 4.

Summary of screening results for the presence of lysogeny in wild-type global populations of E. amylovora and P. agglomerans using real-time PCR

Isolatea Location Isolates tested Lysogenyb
Myoviridae Podoviridae
E. amylovora ON, Canada 5
BC, Canada 10
NS, Canada 10
CA, USA 14
MI, USA 16
NY, USA 11
OR, USA 12
France 10
Germany 10
Israel 10
Lebanon 12
Morocco 10
New Zealand 6
Poland 12
Spain 9
Switzerland 4
P. agglomerans ON, Canada 82
a

Tables S1 and S2 provide a detailed list of wild-type isolates and their sources.

b

Presence of prophage tested using real-time PCR, utilizing STS3 (Podoviridae) and Pun45 (Myoviridae) probe/primer sets − indicates a negative result.

Screening for prophages: spontaneous release and mitomycin C induction

Evidence of lysogeny was not obtained from screening cultures for the spontaneous release of phage progeny nor the induction of prophage release through recombination. Supernatants of liquid cultures of P. agglomerans failed to produce any plaques when added to E. amylovora indicator isolates Ea6-4, Ea17-1-1, EaG-5, Ea110R and Ea29-7 (Table S2). Mitomycin C at 0.5 or 1 μg/ml also failed to induce any phages in a subgroup of 22 P. agglomerans, and no plaques were observed on the same indicator isolates (data not shown).

Recovery of bacteriophage insensitive mutants

After numerous trials using the phage challenge methods and various combinations of phages and hosts (data not shown), the secondary culture method was more efficient at isolating BIMs than the agar overlay method. Several BIMs originating from sensitive parental isolates were recovered from E. amylovora Ea29-7, Ea17-1-1, G-5 and Ea110R. All BIMs were confirmed by real-time PCR as E. amylovora. However, Podoviridae and Myoviridae DNAs were not detected in BIMs derived from Ea29-7, Ea17-1-1 and G-5. These BIMs were deemed to lack a prophage and were not tested further.

Initially, 42 BIMs were recovered from Ea110R after challenge with ΦEa35-20 (Podoviridae). After four rounds of sub-culturing, 24 survivors maintained their phage resistance. To determine the stability of lysogeny, BIMs were cultured from frozen stocks following 2, 6, 12 and 24 months of storage and monitored by real-time PCR for the conservation of Podoviridae phage DNA. Of the 24 BIMs, 12 were unstable and showed a loss or decrease in prophage signal over the course of the trials. Twelve BIMs remained stable and produced similar CT values in most trials. These lysogens maintained an expected approximate CT ratio of 1:1 between Podoviridae and E. amylovora sequences (Table 5). After 24 months in storage at −80°C, 22 of the BIMs were tested for stability. Eleven BIMs were previously identified as unstable and 11 as stable. Ten colonies recovered from each BIM were analysed separately for the presence of phage DNA. Only three of the formerly stable BIMs remained stable with 8 to 10 of the colonies showing a 1:1 phage to bacterial DNA ratio (Table 5).

Table 5.

Dualplex real-time PCR of isolated E. amylovora Ea110R bacteriophage insensitive mutants (BIMs)

BIM Sample 1b Sample 2c Sample 3d Sample 4e
Ea aCT Phage CT Ea CT Phage CT Ea CT Phage CT 1:1 ratio
1 18.3 32.8 17.2 >40 20.5 >40 0/10
6 15.9 32.8 20.9 37.8 19.6 >40 0/10
7 17.0 36.0 19.5 >40 17.4 >40 ND
8 17.2 18.7 17.1 >40 17.4 19.2 10/10
10 15.4 19.6 16.4 11.6 18.5 13.9 4/10
16 16.0 35.3 18.2 39.2 17.1 >40 1/10
18 16.5 16.6 17.9 12.4 16.9 13.1 10/10
19 17.6 18.1 19.6 17.3 19.0 16.8 ND
21 15.8 22.2 17.0 >40 18.1 >40 0/10
22 15.3 33.3 19.0 >40 17.3 37.7 0/10
23 17.2 30.3 17.2 >40 17.5 >40 7/10
24 16.2 17.0 20.5 25.9 18.5 24.8 0/10
25 16.3 19.7 16.4 39.8 19.3 >40 1/10
26 15.5 15.3 16.3 14.9 19.6 21.8 3/10
27 16.9 14.6 15.9 13.1 16.6 16.6 0/10
29 16.2 31.5 18.6 >40 16.7 >40 0/10
34 15.5 26.1 18.9 14.8 20.2 16.5 9/10
35 16.5 30.6 19.8 13.7 19.2 13.6 6/10
37 17.0 32.6 18.1 >40 20.8 37.2 0/10
38 17.2 29.6 19.6 37.0 18.5 >40 1/10
39 16.7 16.3 17.5 9.4 18.2 15.3 6/10
40 16.1 16.8 18.6 13.0 16.8 13.2 0/10
41 16.8 20.9 17.3 16.7 20.2 21.5 0/10
42 17.1 29.4 17.6 37.6 16.8 >40 0/10
a

Threshold cycle (CT) values were derived from purified Ea110R BIM colonies by amplifying E. amylovora DNA with Lsc primer/probes (Ea CT) and Podoviridae phage DNA with STS3 primers/probe (Phage CT): Single colonies were recovered from frozen stocks at three times:

b

Sample 1, at 2 months post-storage at −80°C;

c

Sample 2, at 6 months post-cold storage;

d

Sample 3, at 12 months post-cold storage.

e

Sample 4, at 24 months of storage where 10 colonies from each BIM stock were analysed, and the number of colonies that showed similar CT values for E. amylovora and phage DNA were reported.

Recovery of a temperate phage

Treatment of BIM 8 (Table 5) with ultraviolet light resulted in the recovery of a viable phage, presumably a clone of ΦEa35-20, belonging to the Podoviridae. Restriction fragment length polymorphism analysis with BamH1, EcoR1 and BglII showed similar fragment patterning to known Erwinia spp. Podoviridae phages (Roach, 2011) and the genome size was estimated to be at 46 000 bp (data not shown). To assess any altered host range due to lysogeny, BIM 8 was challenged with Podoviridae phages ΦEa31-3 and ΦEa46-1A2 and Myoviridae phage ΦEa45-1B. This BIM was resistant to lysis by ΦEa31-3 and ΦEa46-1A2 but remained susceptible to ΦEa45-1B.

Discussion

Phages represent the most abundant biological form in the biosphere with an estimated total number of 1031 particles, outnumbering host bacteria 10-fold (Brüssow et al., 2004). Not surprisingly, temperate phages are ecologically important, shaping bacterial communities by controlling their composition, numbers and activities. Comparative genomics have revealed the pervasiveness of prophages in most bacterial genomes and constitute one of the main sources of genetic diversity and strain variation. They are associated with promoting host immunity, virulence and contribution to the evolution of several important bacterial pathogens (Bondy-Denomy and Davidson, 2014). We anticipated that they would play similar roles in E. amylovora and P. agglomerans populations. However, screening of 161 E. amylovora isolates from 16 distinct geographic areas worldwide failed to show evidence of any isolate possessing Myoviridae or Podoviridae prophages. Similarly, a pan-genome study of 12 strains of E. amylovora identified trace phage remnants but no intact prophages (Mann et al., 2013). Nonetheless, phage ΦEa35-20 was clearly identified as a temperate phage of E. amylovora 110R in the present work. The Ea110R lysogen carrying prophage ΦEa35-20 was immune to two Podoviridae phages but remained susceptible to a Myoviridae phage. The lysogen therefore demonstrated homo-infection immunity to similar phages.

Prophages were also not observed in a genomic screening of 82 P. agglomerans isolates from rosaceous hosts in southern Ontario, Canada even though lysogeny has been previously reported in this species (Erskine, 1973; Harrison and Gibbins, 1975). Further testing of a subgroup of E. amylovora and P. agglomerans did not show any signs of release of phage particles spontaneously or after lytic cycle induction attempts with mitomycin C. These results indicate that lysogeny in E amylovora and P. agglomerans, although possible, is extremely rare and/or absent.

The lack of lysogeny in E. amylovora and P. agglomerans reported here contests the overall consensus that lysogeny is a prevalent life choice by most Gram negative bacteria (Ackermann and Dubow, 1987; Jiang and Paul, 1998; Williamson et al., 2002; 2007; 2008a,b; Brüssow et al., 2004; Canchaya et al., 2004; Ghosh et al., 2008; Swanson et al., 2012). Canchaya and colleagues (2004) acknowledge that prophages may be absent from a genome since prophages can be easily acquired and lost from the bacterial cell. While little is known about the factors leading to the establishment of different lifestyles, the choice is believed to be determined to a great extent by the metabolic health of the host bacteria. The lysogenic cycle may be undertaken when host abundance is low and conditions for replication are unfavourable (Marsh and Wellington, 1994; Weinbauer, 2004). Extreme and low nutrient environments have been shown to favour phages that readily undertake a lysogenic life cycle (Jiang and Paul, 1998; Williamson et al., 2002; Williamson, 2008a,b). Blossom stigmatic surfaces provide a nutrient-rich environment for the pathogen and epiphyte (Johnson and Stockwell, 1998; Pusey, 2000; Pusey and Smith, 2008; Stockwell et al., 2008; Pusey et al., 2009). This habitat does not include harsh environmental conditions or low host abundance necessary to promote lysogeny. The bacteria that were studied here were likely in a state of vigorous growth due to ideal nutrient and environmental conditions provided by the plant. Because of this, it is plausible that lytic lifestyles were favoured leading to an absence of lysogeny. This argument applies equally to E. amylovora and P. agglomerans. Erwinia spp. phages are known to be able to cross the species barrier and infect the orchard epiphyte P. agglomerans (Erskine, 1973; Lehman, 2007; Svircev et al., 2010; 2011). Independently, Erskine (1973) and Harrison and Gibbins (1975) reported that phages that could infect E. amylovora were capable of a lysogeny in P. agglomerans. In the present study, no evidence of lysogeny was apparent in P. agglomerans, which suggested that this bacterium does not provide a reservoir for Erwinia spp. phages during unfavourable growth conditions. To achieve a broader understanding into the incidence of lysogeny in E. amylovora and P. agglomerans, sampling of more variable environments will give a deeper understanding of phage–host relationship in natural conditions (Brüssow, 2012) and may reveal higher frequencies of lysogeny (Williamson et al., 2007; 2008a,b) as well as greater genotypic and phenotypic diversity in orchard pathogen and epiphyte communities.

The advent of real-time PCR has allowed for an efficient and accurate detection of prophages in many Gram-negative and Gram-positive bacteria (Lunde et al., 2000; 2003; Sobéron et al., 2007; del Rio et al., 2008; Pecson et al., 2009; Rodriguez et al., 2009). Multiplex real-time PCR was used in this study to simultaneously analyse E. amylovora or P. agglomerans isolates for the presence of Myoviridae and Podoviridae prophage within a single sample. The extreme sensitivity of real-time PCR enabled us to track the loss of prophage DNA from E. amylovora BIMs that were originally identified as lysogens. During lysogeny, a prophage is integrated into the host genome resulting in an approximate CT ratio of 1:1 of phage : host values. Most of the BIMs had phage : host ratios that changed over time even though a 1:1 ratio was initially apparent. Phage DNAs were not stable, and presumptive lysogens experienced the eventual loss or significant reduction of prophage copy number. This variation in stability could be the result of prophage eviction without loss of bacterial cell viability by mechanisms that are very unclear (Weinbauer, 2004; Khemayan et al., 2006; Abedon, 2008).

A more plausible explanation is the unstable coexistence of a phage genome in the host bacterium, where that genome fails to replicate either as a productive infection or with cell division as seen with pseudolysogenic lifestyles (Williamson et al., 2001; Khemayan et al., 2006; Łoś and Węgrzyn, 2012). Pseudolysogeny is often characterized by high host cell and phage copy numbers in a bacterial culture but the lytic cycle cannot be induced by mitomycin C (Williamson et al., 2001; Pasharawipas et al., 2008). Properties such as superinfection immunity are nonetheless exhibited by the host (Ripp and Miller, 1998). Khemayan et al. (2006) reported a similar event where Vibrio harveyi presumptive lysogen cell stability varied widely, and numerous cultures constantly generated large numbers of cured cells that had lost their lysogenic status. The presence of unstable lysogens and/or pseudolysogens has been observed in other bacterial species such as Listonella pelagia (Williamson et al., 2001). Further work on the BIMs of E. amylovora is required for the elucidation of the mechanism of the lack of stability.

To the best of our knowledge, this is the first study that examines the incidence of lysogeny in an orchard phytopathogen and epiphytic bacterium. This study was facilitated by the use of a simple and rapid molecular-based multiplex real-time PCR assay which detected prophages in their quiescent state, circumventing the laborious and inaccurate induction-dependent techniques. Lysogeny was demonstrated for E. amylovora under laboratory conditions and for P. agglomerans in an orchard isolate (Erskine, 1973). Lysogeny appears to be rare or absent when bacteria reside in the phyllosphere and are isolated from nutrient-rich environments such as flower washings. These observations indicate that the risks associated with transduction and lysogenic conversion from the use of phages and the carrier host to control fire blight during bloom may be low. Greater reduction of risk would be achieved by the use of a mixture or cocktail of several different lytic phages in the biological control agent. This mixture should minimize the risk of development of bacterial resistance and broaden the range of hosts controlled by the agent, as has been shown for phage cocktails against diarrhoea-associated E. coli. (Bourdin et al., 2014). Further optimization of the phage-based biological would involve selection of phages for the cocktails based on host range studies and the selection of a carrier isolate of P. agglomerans that allows the production of high-phage titres and secondary antimicrobial metabolites.

Experimental procedures

Bacteria and bacteriophages

Bacteria and bacteriophages are listed in Table 1. Modified Miller-Schroth Medium [MMS; 0.8% nutrient broth (NB, Difco Laboratories, Sparks, MD), 2.5% sucrose, 2% Bacto agar (Difco), 0.0045% bromothymol blue, 0.00125% neutral red, pH 7.4] was used initially to recover E. amylovora and P. agglomerans isolates from apple and pear orchards (Brulez and Zeller, 1981). Bacterial stocks were stored at −80°C in 0.8% NB, 0.25% yeast extract (Difco), 0.5% sucrose, 0.25% K2HPO4, 0.05% KH2PO4, 0.025% MgSO4 and 50% (v/v) glycerol. Bacteria were cultured from frozen stocks on 2.3% nutrient agar (NA; Difco) or 0.8% NB, 0.25% yeast extract (YE) and 0.5% sucrose and incubated at 27°C for 18–48 h prior to use. Phages were enriched by inoculating 25 ml of 0.8% NB with 100 μl of bacterial host at 0.6 at OD600 (∼ 108cfu/ml) and 1 ml phage stock solution at 108 pfu/ml, at 27°C for 20 h on an orbital shaker (100 rpm). To lyse the bacterial cells, overnight cultures were treated with 5% chloroform (v/v) for 30 min, and centrifuged at 12 000 × g for 15 min to remove cell debris. The phage lysates were filtered through a 0.2 μm bottle top filter (Millipore). Phage stocks were stored at 4°C in either 0.8% NB or 0.01 M phosphate buffer (PB, pH 6.8). The soft agar overlay method described by Adams (1959) was used to determine the concentration in pfu/ml of each phage stock solution.

Multiplex real-time PCR

Erwinia spp. phages in the Vineland AAFC Collection were identified as Myoviridae (long contractile tail), Siphoviridae (long non-contractile tail) or Podoviridae (short tail) by restriction fragment length polymorphisms and electron microscopy (Gill et al., 2008). Specific real-time PCR primers and probes for E. amylovora, P. agglomerans (Lehman, 2007) and ones that target Myoviridae and Podoviridae specific genes were designed for multiplex PCR (Table 2). Design of real-time PCR primers and probes targeting Siphoviridae was not possible due to loss of these phage isolates from the collection as a result of long-term storage. Multiplex real-time PCR reactions comprised of 25 μl in either 10X ThermoPol buffer (NEB, Ipswich, MA), 0.2 mM of each primer, 0.1 mM of probe, 0.2 mM each of deoxyribonucleotide triphosphate (dNTP), 2 mM MgCl2, 1.3 U Taq polymerase (NEB) or 2X Master Mix (Qiagen) and 2 μl of sample template suspended in PB. The reaction was assayed on a Stratagene Mx4000 Quantitative PCR thermocycler (La Jolla, CA) (95°C, 5 min and 45 cycles of 95°C, 10 s, 60°C, 16 s) or a Corbett Rotor-Gene 6000 thermocycler (95°C, 5 min then 40 cycles of 95°C for 4 s and 60°C for 11 s). The threshold cycle (CT) was determined by machine software. Positive controls, samples with added phage, and no template controls were included with each test.

Spontaneous liberation and induction of prophages from P. agglomerans

Two methods were used to test for the recovery of phage from bacteria, spontaneous liberation and induction. To assess the spontaneous release of phage particles, cells from an overnight culture in NB were collected by centrifugation at 12 000 × g for 4 min. For prophage induction, 5 μl aliquots from overnight cultures were diluted into 45 ml of NB and incubated until the population reached mid-log phase (OD600 0.4). Cells were then treated with mitomycin C (MC; 0, 0.5 or 1 μg/ml) (Jiang and Paul, 1998) and incubated for an additional 18 h at 27°C before centrifugation at 12 000 × g for 4 min. Both spontaneous and induction treatments were assessed for phage particles by mixing the supernatant with exponentially growing sensitive bacterial cells, adding 3 ml of 0.8% NA and plating on 2.3% NA. After incubation for 24 h at 27°C, plates were examined for bacterial cell lysis.

Isolation of bacteriophage insensitive mutants of E. amylovora

The agar plate method and the secondary culture method (Guglielmotti et al., 2006) were used to isolate BIMs. Bacterial cultures grown overnight in NB were inoculated with phages at MOI of 10, 1 or 0.1. Infected cells were mixed with soft agar, poured over 2.3% NA and incubated at 27°C for 24–48 h. Presumptive BIMs, appearing as single bacterial colonies, were isolated, cultured and tested for phage sensitivity. The secondary method was performed in a similar manner except after 24 h; streaks were taken from plates exhibiting no colony growth and were swabbed on fresh 2.3% NA medium for an additional 24 h at 27°C. Each BIM was subcultured four times on 2.3% NA in the absence of phages to confirm the stability of phage resistance. BIMs were stored at −80°C. In order to assess long-term stability, the frozen stock of each BIM was periodically sampled by streaking on NA plus 0.5% sucrose from and plates were incubated overnight at 27°C. For a final sample, 10 colonies per BIM stock were suspended individually in 100 μl of PB and tested with multiplex real-time PCR.

Conflict of interest

None declared.

Supporting Information

Additional Supporting information may be found in the online version of this article at the publisher's web-site:

Table S1. Real-time PCR was used to confirm the identity of global wild-type isolates as Erwinia amylovora. Specific Erwinia spp. Myoviridae and Podoviridae probe-primers were used to screen the global population for the presence of prophages.

Table S2. Isolate confirmation and lysogeny screening of wild-type Pantoea agglomerans isolated from field collected blossoms from southern Ontario, CA.

mbt20008-0510-sd1.doc (506.5KB, doc)

References

  1. Abedon ST. Phages, ecology, evolution. In: Abedon ST, editor. Bacteriophage ecology. Cambridge, UK: Cambridge University Press; 2008. pp. 1–28. [Google Scholar]
  2. Ackermann H-W. Dubow MS. General Properties of Tailed Phages. Boca Raton, FL, USA: CRC Press; 1987. Viruses of prokaryotes; pp. 1–113. [Google Scholar]
  3. Adams MH, editor. Bacteriophages. New York, NY, USA: Interscience Publishers; 1959. [Google Scholar]
  4. Addy HS, Askora A, Kawasaki T, Fujie M. Yamada T. Loss of virulence of the phytopathogen Ralstonia solanacearum through infection by ΦRSM filamentous phages. Phytopathology. 2012a;102:469–477. doi: 10.1094/PHYTO-11-11-0319-R. [DOI] [PubMed] [Google Scholar]
  5. Addy HS, Askora A, Kawasaki T, Fujie M. Yamada T. The filamentous phage ΦRSS1 enhances virulence of phytopathogenic Ralstonia solanacearum on tomato. Phytopathology. 2012b;102:244–251. doi: 10.1094/PHYTO-10-11-0277. [DOI] [PubMed] [Google Scholar]
  6. Bondy-Denomy J. Davidson AR. When a virus is not a parasite: the beneficial effects of prophages on bacterial fitness. J Microbiol. 2014;52:235–242. doi: 10.1007/s12275-014-4083-3. [DOI] [PubMed] [Google Scholar]
  7. Borkar SG. Lysogeny in Xanthomonas campestris pv. erythrinae and X. campestris pv. azadirachtae and the behaviour of harboured temperate phages. J Mycol Plant Pathol. 1997;27:283–285. [Google Scholar]
  8. Born Y, Fieseler L, Marazzi J, Lurz R, Duffy B. Loessner MJ. Novel virulent and broad-host-range Erwinia amylovora bacteriophages reveal a high degree of mosaicism and a relationship to Enterobacteriaceae Phages. Appl Environ Microbiol. 2011;77:5945–5954. doi: 10.1128/AEM.03022-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Boulé J, Sholberg PL, Lehman SM, O'Gorman DT. Svircev AM. Isolation and characterization of eight bacteriophages infecting Erwinia amylovora and their potential as biological control agents in British Columbia, Canada. Can J Plant Pathol. 2011;33:308–317. [Google Scholar]
  10. Bourdin G, Navarro A, Sarker SA, Pittet AC, Qadri F, Sultana S, et al. Coverage of diarrhoea-associated Escherichia coli isolates from different origins with two types of phage cocktails. Microb Biotechnol. 2014;7:165–176. doi: 10.1111/1751-7915.12113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Brulez W. Zeller W. Seasonal changes in epiphytic Erwinia amylovora on ornamentals in relation to weather conditions and the course of infection. Acta Hortic. 1981;117:37–43. [Google Scholar]
  12. Brüssow H. The not so universal tree of life or the place of viruses in the living world. Philos Trans R Soc Lond B Biol Sci. 2009;364:2263–2274. doi: 10.1098/rstb.2009.0036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Brüssow H. What is needed for phage therapy to become a reality in Western medicine? Virology. 2012;434:138–142. doi: 10.1016/j.virol.2012.09.015. [DOI] [PubMed] [Google Scholar]
  14. Brüssow H, Canchaya C. Hardt WD. Phages and the evolution of bacterial pathogens: from genomic rearrangements to lysogenic conversion. Microbiol Mol Biol Rev. 2004;68:560–602. doi: 10.1128/MMBR.68.3.560-602.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Canchaya C, Proux C, Fournous G, Bruttin A. Brüssow H. Prophage genomics. Microbiol Mol Biol Rev. 2003;67:238–276. doi: 10.1128/MMBR.67.2.238-276.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Canchaya C, Fournous G. Brüssow H. The impact of prophages on bacterial chromosomes. Mol Microbiol. 2004;53:9–18. doi: 10.1111/j.1365-2958.2004.04113.x. [DOI] [PubMed] [Google Scholar]
  17. Erskine JM. Characteristics of Erwinia amylovora bacteriophage and its possible role in the epidemiology of fire blight. Can J Microbiol. 1973;19:837–845. doi: 10.1139/m73-134. [DOI] [PubMed] [Google Scholar]
  18. Faltus II. Kishko YG. Studies on DNA transfection properties of Erwinia carotovora virulent and temperate phages. Mikrobiol Zh. 1980;42:339–344. [PubMed] [Google Scholar]
  19. Ghosh D, Roy K, Williamson KE, White DC, Wommack KE, Sublette KL. Radosevich M. Prevalence of lysogeny among soil bacteria and presence of 16S rRNA and trzN genes in viral-community DNA. Appl Environ Microbiol. 2008;74:495–502. doi: 10.1128/AEM.01435-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gill JJ, Svircev AM, Smith R. Castle AJ. Bacteriophages of Erwinia amylovora. Appl Environ Microbiol. 2003;69:2133–2138. doi: 10.1128/AEM.69.4.2133-2138.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Guglielmotti DM, Reinheimer JA, Binetti A, Giraffa G, Carminati D. Quiberoni A. Characterization of spontaneous phage-resistant derivatives of Lactobacillus delbrueckii commercial strains. Int J Food Microbiol. 2006;111:126–133. doi: 10.1016/j.ijfoodmicro.2006.04.035. [DOI] [PubMed] [Google Scholar]
  22. Harrison A. Gibbins LN. The isolation and characterization of a temperate phage, Y46/(E2), from Erwinia herbicola Y46. Can J Microbiol. 1975;21:937–944. doi: 10.1139/m75-138. [DOI] [PubMed] [Google Scholar]
  23. Jiang SC. Paul JH. Significance of lysogeny in the marine environment: studies with isolates and a model of lysogenic phage production. Microb Ecol. 1998;35:235–243. doi: 10.1007/s002489900079. [DOI] [PubMed] [Google Scholar]
  24. Johnson KB. Stockwell VO. Management of fire blight: a case study in microbial ecology. Annu Rev Phytopathol. 1998;36:227–248. doi: 10.1146/annurev.phyto.36.1.227. [DOI] [PubMed] [Google Scholar]
  25. Johnson KB. Temple TN. Evaluation of strategies for fire blight control in organic pome fruit without antibiotics. Plant Dis. 2013;97:402–409. doi: 10.1094/PDIS-07-12-0638-RE. [DOI] [PubMed] [Google Scholar]
  26. Kabaluk JT, Svircev AM, Goettel MS. Woo SG. 2010. , and The use and regulation of microbial pesticides in representative jurisdictions worldwide [WWW document]. URL http://www.IOBC-Global.org.
  27. Khemayan K, Pasharawipas T, Puiprom O, Sriurairatana S, Suthienkul O. Flegel TW. Unstable lysogeny and pseudolysogeny in Vibrio harveyi siphovirus-like phage 1. Appl Environ Microbiol. 2006;72:1355–1363. doi: 10.1128/AEM.72.2.1355-1363.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lehman SM. Department of Biological Sciences. St. Catharines, ON, Canada: Brock University; 2007. Development of a bacteriophage-based biopesticide for fire blight. . PhD Thesis. [Google Scholar]
  29. Lehman SM, Kropinski AM, Castle AJ. Svircev AM. Complete genome of the broad-host-range Erwinia amylovora phage φEa21-4 and its relationship to Salmonella phage Felix O1. Appl Environ Microbiol. 2009;75:2139–2147. doi: 10.1128/AEM.02352-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lunde M, Blatny JM, Kaper F, Nes IF. Lillehaug D. The life cycles of the temperate lactococcal bacteriophage ΦLC3 monitored by a quantitative PCR method. FEMS Microbiol Lett. 2000;192:119–124. doi: 10.1111/j.1574-6968.2000.tb09369.x. [DOI] [PubMed] [Google Scholar]
  31. Lunde M, Blatny JM, Lillehaug D, Aastveit AH. Nes IF. Use of real-time quantitative PCR for analysis of ΦLC3 prophage stability in lactococci. Appl Environ Microbiol. 2003;69:41–48. doi: 10.1128/AEM.69.1.41-48.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Łoś M. Węgrzyn G. Pseudolysogeny. Adv Virus Res. 2012;82:339–349. doi: 10.1016/B978-0-12-394621-8.00019-4. [DOI] [PubMed] [Google Scholar]
  33. McManus PS, Stockwell VO, Sundin GW. Jones AL. Antibiotic use in plant agriculture. Annu Rev Phytopathol. 2002;40:443–465. doi: 10.1146/annurev.phyto.40.120301.093927. [DOI] [PubMed] [Google Scholar]
  34. Malek W. Properties of the transducing phage M1 of Rhizobium meliloti. J Basic Microbiol. 1990;30:43–50. [Google Scholar]
  35. Mann RA, Smits THM, Buhlmann A, Blom J, Goesmann A, Frey JE, et al. Comparative genomics of 12 strains of Erwinia amylovora identifies a pan-genome with a large conserved core. PLoS ONE. 2013;8:1–11. doi: 10.1371/journal.pone.0055644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Marsh P. Wellington EMH. Phage-host interactions in soil. FEMS Microbiol Ecol. 1994;15:99–107. [Google Scholar]
  37. Mauro S. Koudelka GB. Shiga toxin: expression, distribution, and its role in the environment. Toxins (Basel) 2011;3:608–625. doi: 10.3390/toxins3060608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Müller I, Lurz R, Kube M, Quedenau C, Jelkmann W. Geider K. Molecular and physiological properties of bacteriophages from North America and Germany affecting the fire blight pathogen Erwinia amylovora. Microb Biotechnol. 2011;4:735–745. doi: 10.1111/j.1751-7915.2011.00272.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Muniesa M, Colomer-Lluch M. Jofre J. Potential impact of environmental bacteriophages in spreading antibiotic resistance genes. Future Microbiol. 2013;8:739–751. doi: 10.2217/fmb.13.32. [DOI] [PubMed] [Google Scholar]
  40. Murugaiyan S, Bae JY, Wu J, Lee SD, Um HY, Choi HK, et al. Characterization of filamentous bacteriophage PE226 infecting Ralstonia solanacearum strains. J Appl Microbiol. 2011;110:296–303. doi: 10.1111/j.1365-2672.2010.04882.x. [DOI] [PubMed] [Google Scholar]
  41. Nagy JK, Király L. Schwarczinger I. Phage therapy for plant disease control with a focus on fire blight. Cent Eur J Biol. 2012;7:1–12. [Google Scholar]
  42. Pasharawipas T, Wetchakit N. Sriurairatana S. The cycle for a Siphoviridae-like phage (VHS1) of Vibrio harveyi is dependent on the physiological state of the host. Virus Res. 2008;135:332–335. doi: 10.1016/j.virusres.2008.03.011. [DOI] [PubMed] [Google Scholar]
  43. Paul JH. Prophages in marine bacteria: dangerous molecular time bombs or the key to survival in the seas? ISME J. 2008;2:579–589. doi: 10.1038/ismej.2008.35. [DOI] [PubMed] [Google Scholar]
  44. Pecson BM, Martin LV. Kohn T. Quantitative PCR for determining the infectivity of bacteriophage MS2 upon inactivation by heat, UV-B radiation, and singlet oxygen: advantages and limitations of an enzymatic treatment to reduce false-positive results. Appl Environ Microbiol. 2009;75:5544–5554. doi: 10.1128/AEM.00425-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Pusey PL. The role of water in epiphytic colonization and infection of pomaceous flowers by Erwinia amylovora. Phytopathology. 2000;90:1352–1357. doi: 10.1094/PHYTO.2000.90.12.1352. [DOI] [PubMed] [Google Scholar]
  46. Pusey PL. Smith TJ. Susceptibility of apple hypanthium to Erwinia amylovora in relation to flower age and cougarblight model. Acta Hortic. 2008;793:45–51. [Google Scholar]
  47. Pusey PL. Stockwell VO. Evidence that antibiotic of Pantoea agglomerans E325 is produced and active against Erwinia amylovora on stigmas of pomaceous blossoms. Acta Hortic. 2011;896:463–465. [Google Scholar]
  48. Pusey PL, Stockwell VO. Mazzola M. Epiphytic bacteria and yeasts on apple blossoms and their potential as antagonists of Erwinia amylovora. Phytopathology. 2009;99:571–581. doi: 10.1094/PHYTO-99-5-0571. [DOI] [PubMed] [Google Scholar]
  49. del Rio B, Martin MC, Martinez N, Magadan AH. Alvarez MA. Multiplex fast real-time PCR for quantitative detection and identification of cos- and pac-type Streptococcus thermophilus bacteriophages. Appl Environ Microbiol. 2008;74:4779–4781. doi: 10.1128/AEM.00295-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Ripp S. Miller RV. Dynamics of the pseudolysogenic response in slowly growing cells of Pseudomonas aeruginosa. Microbiology. 1998;144:2225–2232. doi: 10.1099/00221287-144-8-2225. [DOI] [PubMed] [Google Scholar]
  51. Roach DW. Department of Biological Sciences. St. Catharines, ON, Canada: Brock University; 2011. Erwinia amylovora bacteriophage resistance. . PhD Thesis. [Google Scholar]
  52. Rodriguez RA, Pepper IL. Gerba CP. Application of PCR-based methods to assess the infectivity of enteric viruses in environmental samples. Appl Environ Microbiol. 2009;75:297–307. doi: 10.1128/AEM.01150-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Ruban VI, Tovkach FI, Seredyuk RM. Kishko YG. Properties of temperate phage 59 of Erwinia carotovora, its DNA and proteins. Mikrobiol Zh. 1981;43:88–92. [Google Scholar]
  54. Russo NL, Burr TJ, Breth DI. Aldwinckle HS. Isolation of streptomycin-resistant isolates of Erwinia amylovora in New York. Plant Dis. 2008;92:714–718. doi: 10.1094/PDIS-92-5-0714. [DOI] [PubMed] [Google Scholar]
  55. Schwarczinger I, Kiss E, Sule S, Toth M. Hevesi M. Control of fire blight by bacteriophages on apple flowers. Acta Hortic. 2011;896:457–462. [Google Scholar]
  56. Shaburova OV, Burkaltseva MV, Pleteneva EA. Krylov VN. Temperate bacteriophages for rhizospheric pseudomonades Pseudomonas putida: isolation and comparative study. Genetika. 2000;36:753–756. [PubMed] [Google Scholar]
  57. Sobéron N, Martin R. Suarez JE. New method for evaluation of genotoxicity, based on the use of real-time PCR and lysogenic Gram-positive and Gram-negative bacteria. Appl Environ Microbiol. 2007;73:2815–2819. doi: 10.1128/AEM.00407-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Stockwell VO. Duffy B. Use of antibiotics in plant agriculture. Rev Sci Tech. 2012;31:199–210. doi: 10.20506/rst.31.1.2104. [DOI] [PubMed] [Google Scholar]
  59. Stockwell VO, Johnson KB, Sugar D. Loper JE. Antibiosis contributes to biological control of fire blight by Pantoea agglomerans strain Eh252 in orchards. Phytopathology. 2002;92:1202–1209. doi: 10.1094/PHYTO.2002.92.11.1202. [DOI] [PubMed] [Google Scholar]
  60. Stockwell VO, Temple TN, Johnson KB. Loper JE. Integrated control of fire blight with antagonists and oxytetracycline. Acta Hortic. 2008;793:383–390. [Google Scholar]
  61. Stockwell VO, Anderson LM, Loper JE. Johnson KB. Development of a genetically-modified mixture of biological control agents for improved disease control. IOBC/WPRS Bull. 2009;43:71–74. [Google Scholar]
  62. Sundin GW, Werner NA, Yoder KS. Aldwinckle HS. Field evaluation of biological control of fire blight in the Eastern United States. Plant Disease. 2009;93:386–394. doi: 10.1094/PDIS-93-4-0386. [DOI] [PubMed] [Google Scholar]
  63. Svircev AM, Castle AJ. Lehman SM. Bacteriophages for control of phytopathogens in food production systems. In: Griffiths MW, editor; Sabour PM, editor. Bacteriophages in the Control of Food- and Waterborne Pathogens. Washington, DC, USA: ASM Press; 2010. pp. 79–102. [Google Scholar]
  64. Svircev AM, Lehman SM, Roach D. Castle AJ. Phage biopesticides and soil bacteria: multilayered and complex interactions. In: Witzany G, editor; Biocommunications in Soil Microorganisms. Berlin, Germany: Springer-Verlag; 2011. pp. 215–235. [Google Scholar]
  65. Swanson MM, Reavy B, Makarova KS, Cock PJ, Hopkins DW, Torrance L, et al. Novel bacteriophages containing a genome of another bacteriophage within their genomes. PLoS ONE. 2012;7:11–12. doi: 10.1371/journal.pone.0040683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Toth I, Perombelton M. Salmond G. Bacteriophage φKP mediated generalised transduction in Erwinia carotovora subspecies carotovora. J Gen Microbiol. 1993;139:2705–2709. [Google Scholar]
  67. Tovkach FI. Defective lysogeny in Erwinia carotovora. Microbiology. 2002a;71:306–313. [PubMed] [Google Scholar]
  68. Tovkach FI. Temperate bacteriophage ZF40 of Erwinia carotovora: phage particle structure and DNA restriction analysis. Microbiology. 2002b;71:65–71. [PubMed] [Google Scholar]
  69. Uchiumi T, Abe M. Higashi S. Integration of the temperate phage phi U into the putative tRNA gene on the chromosome of its host Rhizobium leguminosarum biovar trifolii. J Gen Appl Microbiol. 1998;44:93–99. doi: 10.2323/jgam.44.93. [DOI] [PubMed] [Google Scholar]
  70. Van der Zwet T, Orolaza-Halbrendt N. Zeller W. Spread and current distribution of fire blight. In: Zeller W, editor; Van der Zwet T, Orolaza-Halbrendt N, editors. Fire Blight: History, Biology, and Management. St. Paul, MN, USA: APS Press; 2012. pp. 15–36. [Google Scholar]
  71. Vanneste JL. Fire Blight: The Disease and Its Causative Agent, Erwinia amylovora. Wallingford, UK: CAB Pub; 2000. [Google Scholar]
  72. Wagner PL. Waldor MK. Bacteriophage control of bacterial virulence. Infect Immun. 2002;70:3985–3993. doi: 10.1128/IAI.70.8.3985-3993.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Weinbauer MG. Ecology of prokaryotic viruses. FEMS Microbiol Rev. 2004;28:127–181. doi: 10.1016/j.femsre.2003.08.001. [DOI] [PubMed] [Google Scholar]
  74. Williamson KE, Radosevich M, Smith DW. Wommack KE. Incidence of lysogeny within temperate and extreme soil environments. Environ Microbiol. 2007;9:2563–2574. doi: 10.1111/j.1462-2920.2007.01374.x. [DOI] [PubMed] [Google Scholar]
  75. Williamson KE, Schnitker JB, Radosevich M, Smith DW. Wommack KE. Cultivation-based assessment of lysogeny among soil bacteria. Microb Ecol. 2008a;56:437–447. doi: 10.1007/s00248-008-9362-2. [DOI] [PubMed] [Google Scholar]
  76. Williamson SE, McLaughlin MR. Paul JH. Interaction of the ΦHSIC virus with its host: lysogeny or psedolysogeny. Appl Environ Microbiol. 2001;67:1682–1688. doi: 10.1128/AEM.67.4.1682-1688.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Williamson SJ. Paul JH. Environmental factors that influence the transition from lysogenic to lytic existence in the Φ HSIC/Listonella pelagia marine phage-host system. Microb Ecol. 2006;52:217–225. doi: 10.1007/s00248-006-9113-1. [DOI] [PubMed] [Google Scholar]
  78. Williamson SJ, Houchin LA, McDaniel L. Paul JH. Seasonal variation in lysogeny as depicted by prophage induction in Tampa Bay, Florida. Appl Environ Microbiol. 2002;68:4307–4314. doi: 10.1128/AEM.68.9.4307-4314.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Williamson SJ, Cary SC, Williamson KE, Helton RR, Bench SR, Winget D. Wommack KE. Lysogenic virus-host interactions predominate at deep-sea diffuse-flow hydrothermal vents. ISME J. 2008b;2:1112–1121. doi: 10.1038/ismej.2008.73. [DOI] [PubMed] [Google Scholar]
  80. Yamada T, Kawasaki T, Nagata S, Fujiwara A, Usami S. Fujie M. New bacteriophages that infect the phytopathogen Ralstonia solanacearum. Microbiology. 2007;153:2630–2639. doi: 10.1099/mic.0.2006/001453-0. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1. Real-time PCR was used to confirm the identity of global wild-type isolates as Erwinia amylovora. Specific Erwinia spp. Myoviridae and Podoviridae probe-primers were used to screen the global population for the presence of prophages.

Table S2. Isolate confirmation and lysogeny screening of wild-type Pantoea agglomerans isolated from field collected blossoms from southern Ontario, CA.

mbt20008-0510-sd1.doc (506.5KB, doc)

Articles from Microbial Biotechnology are provided here courtesy of Wiley

RESOURCES